eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| von hippel-lindau disease | ||||
| Disease ID | 193 |
|---|---|
| Disease | von hippel-lindau disease |
| Definition | An autosomal dominant disorder caused by mutations in a tumor suppressor gene. This syndrome is characterized by abnormal growth of small blood vessels leading to a host of neoplasms. They include HEMANGIOBLASTOMA in the RETINA; CEREBELLUM; and SPINAL CORD; PHEOCHROMOCYTOMA; pancreatic tumors; and renal cell carcinoma (see CARCINOMA, RENAL CELL). Common clinical signs include HYPERTENSION and neurological dysfunctions. |
| Synonym | angiomatoses, familial cerebello-retinal angiomatoses, familial cerebelloretinal angiomatosis retinae angiomatosis, familial cerebello-retinal angiomatosis, familial cerebelloretinal angiophakomatosis retinae et cerebelli cerebello-retinal angiomatoses, familial cerebello-retinal angiomatosis, familial cerebelloretinal angiomatoses, familial cerebelloretinal angiomatosis, familial cerebroretinal angiomatosis disease hippel lindaus von disease hippel-lindau von familial cerebello retinal angiomatosis familial cerebello-retinal angiomatoses familial cerebello-retinal angiomatosis familial cerebelloretinal angiomatoses familial cerebelloretinal angiomatosis hemangioblastomatosis, cerebelloretinal hippel lindau dis hippel lindau disease hippel lindau syndrome hippel lindau syndrome von hippel lindau von disease hippel lindaus syndrome von hippel-lindau disease lindau dis lindau disease lindau von hippel disease lindau' disease lindau's disease lindau's diseases lindaus dis lindaus disease retinae, angiomatosis syndrome, vhl syndrome, von hippel-lindau syndromes, vhl vhl vhl - von hippel-lindau syndrome vhl syndrome vhl syndromes von hippel lindau dis von hippel lindau disease von hippel lindau syndrome von hippel-lindau disease [disease/finding] von hippel-lindau syndrome von hippel-lindau syndrome (disorder) von hippel-lindau syndrome (vhl) von-hippel lindau disease |
| Orphanet | |
| OMIM | |
| DOID | |
| UMLS | C0019562 |
| MeSH | |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:37) C0206734 | hemangioblastomas | 16 C0007134 | renal cell carcinoma | 12 C0206734 | hemangioblastoma | 8 C0031511 | pheochromocytoma | 7 C0206754 | neuroendocrine tumor | 6 C0019562 | von hippel-lindau disease | 6 C0018916 | hemangioma | 4 C1306837 | papillary renal cell carcinoma | 4 C0007134 | renal cell carcinomas | 4 C0206754 | neuroendocrine tumors | 3 C1332900 | cerebellar hemangioblastoma | 3 C0019562 | von hippel-lindau syndrome | 3 C0031511 | pheochromocytomas | 3 C0001418 | adenocarcinoma | 2 C0010633 | cystadenoma | 2 C0024299 | lymphoma | 2 C0278678 | metastatic renal cell carcinoma | 1 C0152013 | lung adenocarcinoma | 1 C0023467 | acute myeloid leukemia | 1 C0025286 | meningioma | 1 C0018916 | hemangiomas | 1 C0023470 | myeloid leukemia | 1 C0022354 | obstructive jaundice | 1 C0001418 | adenocarcinomas | 1 C0011251 | delusional disorder | 1 C0031511 | phaeochromocytoma | 1 C0242647 | mucosa-associated lymphoma | 1 C0206754 | neuroendocrine tumour | 1 C0037859 | epididymal cyst | 1 C1855995 | l-2-hydroxyglutaric aciduria | 1 C0740457 | renal cancer | 1 C0338106 | colon adenocarcinoma | 1 C0740457 | kidney cancer | 1 C0030421 | paraganglioma | 1 C0032461 | polycythemia | 1 C0030286 | pancreatic disease | 1 C1319315 | colorectal adenocarcinoma | 1 |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:2) |
| Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:2) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:62) 656 | BMP8B | 1.509 | DISEASES 672 | BRCA1 | 1.932 | DISEASES 55845 | BRK1 | 3.873 | DISEASES 768 | CA9 | 2.638 | DISEASES 988 | CDC5L | 1.83 | DISEASES 79577 | CDC73 | 2.679 | DISEASES 1012 | CDH13 | 1.591 | DISEASES 1114 | CHGB | 1.607 | DISEASES 8454 | CUL1 | 1.332 | DISEASES 8453 | CUL2 | 4.156 | DISEASES 7852 | CXCR4 | 1.274 | DISEASES 54583 | EGLN1 | 2.99 | DISEASES 2045 | EPHA7 | 1.416 | DISEASES 2047 | EPHB1 | 1.612 | DISEASES 2271 | FH | 3.145 | DISEASES 2272 | FHIT | 2.356 | DISEASES 2642 | GCGR | 1.738 | DISEASES 2674 | GFRA1 | 1.067 | DISEASES 2959 | GTF2B | 1.453 | DISEASES 23462 | HEY1 | 1.263 | DISEASES 3091 | HIF1A | 3.29 | DISEASES 10524 | KAT5 | 1.013 | DISEASES 11202 | KLK8 | 1.148 | DISEASES 3880 | KRT19 | 1.382 | DISEASES 3855 | KRT7 | 2.291 | DISEASES 100506195 | LARGE-AS1 | 2.244 | DISEASES 131578 | LRRC15 | 1.952 | DISEASES 4158 | MC2R | 1.049 | DISEASES 4221 | MEN1 | 4.706 | DISEASES 2315 | MLANA | 1.363 | DISEASES 64223 | MLST8 | 1.277 | DISEASES 4311 | MME | 1.679 | DISEASES 4763 | NF1 | 4.398 | DISEASES 4771 | NF2 | 2.437 | DISEASES 5021 | OXTR | 1.758 | DISEASES 5076 | PAX2 | 1.835 | DISEASES 7849 | PAX8 | 2.114 | DISEASES 5828 | PEX2 | 1.798 | DISEASES 5314 | PKHD1 | 2.55 | DISEASES 5378 | PMS1 | 1.896 | DISEASES 5573 | PRKAR1A | 1.525 | DISEASES 8842 | PROM1 | 1.28 | DISEASES 5728 | PTEN | 1.962 | DISEASES 5792 | PTPRF | 1.465 | DISEASES 5915 | RARB | 2.081 | DISEASES 11186 | RASSF1 | 1.87 | DISEASES 5979 | RET | 4.817 | DISEASES 6390 | SDHB | 5.522 | DISEASES 6391 | SDHC | 4.942 | DISEASES 6392 | SDHD | 5.648 | DISEASES 6513 | SLC2A1 | 1.794 | DISEASES 23583 | SMUG1 | 1.227 | DISEASES 6794 | STK11 | 1.443 | DISEASES 84260 | TCHP | 1.969 | DISEASES 7068 | THRB | 2.91 | DISEASES 7161 | TP73 | 1.033 | DISEASES 7311 | UBA52 | 1.348 | DISEASES 7422 | VEGFA | 3.298 | DISEASES 391104 | VHLL | 4.494 | DISEASES 7432 | VIP | 1.25 | DISEASES 7490 | WT1 | 1.559 | DISEASES 7516 | XRCC2 | 1.106 | DISEASES |
| Locus | Symbol | Locus(Total Locus:1) VHL | 3p25.3 |
| Disease ID | 193 |
|---|---|
| Disease | von hippel-lindau disease |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:42) HP:0000639 | Nystagmus HP:0100026 | Arteriovenous malformation HP:0005562 | Multiple renal cysts HP:0100742 | Vascular neoplasm HP:0000518 | Cataract HP:0008046 | Abnormality of the retinal vasculature HP:0000541 | Retinal detachment HP:0000365 | Hearing impairment HP:0100585 | Telangiectasia of the skin HP:0000572 | Visual loss HP:0100659 | Abnormality of the cerebral vasculature HP:0100634 | Neuroendocrine neoplasm HP:0007360 | Aplasia/Hypoplasia of the cerebellum HP:0001251 | Ataxia HP:0005584 | Renal cell carcinoma HP:0002167 | Neurological speech impairment HP:0000822 | Hypertension HP:0002017 | Nausea and vomiting HP:0002516 | Increased intracranial pressure HP:0001737 | Pancreatic cysts HP:0000407 | Sensorineural hearing impairment HP:0004374 | Hemiplegia/hemiparesis HP:0005306 | Capillary hemangiomas HP:0000975 | Hyperhidrosis HP:0000003 | Multicystic kidney dysplasia HP:0002664 | Neoplasm HP:0000763 | Sensory neuropathy HP:0001288 | Gait disturbance HP:0002666 | Pheochromocytoma HP:0000077 | Abnormality of the kidney HP:0100799 | Neoplasm of the middle ear HP:0011675 | Arrhythmia HP:0100761 | Visceral angiomatosis HP:0009711 | Retinal hemangioblastoma HP:0100763 | Abnormality of the lymphatic system HP:0002076 | Migraine HP:0009715 | Papillary cystadenoma of the epididymis HP:0000505 | Visual impairment HP:0000113 | Polycystic kidney dysplasia HP:0001732 | Abnormality of the pancreas HP:0000501 | Glaucoma HP:0000238 | Hydrocephalus |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:32) HP:0005584 | Renal cell carcinoma | 12 HP:0002664 | Neoplasia | 10 HP:0010797 | Hemangioblastoma | 9 HP:0030731 | Carcinoma | 9 HP:0002666 | Pheochromocytoma | 8 HP:0030393 | Heffner tumor | 7 HP:0006766 | Papillary renal cell carcinoma | 4 HP:0001028 | Strawberry mark | 4 HP:0005306 | Capillary hemangioma | 3 HP:0009726 | Renal neoplasm | 3 HP:0009711 | Retinal capillary hemangioma | 3 HP:0006880 | Hemangioblastoma, sporadic cerebellar | 3 HP:0009713 | Spinal hemangioblastoma | 2 HP:0002665 | Lymphoma | 2 HP:0001737 | Pancreatic cysts | 1 HP:0002858 | Mengiomia | 1 HP:0010550 | Paraplegia | 1 HP:0001901 | Abnormally shaped erythrocytes | 1 HP:0030078 | Lung adenocarcinoma | 1 HP:0003150 | Glutaric aciduria | 1 HP:0012190 | T cell lymphoma | 1 HP:0030424 | Epididymal cyst | 1 HP:0000969 | Dropsy | 1 HP:0007281 | Developmental stagnation | 1 HP:0000952 | Yellow skin | 1 HP:0002894 | Neoplasia of the pancreas | 1 HP:0004808 | Acute myelogenous leukemia | 1 HP:0012324 | Myeloid leukemia | 1 HP:0009715 | Papillary cystadenoma of the epididymis | 1 HP:0012062 | Bone cysts | 1 HP:0002668 | Paragangliomas | 1 HP:0040144 | L-2-hydroxyglutaric aciduria | 1 |
| Disease ID | 193 |
|---|---|
| Disease | von hippel-lindau disease |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:67) C2700547 | kidney cancer C2700526 | erythrocytosis C2697417 | pheochromocytoma C2608055 | hereditary renal cell carcinoma C2029884 | hearing loss C1963229 | retinal detachment C1860392 | renal hemangioblastoma C1860389 | spinal cord hemangioblastoma C1514915 | retinal hemangioblastoma C1514915 | retinal capillary hemangioblastoma C1411989 | angiomatosis C1378703 | renal carcinoma C1378703 | renal cancer C1336708 | germ cell tumor of testis C1335316 | serous cystadenoma of the pancreas C1332900 | cerebellar hemangioblastoma C0740480 | cerebellar astrocytoma C0740457 | cancer of the kidney C0730303 | retinal capillary hemangioma C0699885 | bladder carcinoma C0549473 | thyroid carcinoma C0547030 | visual disturbances C0524802 | optic nerve tumor C0376293 | stigmata C0345964 | adenoma of the lung C0341486 | pancreatic cystadenoma C0334606 | fibrous meningioma C0334101 | hemangioblastomatosis C0334090 | mesenchymal hamartoma C0279702 | renal clear cell carcinoma C0278678 | metastatic renal cell carcinoma C0267373 | intestinal bleeding C0242363 | pancreatic neuroendocrine tumor C0242363 | pancreatic endocrine neoplasm C0242363 | islet cell tumors C0242363 | islet cell tumor C0221166 | paraparesis C0206754 | neuroendocrine tumors C0206734 | hemangioblastomas C0206734 | hemangioblastoma C0206734 | haemangioblastoma C0206733 | capillary hemangiomas C0154051 | retinal hemangioma C0154051 | retinal angioma C0039145 | syringomyelia C0031511 | pheochromocytomas C0030421 | paragangliomas C0030297 | pancreatic tumor C0030283 | pancreatic cysts C0024441 | macular holes C0024441 | macular hole C0022665 | renal tumour C0022665 | renal tumors C0022665 | renal neoplasm C0022354 | obstructive jaundice C0020598 | hypocalcemia C0019829 | hodgkin's disease C0018916 | hemangiomas C0018916 | hemangioma C0018916 | angiomas C0018552 | hamartoma C0010633 | cystadenomas C0007279 | carotid body paraganglioma C0007134 | renal cell carcinomas C0007134 | renal cell carcinoma C0007134 | renal adenocarcinoma C0005967 | bone tumor |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:21) C0206734 | hemangioblastomas | 11 C0007134 | renal cell carcinoma | 7 C0031511 | pheochromocytoma | 7 C0206734 | hemangioblastoma | 6 C0018916 | hemangioma | 4 C0031511 | pheochromocytomas | 3 C0730303 | retinal capillary hemangioma | 2 C0242363 | pancreatic neuroendocrine tumor | 2 C0022665 | renal tumors | 2 C0206754 | neuroendocrine tumors | 2 C0030297 | pancreatic tumor | 1 C0334101 | hemangioblastomatosis | 1 C1860389 | spinal cord hemangioblastoma | 1 C0007134 | renal cell carcinomas | 1 C0022665 | renal neoplasm | 1 C0085666 | capillary hemangiomas | 1 C0022354 | obstructive jaundice | 1 C0740457 | renal cancer | 1 C1514915 | retinal hemangioblastoma | 1 C1332900 | cerebellar hemangioblastoma | 1 C0278678 | metastatic renal cell carcinoma | 1 |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:65) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs104893824 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10142181 | T | A,C |
| rs104893824 | 10533030 | 7428 | VHL | umls:C0019562 | BeFree | We have identified a family segregating von Hippel-Lindau (VHL) disease with a previously unreported T547A mutation in exon 1 of the VHL gene that causes a Tyr112 to Asn missense alteration in the protein. | 0.658392406 | 1999 | VHL | 3 | 10142181 | T | A,C |
| rs104893825 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10149819 | G | T |
| rs104893829 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10142088 | C | T |
| rs104893830 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10146561 | G | C |
| rs119103277 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10142110 | G | A,C |
| rs148935214 | 19906784 | 5979 | RET | umls:C0019562 | BeFree | RET p.Tyr791Phe and p.Ser649Leu and VHL p.Pro81Ser are definitely not pathogenic mutations for VHL and MEN 2. | 0.012258492 | 2010 | RET | 10 | 43114546 | C | T |
| rs193922608 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10142089 | C | T |
| rs193922609 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10142167 | G | C |
| rs193922610 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10146544 | C | T |
| rs193922611 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10146631 | T | A |
| rs193922613 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10149847 | A | G |
| rs267607170 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10149814 | A | G |
| rs281860296 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10149909 | A | G |
| rs28940298 | 12415268 | 7428 | VHL | umls:C0019562 | BeFree | The gene associated with von Hippel-Lindau syndrome, VHL, maps to this region, and homozygosity with respect to a C-->T missense mutation in VHL, causing an arginine-to-tryptophan change at amino-acid residue 200 (Arg200Trp), was identified in all individuals affected with Chuvash polycythemia. | 0.658392406 | 2002 | VHL | 3 | 10149921 | C | T |
| rs28940298 | 12393546 | 7428 | VHL | umls:C0019562 | UNIPROT | We evaluated the role of VHL in 8 children with a history of polycythemia and an elevated serum Epo level and found 3 different germline VHL mutations in 4 of them. | 0.658392406 | 2003 | VHL | 3 | 10149921 | C | T |
| rs28940298 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10149921 | C | T |
| rs35460768 | 16884327 | 7428 | VHL | umls:C0019562 | BeFree | A family with a medical history suggestive of VHL disease was investigated using DNA sequence analysis to determine the presence of the P25L variant of the VHL protein. | 0.658392406 | 2006 | VHL | 3 | 10141921 | C | T |
| rs35460768 | 11257211 | 7428 | VHL | umls:C0019562 | BeFree | P25L is a rare variant of the VHL gene and cannot be considered a cause of VHL disease. | 0.658392406 | 2001 | VHL | 3 | 10141921 | C | T |
| rs397516440 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10142166 | C | G |
| rs397516441 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10149790 | A | G |
| rs397516442 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10146581 | T | - |
| rs397516443 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10146638 | T | G |
| rs397516444 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10149808 | G | T |
| rs397516445 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10149820 | T | C |
| rs398123481 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10142103 | C | G,T |
| rs398123482 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10142173 | T | A |
| rs398123483 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10149824 | - | TTGTCCGT |
| rs5030622 | 8956040 | 7428 | VHL | umls:C0019562 | UNIPROT | Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan. | 0.658392406 | 1996 | NA | NA | NA | NA | NA |
| rs5030802 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10142055 | G | A,T |
| rs5030803 | 8956040 | 7428 | VHL | umls:C0019562 | UNIPROT | Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan. | 0.658392406 | 1996 | VHL | 3 | 10142068 | T | G |
| rs5030804 | 23842656 | 7428 | VHL | umls:C0019562 | BeFree | p.N78S and p.R161Q germline mutations of the VHL gene are present in von Hippel-Lindau syndrome in two pedigrees. | 0.658392406 | 2013 | VHL | 3 | 10142080 | A | G |
| rs5030804 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10142080 | A | G |
| rs5030804 | 8956040 | 7428 | VHL | umls:C0019562 | UNIPROT | Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan. | 0.658392406 | 1996 | VHL | 3 | 10142080 | A | G |
| rs5030805 | 12000816 | 7428 | VHL | umls:C0019562 | UNIPROT | The group of susceptibility genes for pheochromocytoma that included the proto-oncogene RET (associated with multiple endocrine neoplasia type 2 [MEN-2]) and the tumor-suppressor gene VHL (associated with von Hippel-Lindau disease) now also encompasses the newly identified genes for succinate dehydrogenase subunit D (SDHD) and succinate dehydrogenase subunit B (SDHB), which predispose carriers to pheochromocytomas and glomus tumors. | 0.658392406 | 2002 | VHL | 3 | 10142086 | G | A,T |
| rs5030806 | 8956040 | 7428 | VHL | umls:C0019562 | UNIPROT | Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan. | 0.658392406 | 1996 | NA | NA | NA | NA | NA |
| rs5030807 | 8956040 | 7428 | VHL | umls:C0019562 | UNIPROT | Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan. | 0.658392406 | 1996 | VHL | 3 | 10142113 | T | A,C |
| rs5030808 | 12000816 | 7428 | VHL | umls:C0019562 | UNIPROT | The group of susceptibility genes for pheochromocytoma that included the proto-oncogene RET (associated with multiple endocrine neoplasia type 2 [MEN-2]) and the tumor-suppressor gene VHL (associated with von Hippel-Lindau disease) now also encompasses the newly identified genes for succinate dehydrogenase subunit D (SDHD) and succinate dehydrogenase subunit B (SDHB), which predispose carriers to pheochromocytomas and glomus tumors. | 0.658392406 | 2002 | VHL | 3 | 10142124 | G | A,C |
| rs5030809 | 12000816 | 7428 | VHL | umls:C0019562 | UNIPROT | The group of susceptibility genes for pheochromocytoma that included the proto-oncogene RET (associated with multiple endocrine neoplasia type 2 [MEN-2]) and the tumor-suppressor gene VHL (associated with von Hippel-Lindau disease) now also encompasses the newly identified genes for succinate dehydrogenase subunit D (SDHD) and succinate dehydrogenase subunit B (SDHB), which predispose carriers to pheochromocytomas and glomus tumors. | 0.658392406 | 2002 | VHL | 3 | 10142139 | T | C |
| rs5030809 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10142139 | T | C |
| rs5030811 | 8956040 | 7428 | VHL | umls:C0019562 | UNIPROT | Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan. | 0.658392406 | 1996 | VHL | 3 | 10146516 | C | T |
| rs5030812 | 18836774 | 7428 | VHL | umls:C0019562 | BeFree | Based on this work, we propose that the nsSNP with a SNPid of rs5030812 is an important candidate for the cause of von Hippel-Lindau syndrome via the VHL gene. | 0.658392406 | 2008 | NA | NA | NA | NA | NA |
| rs5030812 | NA | 7428 | VHL | umls:C0019562 | UNIPROT | NA | 0.658392406 | NA | NA | NA | NA | NA | NA |
| rs5030817 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10149786 | G | A |
| rs5030818 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10149804 | C | G,T |
| rs5030818 | NA | 7428 | VHL | umls:C0019562 | UNIPROT | NA | 0.658392406 | NA | VHL | 3 | 10149804 | C | G,T |
| rs5030820 | 12000816 | 7428 | VHL | umls:C0019562 | UNIPROT | The group of susceptibility genes for pheochromocytoma that included the proto-oncogene RET (associated with multiple endocrine neoplasia type 2 [MEN-2]) and the tumor-suppressor gene VHL (associated with von Hippel-Lindau disease) now also encompasses the newly identified genes for succinate dehydrogenase subunit D (SDHD) and succinate dehydrogenase subunit B (SDHB), which predispose carriers to pheochromocytomas and glomus tumors. | 0.658392406 | 2002 | VHL | 3 | 10149822 | C | G,T |
| rs5030820 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10149822 | C | G,T |
| rs5030821 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10149823 | G | A |
| rs5030821 | 12000816 | 7428 | VHL | umls:C0019562 | UNIPROT | The group of susceptibility genes for pheochromocytoma that included the proto-oncogene RET (associated with multiple endocrine neoplasia type 2 [MEN-2]) and the tumor-suppressor gene VHL (associated with von Hippel-Lindau disease) now also encompasses the newly identified genes for succinate dehydrogenase subunit D (SDHD) and succinate dehydrogenase subunit B (SDHB), which predispose carriers to pheochromocytomas and glomus tumors. | 0.658392406 | 2002 | VHL | 3 | 10149823 | G | A |
| rs5030822 | NA | 7428 | VHL | umls:C0019562 | UNIPROT | NA | 0.658392406 | NA | VHL | 3 | 10149856 | T | A |
| rs5030824 | 12000816 | 7428 | VHL | umls:C0019562 | UNIPROT | The group of susceptibility genes for pheochromocytoma that included the proto-oncogene RET (associated with multiple endocrine neoplasia type 2 [MEN-2]) and the tumor-suppressor gene VHL (associated with von Hippel-Lindau disease) now also encompasses the newly identified genes for succinate dehydrogenase subunit D (SDHD) and succinate dehydrogenase subunit B (SDHB), which predispose carriers to pheochromocytomas and glomus tumors. | 0.658392406 | 2002 | VHL | 3 | 10149885 | C | G |
| rs5030824 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10149885 | C | G |
| rs5030826 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10142041 | C | A,G,T |
| rs5030827 | 16502427 | 7428 | VHL | umls:C0019562 | UNIPROT | In each of these four families, the major clinical manifestation of VHL disease is multiple early-onset pheochromocytomas (VHL type 2C). | 0.658392406 | 2006 | VHL | 3 | 10142097 | G | T |
| rs5030827 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10142097 | G | T |
| rs5030830 | 8956040 | 7428 | VHL | umls:C0019562 | UNIPROT | Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan. | 0.658392406 | 1996 | VHL | 3 | 10146526 | T | C |
| rs5030832 | 8956040 | 7428 | VHL | umls:C0019562 | UNIPROT | Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan. | 0.658392406 | 1996 | VHL | 3 | 10146535 | A | G |
| rs5030833 | 12000816 | 7428 | VHL | umls:C0019562 | UNIPROT | The group of susceptibility genes for pheochromocytoma that included the proto-oncogene RET (associated with multiple endocrine neoplasia type 2 [MEN-2]) and the tumor-suppressor gene VHL (associated with von Hippel-Lindau disease) now also encompasses the newly identified genes for succinate dehydrogenase subunit D (SDHD) and succinate dehydrogenase subunit B (SDHB), which predispose carriers to pheochromocytomas and glomus tumors. | 0.658392406 | 2002 | VHL | 3 | 10146580 | T | C,G |
| rs727503744 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10141773 | CGCACGCAGCTCCGCCCCGCG | - |
| rs727504215 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10146524 | G | T |
| rs77724903 | 19906784 | 5979 | RET | umls:C0019562 | BeFree | RET p.Tyr791Phe and p.Ser649Leu and VHL p.Pro81Ser are definitely not pathogenic mutations for VHL and MEN 2. | 0.012258492 | 2010 | RET | 10 | 43118460 | A | T |
| rs794726890 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10142092 | G | C |
| rs794727253 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10146622 | A | - |
| rs794729660 | NA | 7428 | VHL | umls:C0019562 | CLINVAR | NA | 0.658392406 | NA | VHL | 3 | 10142070 | ATC | - |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:18) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0005562 | Multiple renal cysts | MP:0000522 | kidney cortex cysts | abnormal membranous sacs appearing in the outer portion of the kidney located between the renal capsule and the renal medulla and involved in ultrafiltration, containing the renal corpuscles, the renal tubules (except for parts of the loop of Henle which |
| HP:0005584 | Renal cell carcinoma | MP:0013774 | decreased KLRG1-positive T-helper cell number | reduction in the number of CD4-positive alpha-beta T-helper cells expressing KLRG1, a marker associated with activation |
| HP:0000003 | Multicystic kidney dysplasia | MP:0011376 | abnormal kidney corticomedullary boundary morphology | any structural anomaly of the region demarcating the renal medulla from the surrounding cortex; end-stage renal failure may be associated with loss of the normal corticomedullary boundary |
| HP:0000113 | Polycystic kidney dysplasia | MP:0011565 | kidney papillary hypoplasia | underdevelopment or reduced size, usually due to a reduced number of cells, of the apex of the renal pyramid that normally projects into a calyx |
| HP:0008046 | Abnormality of the retinal vasculature | MP:0004686 | decreased length of long bones | reduced end-to-end length of the several elongated bones of the extremities |
| HP:0002017 | Nausea and vomiting | MP:0010426 | abnormal heart and great artery attachment | any anomaly in the in the position or pattern of the connection site of the heart to any of the great arteries, including the pulmonary artery and aorta |
| HP:0000407 | Sensorineural hearing impairment | MP:0006330 | syndromic hearing impairment | hearing impairment that is usually associated with malformations of the external ear and other inherited signs and symptoms |
| HP:0009715 | Papillary cystadenoma of the epididymis | MP:0004499 | increased incidence of tumors by chemical induction | higher than normal frequency of tumor incidence induced by one or more chemical carcinogens or mutagens |
| HP:0000541 | Retinal detachment | MP:0003099 | retinal detachment | detachment of the retina from the underlying inner wall of the eye, often from tension of the vitreous; may occur with aging or as a result of trauma |
| HP:0001732 | Abnormality of the pancreas | MP:0014230 | dilated crypts of Lieberkuhn | |
| HP:0100763 | Abnormality of the lymphatic system | MP:0004502 | decreased incidence of tumors by chemical induction | lower than normal frequency of tumor incidence induced by one or more chemical carcinogens or mutagens |
| HP:0009711 | Retinal capillary hemangioma | MP:0002047 | increased hepatic hemangioma incidence | greater than the expected number of a benign tumor characterized by blood-filled spaces lined by benign endothelial cells in the liver, occurring in a specific population in a given time period |
| HP:0007360 | Aplasia/Hypoplasia of the cerebellum | MP:0012129 | failure of blastocyst formation | inability to form a blastocyst from a solid ball of cells known as a morula |
| HP:0000077 | Abnormality of the kidney | MP:0011665 | d-loop transposition of the great arteries | complete transposition of the great arteries; the d- refers to the dextroposition of the bulboventricular loop (ie, the position of the right ventricle, which is on the right side); in addition, the aorta also tends to be on the right and anterior, and th |
| HP:0001737 | Pancreatic cysts | MP:0011682 | renal glomerulus cysts | abnormal membranous sacs in any portion of the renal glomerulus |
| HP:0100659 | Abnormality of the cerebral vasculature | MP:0004499 | increased incidence of tumors by chemical induction | higher than normal frequency of tumor incidence induced by one or more chemical carcinogens or mutagens |
| HP:0100585 | Telangiectasia of the skin | MP:0011022 | abnormal circadian regulation of systemic arterial blood pressure | any anomaly in the process in which an organism modulates its blood pressure at different values with a regularity of approximately 24 hours |
| HP:0000572 | Visual loss | MP:0011352 | proximal convoluted tubule brush border loss | attenuation or degeneration of the microvillus brush border normally present on the luminal surface of epithelial cells of the proximal convoluted tubule; may be associated with renal tubular injury and/or cystic changes |
Mapped by homologous gene(Total Items:40) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0008046 | Abnormality of the retinal vasculature | MP:0014059 | abnormal photoreceptor connecting cilium morphology | any structural anomaly of the nonmotile primary cilium that has a 9+0 microtubule array and forms the portion of the axoneme traversing the boundary between the retinal photoreceptor inner and outer segments |
| HP:0002664 | Neoplasm | MP:0020154 | impaired humoral immune response | impaired response of the immune system that mediates secreted antibodies produced in B cells |
| HP:0011675 | Arrhythmia | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0009715 | Papillary cystadenoma of the epididymis | MP:0011110 | preweaning lethality, incomplete penetrance | the appearance of lower than Mendelian ratios of organisms of a given genotype due to death of some, but not all of the organisms between fertilization and weaning age (Mus: approximately 3-4 weeks of age) |
| HP:0002516 | Increased intracranial pressure | MP:0020215 | impaired blood coagulation | impaired ability of the blood to clot |
| HP:0001288 | Gait disturbance | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0000238 | Hydrocephalus | MP:0020080 | increased bone mineralization | increase in the rate at which minerals are deposited into bone |
| HP:0000501 | Glaucoma | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0004374 | Hemiplegia/hemiparesis | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0100763 | Abnormality of the lymphatic system | MP:0012431 | increased lymphoma incidence | greater than the expected number of neoplasms characterized by a proliferation of malignant lymphocytes in lymphoid tissue in a specific population in a given time period |
| HP:0000003 | Multicystic kidney dysplasia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0005562 | Multiple renal cysts | MP:0011108 | embryonic lethality during organogenesis, incomplete penetrance | the appearance of lower than Mendelian ratios of organisms of a given genotype due to death of some, but not all of the organisms between embryo turning and the completion of organogenesis (Mus: E9-9.5 to less than E14) |
| HP:0000407 | Sensorineural hearing impairment | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0100742 | Vascular neoplasm | MP:0011967 | increased or absent threshold for auditory brainstem response | increase in the value at which one or more sound frequencies or broadband clicks first elicits a recordable response generated by electrical activity of neurons in the ascending auditory system, or complete lack of a recordable response at any frequency o |
| HP:0000518 | Cataract | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000541 | Retinal detachment | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000077 | Abnormality of the kidney | MP:0013294 | prenatal lethality prior to heart atrial septation | death prior to the completion of heart atrial septation (Mus: E14.5-15.5) |
| HP:0007360 | Aplasia/Hypoplasia of the cerebellum | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0002017 | Nausea and vomiting | MP:0020220 | decreased tear production | decreased production of the amount of fluid produced in the eye |
| HP:0100659 | Abnormality of the cerebral vasculature | MP:0020220 | decreased tear production | decreased production of the amount of fluid produced in the eye |
| HP:0000975 | Hyperhidrosis | MP:0020187 | altered susceptibility to prion infection | altered likelihood that an organism will develop ill effects from the small proteinaceous infectious particles which are resistant to inactivation by procedures that modify nucleic acids and which contain an abnormal isoform of a cellular protein that is |
| HP:0005306 | Capillary hemangiomas | MP:0013956 | decreased colon length | reduced length of the portion of the large intestine between the cecum and the rectum |
| HP:0009711 | Retinal capillary hemangioma | MP:0011108 | embryonic lethality during organogenesis, incomplete penetrance | the appearance of lower than Mendelian ratios of organisms of a given genotype due to death of some, but not all of the organisms between embryo turning and the completion of organogenesis (Mus: E9-9.5 to less than E14) |
| HP:0100761 | Visceral angiomatosis | MP:0014171 | increased fatty acid oxidation | increased rate or incidence of the process of removal of one or more electrons from a fatty acid, with or without the concomitant removal of a proton or protons, by reaction with an electron-accepting substance, by addition of oxygen or by removal of hydr |
| HP:0000365 | Hearing impairment | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000113 | Polycystic kidney dysplasia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001251 | Ataxia | MP:0020301 | short tongue | decreased length of the mobile mass of muscular tissue and surrounding epithelial tissue occupying the cavity of the mouth and forming part of the floor |
| HP:0002666 | Pheochromocytoma | MP:0013774 | decreased KLRG1-positive T-helper cell number | reduction in the number of CD4-positive alpha-beta T-helper cells expressing KLRG1, a marker associated with activation |
| HP:0002076 | Migraine | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0000639 | Nystagmus | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0001737 | Pancreatic cysts | MP:0013293 | embryonic lethality prior to tooth bud stage | death prior to the appearance of tooth buds (Mus: E12-E12.5) |
| HP:0001732 | Abnormality of the pancreas | MP:0014233 | bile duct epithelium hyperplasia | |
| HP:0002167 | Neurological speech impairment | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0100026 | Arteriovenous malformation | MP:0014179 | abnormal blood-retinal barrier function | anomaly in the function of the part of the blood-ocular barrier that consists of cells that are joined tightly together to prevent certain substances from entering the tissue of the retina; the BRB consists of non-fenestrated capillaries of the retinal ci |
| HP:0000572 | Visual loss | MP:0020194 | abnormal glycosphingolipid level | any anomaly in the concentrations of glycosphingolipids, a subtype of glycolipids containing the amino alcohol sphingosine, in the body |
| HP:0005584 | Renal cell carcinoma | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0100585 | Telangiectasia of the skin | MP:0014127 | increased thymoma incidence | greater than the expected number of a malignant neoplasm originating from the epithelial cells of the thymus, occurring in a specific population in a given time period; thymoma is an uncommon tumor linked with myasthenia gravis and other autoimmune diseas |
| HP:0000505 | Visual impairment | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000822 | Hypertension | MP:0020216 | decreased circulating complement protein level | less than normal levels of the serum proteins that act sequentially to allow for the direct killing of microbes, the disposal of immune complexes, and the regulation of other immune processes |
| HP:0000763 | Sensory neuropathy | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| Disease ID | 193 |
|---|---|
| Disease | von hippel-lindau disease |
| Case | (Waiting for update.) |