Home Contact Sitemap

eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine



   van der woude syndrome
  

Disease ID 294
Disease van der woude syndrome
Definition
A rare autosomal dominant syndrome caused by mutations in the IRF6 gene. It is characterized by a cleft palate and/or pits on the lower lip. Other signs and symptoms include absent teeth, palate and tongue deformities.
Synonym
cleft lip and-or palate with mucous cysts of lower lip
cleft lip and/or palate with mucous cysts of lower lip
der syndrome van woudes
lip pit syndrome
lip-pit syndrome
lip-pit-cleft lip syndrome
pit
van der woude syndrome (disorder)
van der woude syndrome 1
van der woude's syndrome
vdws
vws1
Orphanet
OMIM
DOID
UMLS
C0175697
SNOMED-CT
Curated Gene
Entrez_id | Symbol | Resource(Total Genes:2)
57822  |  GRHL3  |  ORPHANET
3664  |  IRF6  |  CLINVAR;CTD_human;GHR;ORPHANET;UNIPROT
Inferring Gene
Entrez_id | Symbol | Resource(Total Genes:1)
3664  |  IRF6  |  CIPHER;CTD_human
Text Mined Gene
Entrez_id | Symbol | Score | Resource(Total Genes:21)
1063  |  CENPF  |  2.281  |  DISEASES
6900  |  CNTN2  |  2.752  |  DISEASES
2304  |  FOXE1  |  1.532  |  DISEASES
50486  |  G0S2  |  2.503  |  DISEASES
2737  |  GLI3  |  1.107  |  DISEASES
2932  |  GSK3B  |  1.686  |  DISEASES
3663  |  IRF5  |  1.507  |  DISEASES
3664  |  IRF6  |  7.874  |  DISEASES
3714  |  JAG2  |  1.768  |  DISEASES
128209  |  KLF17  |  3.051  |  DISEASES
3914  |  LAMB3  |  1.97  |  DISEASES
8481  |  OFD1  |  2.341  |  DISEASES
83695  |  RHNO1  |  1.004  |  DISEASES
54101  |  RIPK4  |  2.844  |  DISEASES
2810  |  SFN  |  2.388  |  DISEASES
9901  |  SRGAP3  |  2.763  |  DISEASES
6427  |  SRSF2  |  1.594  |  DISEASES
79718  |  TBL1XR1  |  2.243  |  DISEASES
7020  |  TFAP2A  |  2.715  |  DISEASES
7042  |  TGFB2  |  1.792  |  DISEASES
113452  |  TMEM54  |  2.045  |  DISEASES
Locus
Symbol | Locus(Total Locus:2)
IRF6  |  1q32.2
GRHL3  |  1p36.11
Disease ID 294
Disease van der woude syndrome
Integrated Phenotype
HPO | Name(Total Integrated Phenotypes:9)
HP:0000175  |  Cleft palate
HP:0010286  |  Abnormality of the salivary glands
HP:0000204  |  Cleft upper lip
HP:0000196  |  Lower lip pit
HP:0000193  |  Uvula bifida
HP:0000668  |  Hypodontia
HP:0100267  |  Lip pit
HP:0000175  |  Palatoschisis
HP:0000668  |  Failure of development of between one and six teeth
Text Mined Phenotype
HPO | Name | Sentences' Count(Total Phenotypes:2)
HP:0100267  |  Lip pit  |  4
HP:0000196  |  Lower lip pit  |  2
Disease ID 294
Disease van der woude syndrome
Manually Symptom
UMLS  | Name(Total Manually Symptoms:1)
C0679466  |  cognitive deficits
Text Mined Symptom(Waiting for update.)
Manually Genotype(Total Manually Genotypes:1)
Gene Mutation DOI Article Title
IRF6Het del whole genedoi:10.1038/gim.2011.65Exon-level array CGH in a large clinical cohort demonstrates increased sensitivity of diagnostic testing for Mendelian disorders
Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)
All Snps(Total Genotypes:19)
snpId pubmedId geneId geneSymbol diseaseId sourceId sentence score Year geneSymbol_dbSNP CHROMOSOME POS REF ALT
rs121434224NA3664IRF6umls:C0175697CLINVARNA0.575396242NAIRF61209796453CA
rs121434228NA3664IRF6umls:C0175697CLINVARNA0.575396242NAIRF61209789709CT
rs121434229146184173664IRF6umls:C0175697UNIPROTNovel IRF6 mutations in Japanese patients with Van der Woude syndrome: two missense mutations (R45Q and P396S) and a 17-kb deletion.0.5753962422003IRF61209801280CT
rs121434229146184173664IRF6umls:C0175697BeFreeNovel IRF6 mutations in Japanese patients with Van der Woude syndrome: two missense mutations (R45Q and P396S) and a 17-kb deletion.0.5753962422003IRF61209801280CT
rs121434229NA3664IRF6umls:C0175697CLINVARNA0.575396242NAIRF61209801280CT
rs121434230146184173664IRF6umls:C0175697BeFreeNovel IRF6 mutations in Japanese patients with Van der Woude syndrome: two missense mutations (R45Q and P396S) and a 17-kb deletion.0.5753962422003IRF61209788638GA
rs121434230NA3664IRF6umls:C0175697CLINVARNA0.575396242NAIRF61209788638GA
rs121434231NA3664IRF6umls:C0175697CLINVARNA0.575396242NAIRF61209790539CA
rs200166664NA3664IRF6umls:C0175697CLINVARNA0.575396242NAIRF61209788625CA,G,T
rs28942093122190903664IRF6umls:C0175697UNIPROTThe gene encoding IRF6 is located in the critical region for the Van der Woude syndrome (VWS; OMIM 119300) locus at chromosome 1q32-q41 (refs 2,3).0.5753962422002IRF61209801409GA
rs28942093NA3664IRF6umls:C0175697CLINVARNA0.575396242NAIRF61209801409GA
rs28942094129205753664IRF6umls:C0175697UNIPROTNovel mutations in the IRF6 gene for Van der Woude syndrome.0.5753962422003IRF61209801398GA
rs28942094NA3664IRF6umls:C0175697CLINVARNA0.575396242NAIRF61209801398GA
rs28942095129205753664IRF6umls:C0175697UNIPROTNovel mutations in the IRF6 gene for Van der Woude syndrome.0.5753962422003IRF61209788626GA
rs28942095NA3664IRF6umls:C0175697CLINVARNA0.575396242NAIRF61209788626GA
rs387906967NA3664IRF6umls:C0175697CLINVARNA0.575396242NAIRF61209801349AG
rs397515434NA3664IRF6umls:C0175697CLINVARNA0.575396242NAIRF61209801269GA
rs587776569NA3664IRF6umls:C0175697CLINVARNA0.575396242NAIRF61209790667GTCCAGCAGCTTGCTAGTGT
rs769068305NA3664IRF6umls:C0175697CLINVARNA0.575396242NAIRF61209788614CG
GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)
GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)
Mapped by lexical matching(Total Items:4)
HP ID HP Name MP ID MP Name Annotation
HP:0000204Cleft upper lipMP:0005170cleft upper lipdefect in the upper lip where the maxillary prominence fails to merge with the merged medial nasal prominences
HP:0000175Cleft palateMP:0013550abnormal secondary palate morphology
HP:0010286Abnormality of the salivary glandsMP:0009657failure of chorioallantoic fusionfailure to initiate and/or complete the formation of a highly vascularized extra-embryonic fetal membrane by fusion of the chorion and allantois
HP:0000196Lower lip pitMP:0006306abnormal nasal pit morphologyany structural anomaly of one or both of a pair of depressions formed in the developing face that give rise to the rostral portion of the nasal meatus; the nasal pits indent the fronto-nasal process and divide it into a medial and two lateral nasal proces
Mapped by homologous gene(Total Items:7)
HP ID HP Name MP ID MP Name Annotation
HP:0000193Bifid uvulaMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0010286Abnormality of the salivary glandsMP:0020039increased bone ossificationincrease in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance
HP:0100267Lip pitMP:0013818abnormal oral cavity morphologyany structural anomaly of the anatomical cavity at the start of the digestive tract that is enclosed by the mouth
HP:0000204Cleft upper lipMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0000175Cleft palateMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000668HypodontiaMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0000196Lower lip pitMP:0013818abnormal oral cavity morphologyany structural anomaly of the anatomical cavity at the start of the digestive tract that is enclosed by the mouth
Disease ID 294
Disease van der woude syndrome
Case(Waiting for update.)