| usher syndrome type 1 | ||||
| Disease ID | 616 |
|---|---|
| Disease | usher syndrome type 1 |
| Definition | A syndrome characterized by congenital, bilateral, severe sensorineural hearing loss, abnormalities in the vestibular system, and adolescent-onset retinitis pigmentosa. |
| Synonym | retinitis pigmentosa and congenital deafness us1 ush1 usher syndrome type 1 (disorder) usher syndrome, type i |
| Orphanet | |
| OMIM | |
| UMLS | C1568247 |
| SNOMED-CT | |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:56) 60509 | AGBL5 | 3.138 | DISEASES 11214 | AKAP13 | 1.6 | DISEASES 136371 | ASB10 | 2.699 | DISEASES 491 | ATP2B2 | 2.096 | DISEASES 53335 | BCL11A | 1.275 | DISEASES 64919 | BCL11B | 2.62 | DISEASES 64072 | CDH23 | 7.045 | DISEASES 92211 | CDHR1 | 2.573 | DISEASES 10519 | CIB1 | 3.305 | DISEASES 7401 | CLRN1 | 4.77 | DISEASES 23418 | CRB1 | 1.2 | DISEASES 9732 | DOCK4 | 2.364 | DISEASES 2035 | EPB41 | 1.206 | DISEASES 346007 | EYS | 1.891 | DISEASES 8322 | FZD4 | 1.337 | DISEASES 2582 | GALE | 2.305 | DISEASES 2706 | GJB2 | 2.749 | DISEASES 2821 | GPI | 2.28 | DISEASES 2925 | GRPR | 1.033 | DISEASES 2932 | GSK3B | 1.172 | DISEASES 55733 | HHAT | 1.594 | DISEASES 3376 | IARS | 1.665 | DISEASES 3399 | ID3 | 1.312 | DISEASES 3614 | IMPDH1 | 1.844 | DISEASES 3714 | JAG2 | 1.343 | DISEASES 133746 | JMY | 3.012 | DISEASES 25802 | LMOD1 | 1.916 | DISEASES 348801 | LNP1 | 2.506 | DISEASES 474354 | LRRC18 | 3.518 | DISEASES 9863 | MAGI2 | 2.097 | DISEASES 744 | MPPED2 | 2.535 | DISEASES 4647 | MYO7A | 7.103 | DISEASES 11165 | NUDT3 | 2.245 | DISEASES 4976 | OPA1 | 1.425 | DISEASES 5021 | OXTR | 1.239 | DISEASES 27328 | PCDH11X | 3 | DISEASES 65217 | PCDH15 | 7.225 | DISEASES 9659 | PDE4DIP | 2.683 | DISEASES 79955 | PDZD7 | 2.696 | DISEASES 11284 | PNKP | 2.327 | DISEASES 5456 | POU3F4 | 1.55 | DISEASES 5457 | POU4F1 | 1.577 | DISEASES 5515 | PPP2CA | 1.567 | DISEASES 5537 | PPP6C | 1.552 | DISEASES 5962 | RDX | 1.136 | DISEASES 51460 | SFMBT1 | 2.37 | DISEASES 9498 | SLC4A8 | 2.444 | DISEASES 6427 | SRSF2 | 1.169 | DISEASES 161497 | STRC | 2.363 | DISEASES 129685 | TAF8 | 2.192 | DISEASES 51616 | TAF9B | 3.563 | DISEASES 6975 | TECTB | 2.947 | DISEASES 25893 | TRIM58 | 2.926 | DISEASES 11078 | TRIOBP | 2.736 | DISEASES 124997 | WDR81 | 4.896 | DISEASES 29062 | WDR91 | 5.386 | DISEASES |
| Locus | Symbol | Locus(Total Locus:9) |
| Disease ID | 616 |
|---|---|
| Disease | usher syndrome type 1 |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:22) HP:0001263 | Global developmental delay HP:0000518 | Cataract HP:0000682 | Abnormality of dental enamel HP:0000572 | Visual loss HP:0000512 | Abnormal electroretinogram HP:0007360 | Aplasia/Hypoplasia of the cerebellum HP:0001251 | Ataxia HP:0008499 | High-grade hypermetropia HP:0012157 | Subcortical cerebral atrophy HP:0007730 | Iris hypopigmentation HP:0002120 | Cerebral cortical atrophy HP:0000407 | Sensorineural hearing impairment HP:0000739 | Anxiety HP:0000375 | Abnormality of cochlea HP:0001249 | Intellectual disability HP:0012377 | Hemianopsia HP:0001756 | Vestibular hypofunction HP:0000575 | Scotoma HP:0100753 | Schizophrenia HP:0000738 | Hallucinations HP:0000716 | Depression HP:0000662 | Nyctalopia |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:2) |
| Disease ID | 616 |
|---|---|
| Disease | usher syndrome type 1 |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:96) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs1052030 | 15660226 | 4647 | MYO7A | umls:C1568247 | UNIPROT | The present study suggests that mutations in MYO7A and CDH23 are the two major components of causes for USH1, while PCDH15, USH1C, and SANS are less frequent causes. | 0.325971721 | 2005 | MYO7A | 11 | 77142737 | T | A,C |
| rs111033174 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156683 | C | T |
| rs111033175 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77208781 | A | G |
| rs111033178 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77190108 | G | A |
| rs111033180 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77172850 | C | T |
| rs111033181 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156022 | T | A |
| rs111033182 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77202357 | C | T |
| rs111033187 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156018 | - | C |
| rs111033192 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77207370 | G | A,T |
| rs111033198 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77211170 | C | T |
| rs111033201 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77174825 | C | A,T |
| rs111033202 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77192191 | C | - |
| rs111033206 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77162854 | G | A |
| rs111033214 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77189348 | G | A |
| rs111033215 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77206108 | G | A |
| rs111033219 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77162179 | - | GCA |
| rs111033232 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77208459 | CTT | - |
| rs111033233 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77181589 | G | A,T |
| rs111033238 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156771 | C | - |
| rs111033239 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77189372 | C | - |
| rs111033250 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77208697 | G | A |
| rs111033259 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77198597 | AGATCATG | CA |
| rs111033276 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77203099 | - | C |
| rs111033283 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156909 | G | A |
| rs111033284 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156991 | G | A |
| rs111033285 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77158426 | T | G |
| rs111033286 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77162146 | C | T |
| rs111033290 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77175465 | G | A |
| rs111033337 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77198493 | A | C |
| rs111033347 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77190710 | A | - |
| rs111033388 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77214682 | - | TGAGCAAACAGCGGGGCTCCA |
| rs111033389 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77162989 | G | A |
| rs111033390 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77189384 | - | CA |
| rs111033403 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156018 | C | A,T |
| rs111033404 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77174915 | G | A,C |
| rs111033415 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77162118 | A | G |
| rs111033426 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77142708 | G | A |
| rs111033433 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77183109 | C | - |
| rs111033448 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156685 | G | - |
| rs111033482 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77189373 | A | C |
| rs111033486 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156900 | A | G |
| rs111033510 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77174772 | - | AG |
| rs121965079 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156069 | C | A,T |
| rs121965085 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77174816 | C | T |
| rs139889944 | 9718356 | 4647 | MYO7A | umls:C1568247 | UNIPROT | Mutations in the myosin VIIA gene cause a wide phenotypic spectrum, including atypical Usher syndrome. | 0.325971721 | 1998 | MYO7A | 11 | 77199771 | G | A |
| rs199606180 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77206120 | C | T |
| rs28934610 | 8900236 | 4647 | MYO7A | umls:C1568247 | UNIPROT | Myosin VIIA mutation screening in 189 Usher syndrome type 1 patients. | 0.325971721 | 1996 | MYO7A | 11 | 77156904 | G | A |
| rs28934610 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156904 | G | A |
| rs35689081 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77142783 | C | A,T |
| rs368657015 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77205554 | T | C |
| rs369125667 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77142767 | C | T |
| rs369458838 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77190773 | C | T |
| rs376764423 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77208472 | C | T |
| rs377670513 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77211909 | C | T |
| rs397516281 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77160179 | T | C |
| rs397516283 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77160283 | G | A |
| rs397516284 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77142827 | G | A |
| rs397516285 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77147806 | G | A |
| rs397516290 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77172788 | - | CAGCCA |
| rs397516291 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77174783 | C | T |
| rs397516294 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77175449 | C | - |
| rs397516295 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77179044 | G | T |
| rs397516301 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77189412 | G | A |
| rs397516303 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77190085 | AAGGACCTTTG | - |
| rs397516304 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77190117 | - | C |
| rs397516308 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77194494 | G | A |
| rs397516310 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77197568 | T | C |
| rs397516312 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156079 | G | A,T |
| rs397516315 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77199787 | T | A |
| rs397516316 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77204065 | A | G |
| rs397516317 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77204141 | C | T |
| rs397516320 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77205562 | - | C |
| rs397516321 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77205598 | C | T |
| rs397516322 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77205599 | G | A |
| rs397516323 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77207350 | T | C |
| rs397516324 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156776 | T | C |
| rs397516326 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77208777 | G | - |
| rs397516330 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77213858 | A | G |
| rs397516331 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77213919 | C | A |
| rs397516332 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77214608 | G | A,T |
| rs41298133 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156969 | C | T |
| rs606231379 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77162854 | G | - |
| rs727503329 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77190838 | G | A |
| rs727504541 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77204213 | A | C |
| rs730880367 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77211331 | - | G |
| rs773844428 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77208720 | C | T |
| rs781811444 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77155908 | C | T |
| rs781988557 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77181548 | G | A |
| rs782252317 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77142763 | G | A |
| rs797044490 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77158400 | ATCC | - |
| rs797044491 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77158404 | T | A |
| rs797044510 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156092 | G | A |
| rs797044511 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77160980 | A | G |
| rs797044512 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77156958 | C | T |
| rs797044513 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77189404 | TGCCCGGG | A |
| rs797044518 | NA | 4647 | MYO7A | umls:C1568247 | CLINVAR | NA | 0.325971721 | NA | MYO7A | 11 | 77130635 | A | G |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:7) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0000407 | Sensorineural hearing impairment | MP:0006330 | syndromic hearing impairment | hearing impairment that is usually associated with malformations of the external ear and other inherited signs and symptoms |
| HP:0002120 | Cerebral cortical atrophy | MP:0012506 | brain atrophy | acquired diminution of the size of the brain associated with wasting as from death and reabsorbtion of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal chan |
| HP:0001263 | Global developmental delay | MP:0002084 | abnormal developmental patterning | abnormal systematic arrangement of the developing body along an axis |
| HP:0007730 | Iris hypopigmentation | MP:0005408 | hypopigmentation | dilution of pigment in any or all tissues or a part of a tissue |
| HP:0007360 | Aplasia/Hypoplasia of the cerebellum | MP:0012129 | failure of blastocyst formation | inability to form a blastocyst from a solid ball of cells known as a morula |
| HP:0000682 | Abnormality of dental enamel | MP:0012069 | abnormal horizontal basal cell of olfactory epithelium morphology | any structural anomaly of the flat or angular epithelial cell with condensed nuclei and darkly staining cytoplasm containing numerous intermediate filaments inserted into desmosomes contacting surrounding supporting cells, that lie in contact with the bas |
| HP:0000572 | Visual loss | MP:0011352 | proximal convoluted tubule brush border loss | attenuation or degeneration of the microvillus brush border normally present on the luminal surface of epithelial cells of the proximal convoluted tubule; may be associated with renal tubular injury and/or cystic changes |
Mapped by homologous gene(Total Items:20) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0000407 | Sensorineural hearing impairment | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000739 | Anxiety | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001263 | Global developmental delay | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000572 | Visual loss | MP:0020194 | abnormal glycosphingolipid level | any anomaly in the concentrations of glycosphingolipids, a subtype of glycolipids containing the amino alcohol sphingosine, in the body |
| HP:0000575 | Scotoma | MP:0014059 | abnormal photoreceptor connecting cilium morphology | any structural anomaly of the nonmotile primary cilium that has a 9+0 microtubule array and forms the portion of the axoneme traversing the boundary between the retinal photoreceptor inner and outer segments |
| HP:0001756 | Vestibular hypofunction | MP:0014164 | abnormal ciliary process morphology | any structural anomaly of any of the pigmented processes that radiate from the ciliary muscle and give attachments to ligaments supporting the lens of the eye; these processes increase in thickness as they advance from the orbiculus ciliaris to the exter |
| HP:0000518 | Cataract | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000512 | Abnormal electroretinogram | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002120 | Cerebral cortical atrophy | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001249 | Intellectual disability | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0000738 | Hallucinations | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0000716 | Depression | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0000662 | Nyctalopia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0007360 | Aplasia/Hypoplasia of the cerebellum | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0001251 | Ataxia | MP:0020301 | short tongue | decreased length of the mobile mass of muscular tissue and surrounding epithelial tissue occupying the cavity of the mouth and forming part of the floor |
| HP:0007730 | Iris hypopigmentation | MP:0014164 | abnormal ciliary process morphology | any structural anomaly of any of the pigmented processes that radiate from the ciliary muscle and give attachments to ligaments supporting the lens of the eye; these processes increase in thickness as they advance from the orbiculus ciliaris to the exter |
| HP:0012377 | Hemianopia | MP:0013405 | increased circulating lactate level | greater amount of lactate in the blood which is produced from pyruvate by lactate dehydrogenase |
| HP:0000682 | Abnormality of dental enamel | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0008499 | High-grade hypermetropia | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0100753 | Schizophrenia | MP:0013787 | photophobia | abnormal aversion or avoidance behavior in response to light; photophobia is symptom of abnormal intolerance to visual perception of light; as a medical symptom, photophobia is not a morbid fear or phobia, but an experience of discomfort or pain to the e |
| Disease ID | 616 |
|---|---|
| Disease | usher syndrome type 1 |
| Case | (Waiting for update.) |