Home Contact Sitemap

eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine



   sjogren-larsson syndrome
  

Disease ID 301
Disease sjogren-larsson syndrome
Definition
An autosomal recessive neurocutaneous disorder characterized by severe ichthyosis MENTAL RETARDATION; SPASTIC PARAPLEGIA; and congenital ICHTHYOSIS. It is caused by mutation of gene encoding microsomal fatty ALDEHYDE DEHYDROGENASE leading to defect in fatty alcohol metabolism.
Synonym
congenital icthyosis mental retardation spasticity syndrome
faldh deficiency
fao - fatty alcohol-nicotinamide adenine dinucleotide oxidase-reductase deficiency
fatty alcohol-nicotinamide adenine dinucleotide oxidoreductase deficiency
fatty alcohol:nad+ oxidoreductase deficiency
fatty aldehyde dehydrogenase defic dis
fatty aldehyde dehydrogenase deficiency
fatty aldehyde dehydrogenase deficiency disease
ichthyosis oligophrenia syndrome
ichthyosis, spastic neurologic disorder, and oligophrenia
sjogren - larsson syndrome
sjogren larsson syndrome
sjogren-larsson syndrome (disorder)
sjogren-larsson syndrome [disease/finding]
sjogren-larsson's syndrome
sjögren-larsson syndrome
sjögren-larsson syndrome (disorder)
sjögren-larsson's syndrome
sls
Orphanet
OMIM
DOID
UMLS
C0037231
MeSH
SNOMED-CT
Comorbidity
UMLS | Disease | Sentences' Count(Total Sentences:2)
C0020757  |  ichthyosis  |  2
C0023882  |  spastic diplegia  |  1
Curated Gene
Entrez_id | Symbol | Resource(Total Genes:1)
224  |  ALDH3A2  |  CLINVAR;CTD_human;GHR;ORPHANET;UNIPROT
Inferring Gene
Entrez_id | Symbol | Resource(Total Genes:1)
224  |  ALDH3A2  |  CIPHER;CTD_human
Text Mined Gene
Entrez_id | Symbol | Score | Resource(Total Genes:3)
26090  |  ABHD12  |  4.256  |  DISEASES
224  |  ALDH3A2  |  6.688  |  DISEASES
10908  |  PNPLA6  |  3.077  |  DISEASES
Locus(Waiting for update.)
Disease ID 301
Disease sjogren-larsson syndrome
Integrated Phenotype
HPO | Name(Total Integrated Phenotypes:11)
HP:0007305  |  Demyelination in central white matter
HP:0001257  |  Spasticity
HP:0001250  |  Seizures
HP:0004322  |  Stature below 3rd percentile
HP:0001249  |  Mental retardation
HP:0002942  |  Thoracic kyphosis
HP:0007727  |  Superficial corneal opacities
HP:0000608  |  Macular degeneration
HP:0000613  |  Extreme light sensitivity
HP:0006297  |  Hypoplasia of tooth enamel
HP:0008064  |  Ichthyosis
Text Mined Phenotype
HPO | Name | Sentences' Count(Total Phenotypes:4)
HP:0008064  |  Ichthyosis  |  2
HP:0001264  |  Spastic diplegia  |  1
HP:0001263  |  Developmental retardation  |  1
HP:0000989  |  pruritis  |  1
Disease ID 301
Disease sjogren-larsson syndrome
Manually Symptom(Waiting for update.)
Text Mined Symptom(Waiting for update.)
Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)
Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)
All Snps(Total Genotypes:17)
snpId pubmedId geneId geneSymbol diseaseId sourceId sentence score Year geneSymbol_dbSNP CHROMOSOME POS REF ALT
rs387906254NA224ALDH3A2umls:C0037231CLINVARNA0.514129238NAALDH3A21719656415T-
rs387906255NA224ALDH3A2umls:C0037231CLINVARNA0.514129238NAALDH3A21719661137G-
rs387906256NA224ALDH3A2umls:C0037231CLINVARNA0.514129238NAALDH3A21719671810GA-
rs387906257NA224ALDH3A2umls:C0037231CLINVARNA0.514129238NAALDH3A21719671824-ACAAA
rs6793911410577908224ALDH3A2umls:C0037231UNIPROTThe molecular basis of Sjögren-Larsson syndrome: mutation analysis of the fatty aldehyde dehydrogenase gene.0.5141292381999ALDH3A21719671852AG
rs72547554NA224ALDH3A2umls:C0037231CLINVARNA0.514129238NAALDH3A21719648999CG,T
rs72547562NA224ALDH3A2umls:C0037231CLINVARNA0.514129238NAALDH3A21719656445CT
rs72547564NA224ALDH3A2umls:C0037231CLINVARNA0.514129238NAALDH3A21719656535GA
rs7254756610577908224ALDH3A2umls:C0037231UNIPROTThe molecular basis of Sjögren-Larsson syndrome: mutation analysis of the fatty aldehyde dehydrogenase gene.0.5141292381999ALDH3A21719657746CT
rs72547569NA224ALDH3A2umls:C0037231CLINVARNA0.514129238NAALDH3A21719657862GC
rs72547571NA224ALDH3A2umls:C0037231CLINVARNA0.514129238NAALDH3A21719663335CT
rs72547575NA224ALDH3A2umls:C0037231CLINVARNA0.514129238NAALDH3A21719664997AG
rs730880264NA224ALDH3A2umls:C0037231CLINVARNA0.514129238NAALDH3A21719663333CCCGGGCTAAAAGTACTGTTGGGG
rs786204625NA224ALDH3A2umls:C0037231CLINVARNA0.514129238NAALDH3A21719663492A-
rs786204677NA224ALDH3A2umls:C0037231CLINVARNA0.514129238NAALDH3A21719657867GA
rs786204741NA224ALDH3A2umls:C0037231CLINVARNA0.514129238NAALDH3A21719652633G-
rs786204759NA224ALDH3A2umls:C0037231CLINVARNA0.514129238NAALDH3A21719661229GCTCC
GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)
GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)
Mapped by lexical matching(Total Items:4)
HP ID HP Name MP ID MP Name Annotation
HP:0002942Thoracic kyphosisMP:0000160kyphosisforward curvature of the spine, characterized by extensive flexion
HP:0006297Hypoplasia of dental enamelMP:0020010decreased bone mineral density of femurreduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh
HP:0007305CNS demyelinationMP:0006082CNS inflammationlocal accumulation of fluid, plasma proteins, and leukocytes in the brain and/or spinal cord
HP:0000608Macular degenerationMP:0008584photoreceptor outer segment degenerationretrogressive pathologic change in the photoreceptor region that is rich in the visual pigment rhodopsin
Mapped by homologous gene(Total Items:11)
HP ID HP Name MP ID MP Name Annotation
HP:0002942Thoracic kyphosisMP:0014164abnormal ciliary process morphology any structural anomaly of any of the pigmented processes that radiate from the ciliary muscle and give attachments to ligaments supporting the lens of the eye; these processes increase in thickness as they advance from the orbiculus ciliaris to the exter
HP:0007305CNS demyelinationMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0008064IchthyosisMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0001257SpasticityMP:0020316decreased vascular endothelial cell proliferationdecrease in the expansion rate of any vascular endothelial cell population by cell division
HP:0000613PhotophobiaMP:0020220decreased tear productiondecreased production of the amount of fluid produced in the eye
HP:0000608Macular degenerationMP:0020039increased bone ossificationincrease in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance
HP:0001249Intellectual disabilityMP:0020316decreased vascular endothelial cell proliferationdecrease in the expansion rate of any vascular endothelial cell population by cell division
HP:0001250SeizuresMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0006297Hypoplasia of dental enamelMP:0020220decreased tear productiondecreased production of the amount of fluid produced in the eye
HP:0004322Short statureMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0007727Opacification of the corneal epitheliumMP:0009142decreased prepulse inhibitiondecrease in the ability of a relatively mild stimulus to suppress the response to a strong, startle-eliciting stimulus
Disease ID 301
Disease sjogren-larsson syndrome
Case(Waiting for update.)