sjogren-larsson syndrome |
Disease ID | 301 |
---|---|
Disease | sjogren-larsson syndrome |
Definition | An autosomal recessive neurocutaneous disorder characterized by severe ichthyosis MENTAL RETARDATION; SPASTIC PARAPLEGIA; and congenital ICHTHYOSIS. It is caused by mutation of gene encoding microsomal fatty ALDEHYDE DEHYDROGENASE leading to defect in fatty alcohol metabolism. |
Synonym | congenital icthyosis mental retardation spasticity syndrome faldh deficiency fao - fatty alcohol-nicotinamide adenine dinucleotide oxidase-reductase deficiency fatty alcohol-nicotinamide adenine dinucleotide oxidoreductase deficiency fatty alcohol:nad+ oxidoreductase deficiency fatty aldehyde dehydrogenase defic dis fatty aldehyde dehydrogenase deficiency fatty aldehyde dehydrogenase deficiency disease ichthyosis oligophrenia syndrome ichthyosis, spastic neurologic disorder, and oligophrenia sjogren - larsson syndrome sjogren larsson syndrome sjogren-larsson syndrome (disorder) sjogren-larsson syndrome [disease/finding] sjogren-larsson's syndrome sjögren-larsson syndrome sjögren-larsson syndrome (disorder) sjögren-larsson's syndrome sls |
Orphanet | |
OMIM | |
DOID | |
UMLS | C0037231 |
MeSH | |
SNOMED-CT | |
Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:2) |
Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:3) |
Locus | (Waiting for update.) |
Disease ID | 301 |
---|---|
Disease | sjogren-larsson syndrome |
Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:11) HP:0007305 | Demyelination in central white matter HP:0001257 | Spasticity HP:0001250 | Seizures HP:0004322 | Stature below 3rd percentile HP:0001249 | Mental retardation HP:0002942 | Thoracic kyphosis HP:0007727 | Superficial corneal opacities HP:0000608 | Macular degeneration HP:0000613 | Extreme light sensitivity HP:0006297 | Hypoplasia of tooth enamel HP:0008064 | Ichthyosis |
Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:4) HP:0008064 | Ichthyosis | 2 HP:0001264 | Spastic diplegia | 1 HP:0001263 | Developmental retardation | 1 HP:0000989 | pruritis | 1 |
Disease ID | 301 |
---|---|
Disease | sjogren-larsson syndrome |
Manually Symptom | (Waiting for update.) |
Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Text Mining Genotypes:0) |
---|
(Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
---|---|
(Waiting for update.) |
All Snps(Total Genotypes:17) | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
rs387906254 | NA | 224 | ALDH3A2 | umls:C0037231 | CLINVAR | NA | 0.514129238 | NA | ALDH3A2 | 17 | 19656415 | T | - |
rs387906255 | NA | 224 | ALDH3A2 | umls:C0037231 | CLINVAR | NA | 0.514129238 | NA | ALDH3A2 | 17 | 19661137 | G | - |
rs387906256 | NA | 224 | ALDH3A2 | umls:C0037231 | CLINVAR | NA | 0.514129238 | NA | ALDH3A2 | 17 | 19671810 | GA | - |
rs387906257 | NA | 224 | ALDH3A2 | umls:C0037231 | CLINVAR | NA | 0.514129238 | NA | ALDH3A2 | 17 | 19671824 | - | ACAAA |
rs67939114 | 10577908 | 224 | ALDH3A2 | umls:C0037231 | UNIPROT | The molecular basis of Sjögren-Larsson syndrome: mutation analysis of the fatty aldehyde dehydrogenase gene. | 0.514129238 | 1999 | ALDH3A2 | 17 | 19671852 | A | G |
rs72547554 | NA | 224 | ALDH3A2 | umls:C0037231 | CLINVAR | NA | 0.514129238 | NA | ALDH3A2 | 17 | 19648999 | C | G,T |
rs72547562 | NA | 224 | ALDH3A2 | umls:C0037231 | CLINVAR | NA | 0.514129238 | NA | ALDH3A2 | 17 | 19656445 | C | T |
rs72547564 | NA | 224 | ALDH3A2 | umls:C0037231 | CLINVAR | NA | 0.514129238 | NA | ALDH3A2 | 17 | 19656535 | G | A |
rs72547566 | 10577908 | 224 | ALDH3A2 | umls:C0037231 | UNIPROT | The molecular basis of Sjögren-Larsson syndrome: mutation analysis of the fatty aldehyde dehydrogenase gene. | 0.514129238 | 1999 | ALDH3A2 | 17 | 19657746 | C | T |
rs72547569 | NA | 224 | ALDH3A2 | umls:C0037231 | CLINVAR | NA | 0.514129238 | NA | ALDH3A2 | 17 | 19657862 | G | C |
rs72547571 | NA | 224 | ALDH3A2 | umls:C0037231 | CLINVAR | NA | 0.514129238 | NA | ALDH3A2 | 17 | 19663335 | C | T |
rs72547575 | NA | 224 | ALDH3A2 | umls:C0037231 | CLINVAR | NA | 0.514129238 | NA | ALDH3A2 | 17 | 19664997 | A | G |
rs730880264 | NA | 224 | ALDH3A2 | umls:C0037231 | CLINVAR | NA | 0.514129238 | NA | ALDH3A2 | 17 | 19663333 | CCC | GGGCTAAAAGTACTGTTGGGG |
rs786204625 | NA | 224 | ALDH3A2 | umls:C0037231 | CLINVAR | NA | 0.514129238 | NA | ALDH3A2 | 17 | 19663492 | A | - |
rs786204677 | NA | 224 | ALDH3A2 | umls:C0037231 | CLINVAR | NA | 0.514129238 | NA | ALDH3A2 | 17 | 19657867 | G | A |
rs786204741 | NA | 224 | ALDH3A2 | umls:C0037231 | CLINVAR | NA | 0.514129238 | NA | ALDH3A2 | 17 | 19652633 | G | - |
rs786204759 | NA | 224 | ALDH3A2 | umls:C0037231 | CLINVAR | NA | 0.514129238 | NA | ALDH3A2 | 17 | 19661229 | GCT | CC |
GWASdb Annotation(Total Genotypes:0) | |
---|---|
(Waiting for update.) |
GWASdb Snp Trait(Total Genotypes:0) | |
---|---|
(Waiting for update.) |
Mapped by lexical matching(Total Items:4) | ||||
---|---|---|---|---|
HP ID | HP Name | MP ID | MP Name | Annotation |
HP:0002942 | Thoracic kyphosis | MP:0000160 | kyphosis | forward curvature of the spine, characterized by extensive flexion |
HP:0006297 | Hypoplasia of dental enamel | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
HP:0007305 | CNS demyelination | MP:0006082 | CNS inflammation | local accumulation of fluid, plasma proteins, and leukocytes in the brain and/or spinal cord |
HP:0000608 | Macular degeneration | MP:0008584 | photoreceptor outer segment degeneration | retrogressive pathologic change in the photoreceptor region that is rich in the visual pigment rhodopsin |
Mapped by homologous gene(Total Items:11) | ||||
---|---|---|---|---|
HP ID | HP Name | MP ID | MP Name | Annotation |
HP:0002942 | Thoracic kyphosis | MP:0014164 | abnormal ciliary process morphology | any structural anomaly of any of the pigmented processes that radiate from the ciliary muscle and give attachments to ligaments supporting the lens of the eye; these processes increase in thickness as they advance from the orbiculus ciliaris to the exter |
HP:0007305 | CNS demyelination | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
HP:0008064 | Ichthyosis | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
HP:0001257 | Spasticity | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
HP:0000613 | Photophobia | MP:0020220 | decreased tear production | decreased production of the amount of fluid produced in the eye |
HP:0000608 | Macular degeneration | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
HP:0001249 | Intellectual disability | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
HP:0001250 | Seizures | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
HP:0006297 | Hypoplasia of dental enamel | MP:0020220 | decreased tear production | decreased production of the amount of fluid produced in the eye |
HP:0004322 | Short stature | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
HP:0007727 | Opacification of the corneal epithelium | MP:0009142 | decreased prepulse inhibition | decrease in the ability of a relatively mild stimulus to suppress the response to a strong, startle-eliciting stimulus |
Disease ID | 301 |
---|---|
Disease | sjogren-larsson syndrome |
Case | (Waiting for update.) |