| rubinstein-taybi syndrome | ||||
| Disease ID | 44 |
|---|---|
| Disease | rubinstein-taybi syndrome |
| Definition | A chromosomal disorder characterized by MENTAL RETARDATION, broad thumbs, webbing of fingers and toes, beaked nose, short upper lip, pouting lower lip, agenesis of corpus callosum, large foramen magnum, keloid formation, pulmonary stenosis, vertebral anomalies, chest wall anomalies, sleep apnea, and megacolon. The disease has an autosomal dominant pattern of inheritance and is associated with deletions of the short arm of chromosome 16 (16p13.3). |
| Synonym | broad thumb hallux syndrome broad thumb-hallux syndrome broad thumb-hallux syndromes broad thumbs and great toes, characteristic facies, and mental retardation rsts1 rubenstein taybi syndrome rubenstein-taybi syndrome rubinstein syndrome rubinstein taybi syndrome rubinstein taybis syndrome rubinstein-taybi syndrome (disorder) rubinstein-taybi syndrome 1 rubinstein-taybi syndrome [disease/finding] syndrome rubinstein taybi syndrome, broad thumb-hallux syndrome, rubinstein syndrome, rubinstein-taybi syndromes, broad thumb-hallux |
| Orphanet | |
| OMIM | |
| DOID | |
| UMLS | C0035934 |
| MeSH | |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:11) C0036439 | scoliosis | 2 C0027122 | myositis ossificans | 1 C0004352 | autism | 1 C0029927 | ovarian cyst | 1 C0476089 | endometrial ca | 1 C0476089 | endometrial carcinoma | 1 C0017601 | glaucoma | 1 C0013338 | growth hormone deficiency | 1 C0020302 | infantile glaucoma | 1 C0027121 | myositis | 1 C0206624 | hepatoblastoma | 1 |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:2) |
| Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:2) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:40) 57492 | ARID1B | 1.991 | DISEASES 546 | ATRX | 1.968 | DISEASES 54880 | BCOR | 1.663 | DISEASES 6792 | CDKL5 | 1.624 | DISEASES 55636 | CHD7 | 1.32 | DISEASES 10370 | CITED2 | 1.9 | DISEASES 1385 | CREB1 | 4.152 | DISEASES 23741 | EID1 | 2.353 | DISEASES 2304 | FOXE1 | 1.393 | DISEASES 2290 | FOXG1 | 1.505 | DISEASES 9573 | GDF3 | 2.179 | DISEASES 55869 | HDAC8 | 1.667 | DISEASES 3091 | HIF1A | 1.016 | DISEASES 8337 | HIST2H2AA3 | 2.547 | DISEASES 8338 | HIST2H2AC | 2.547 | DISEASES 8349 | HIST2H2BE | 2.255 | DISEASES 3483 | IGFALS | 2.535 | DISEASES 3590 | IL11RA | 2.799 | DISEASES 10524 | KAT5 | 1.694 | DISEASES 374654 | KIF7 | 2.486 | DISEASES 4038 | LRP4 | 3.015 | DISEASES 4204 | MECP2 | 2.718 | DISEASES 4763 | NF1 | 1.399 | DISEASES 64324 | NSD1 | 1.63 | DISEASES 5080 | PAX6 | 1.605 | DISEASES 5456 | POU3F4 | 1.837 | DISEASES 5727 | PTCH1 | 1.964 | DISEASES 8643 | PTCH2 | 1.943 | DISEASES 51715 | RAB23 | 2.302 | DISEASES 388015 | RTL1 | 2.619 | DISEASES 860 | RUNX2 | 1.317 | DISEASES 10284 | SAP18 | 3.454 | DISEASES 10479 | SLC9A6 | 2.282 | DISEASES 84679 | SLC9A7 | 2.535 | DISEASES 6597 | SMARCA4 | 1.98 | DISEASES 8243 | SMC1A | 1.894 | DISEASES 9126 | SMC3 | 2.009 | DISEASES 51684 | SUFU | 1.611 | DISEASES 7020 | TFAP2A | 1.53 | DISEASES 157680 | VPS13B | 3.578 | DISEASES |
| Locus | (Waiting for update.) |
| Disease ID | 44 |
|---|---|
| Disease | rubinstein-taybi syndrome |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:45) HP:0000028 | Cryptorchidism HP:0000670 | Carious teeth HP:0001263 | Global developmental delay HP:0002553 | Highly arched eyebrow HP:0004322 | Short stature HP:0000365 | Hearing impairment HP:0002019 | Constipation HP:0100760 | Clubbing of toes HP:0000218 | High palate HP:0000508 | Ptosis HP:0001156 | Brachydactyly syndrome HP:0000987 | Atypical scarring of skin HP:0000347 | Micrognathia HP:0006101 | Finger syndactyly HP:0000506 | Telecanthus HP:0000369 | Low-set ears HP:0002564 | Malformation of the heart and great vessels HP:0000486 | Strabismus HP:0005692 | Joint hyperflexibility HP:0000316 | Hypertelorism HP:0001531 | Failure to thrive in infancy HP:0000164 | Abnormality of the teeth HP:0005306 | Capillary hemangiomas HP:0000739 | Anxiety HP:0000494 | Downslanted palpebral fissures HP:0008872 | Feeding difficulties in infancy HP:0001250 | Seizures HP:0000286 | Epicanthus HP:0010562 | Keloids HP:0002093 | Respiratory insufficiency HP:0000252 | Microcephaly HP:0002230 | Generalized hirsutism HP:0007018 | Attention deficit hyperactivity disorder HP:0004209 | Clinodactyly of the 5th finger HP:0000431 | Wide nasal bridge HP:0010059 | Broad hallux phalanx HP:0001249 | Intellectual disability HP:0001385 | Hip dysplasia HP:0000579 | Nasolacrimal duct obstruction HP:0009832 | Abnormality of the distal phalanx of finger HP:0000444 | Convex nasal ridge HP:0011304 | Broad thumb HP:0000737 | Irritability HP:0000501 | Glaucoma HP:0001561 | Polyhydramnios |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:15) HP:0000501 | Glaucoma | 2 HP:0001087 | Childhood glaucoma | 2 HP:0002650 | Scoliosis | 2 HP:0000138 | Ovarian cyst | 1 HP:0002597 | Abnormality of blood vessels | 1 HP:0012114 | Endometrial carcinoma | 1 HP:0100614 | Muscle inflammation | 1 HP:0000556 | Retinal dystrophy | 1 HP:0001274 | Absent corpus callosum | 1 HP:0000824 | Growth hormone deficiency | 1 HP:0002958 | Immune dysregulation | 1 HP:0002884 | Hepatoblastoma | 1 HP:0000717 | Autism | 1 HP:0002308 | Chiari malformation | 1 HP:0010562 | Keloids | 1 |
| Disease ID | 44 |
|---|---|
| Disease | rubinstein-taybi syndrome |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:15) C0376293 | stigmata C0311237 | goniodysgenesis C0206724 | sex cord stromal tumor C0206711 | pilomatrixomas C0205834 | multiple meningiomas C0149887 | slipped capital femoral epiphysis C0033838 | kimura disease C0029166 | oral manifestations C0025958 | microcephaly C0022596 | palmoplantar keratoderma C0020302 | congenital glaucoma C0017152 | gastritis C0013261 | duane retraction syndrome C0010964 | dandy-walker malformation C0010308 | congenital hypothyroidism |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:1) |
Manually Genotype(Total Manually Genotypes:1) | |||
|---|---|---|---|
| Gene | Mutation | DOI | Article Title |
| Rubinstein-Taybi syndrome | CREBBP | NM_004380, c.5129G>A (p.C1710Y) | doi:10.1038/gim.2015.186 |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:75) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs11644721 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3851010 | C | T |
| rs121434624 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3850689 | G | C,A |
| rs121434625 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3793533 | G | A |
| rs121434626 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3740399 | C | G |
| rs143247685 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3770722 | T | A,C |
| rs147688139 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3736812 | A | G,T |
| rs200782888 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3749626 | C | T |
| rs267606752 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3749631 | C | T |
| rs28937315 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3757894 | T | C |
| rs28937315 | 25388907 | 1387 | CREBBP | umls:C0035934 | UNIPROT | Insights into genotype-phenotype correlations from CREBBP point mutation screening in a cohort of 46 Rubinstein-Taybi syndrome patients. | 0.589289435 | 2014 | CREBBP | 16 | 3757894 | T | C |
| rs587783460 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3793539 | G | A |
| rs587783461 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3793446 | G | A |
| rs587783463 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3792054 | C | T |
| rs587783464 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3792041 | G | A |
| rs587783465 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3781290 | G | - |
| rs587783467 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3780734 | T | - |
| rs587783469 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3778098 | G | - |
| rs587783470 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3777648 | AG | - |
| rs587783471 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3770915 | G | T |
| rs587783473 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3770843 | GA | - |
| rs587783475 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3770659 | G | A |
| rs587783476 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3850809 | G | A |
| rs587783477 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3850796 | C | - |
| rs587783478 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3850779 | G | A |
| rs587783479 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3758913 | G | A |
| rs587783480 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3758853 | C | A |
| rs587783481 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3757918 | T | C |
| rs587783482 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3757373 | C | A |
| rs587783483 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3751725 | C | T |
| rs587783484 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3879880 | T | C |
| rs587783485 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3745274 | C | T,A |
| rs587783486 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3740551 | T | C |
| rs587783488 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3740510 | C | G |
| rs587783489 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3740487 | G | A |
| rs587783490 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3740454 | G | A |
| rs587783491 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3740398 | C | T |
| rs587783492 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3739632 | A | G |
| rs587783493 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3738683 | G | C |
| rs587783494 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3738577 | T | C |
| rs587783495 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3736766 | A | C |
| rs587783496 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3736765 | T | C |
| rs587783497 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3736702 | T | C |
| rs587783499 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3736075 | C | - |
| rs587783500 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3731874 | T | - |
| rs587783503 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3731314 | A | G |
| rs587783505 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3729226 | G | A |
| rs587783506 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3729203 | CGGGGGTGGGG | - |
| rs587783507 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3729210 | G | - |
| rs587783508 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3729178 | C | - |
| rs587783509 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3850497 | G | A |
| rs587783510 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3728959 | G | A |
| rs587783511 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3728876 | CTGCACGCTGGGCATCCGGGGCCCAGCCACGGCCGCCTGGGC | - |
| rs587783515 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3851011 | T | G |
| rs587783516 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3810625 | G | T |
| rs794727124 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3770765 | G | - |
| rs794727391 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3740539 | G | - |
| rs797045037 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3729433 | T | C |
| rs797045483 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3774673 | - | G |
| rs797045484 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3770760 | TGCCCGGAAGAC | GG |
| rs797045485 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3770639 | - | G |
| rs797045486 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3850812 | - | G |
| rs797045487 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3879915 | A | T |
| rs797045488 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3767885 | CTCCTTGCA | TT |
| rs797045489 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3757982 | G | A |
| rs797045490 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3757956 | - | A |
| rs797045491 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3850745 | - | CA |
| rs797045492 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3757928 | C | G |
| rs797045494 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3738672 | C | A |
| rs797045495 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3731337 | C | T |
| rs797045496 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3729635 | G | T |
| rs797045497 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3729209 | - | G |
| rs797045498 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3729110 | - | A |
| rs797045499 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3728931 | ACAGGCCTGG | - |
| rs797045500 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3728629 | - | CAGGCTGGGCTGCTGGTGCATGC |
| rs797045502 | NA | 1387 | CREBBP | umls:C0035934 | CLINVAR | NA | 0.589289435 | NA | CREBBP | 16 | 3810749 | - | AA |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:15) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0000987 | Atypical scarring of skin | MP:0011205 | excessive folding of visceral yolk sac | the appearance of wrinkles or folds on the surface of the visceral yolk sac |
| HP:0000670 | Carious teeth | MP:0004033 | supernumerary teeth | occurrence of more than the usual number of teeth |
| HP:0008872 | Feeding difficulties in infancy | MP:0011075 | abnormal macrophage activation involved in immune response | anomaly in the process in which a change in response and behavior of a macrophage results from exposure to a cytokine, chemokine, cellular ligand, or soluble factor, leading to the initiation or perpetuation of an immune response |
| HP:0000431 | Wide nasal bridge | MP:0006292 | abnormal nasal placode morphology | any structural anomaly in the paired ectodermal placodes that come to lie in the bottom of the olfactory pits as the pits are deepened by the growth of the surrounding medial and lateral nasal processes; the nasal placode gives rise to the olfactory epith |
| HP:0000579 | Nasolacrimal duct obstruction | MP:0009525 | abnormal submandibular duct morphology | any structural anomaly of the duct of the submadibular gland that opens at the sublingual papilla near the frenulum of the tongue |
| HP:0000218 | High palate | MP:0011615 | submucous cleft palate | a cleft of the palate with cardinal signs including a bifid uvula, a V-shaped notch at the back of the hard palate, and/or a translucent line in the midline of the soft palate and a short palate |
| HP:0001531 | Failure to thrive in infancy | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0004209 | Clinodactyly of the 5th finger | MP:0011665 | d-loop transposition of the great arteries | complete transposition of the great arteries; the d- refers to the dextroposition of the bulboventricular loop (ie, the position of the right ventricle, which is on the right side); in addition, the aorta also tends to be on the right and anterior, and th |
| HP:0001263 | Global developmental delay | MP:0002084 | abnormal developmental patterning | abnormal systematic arrangement of the developing body along an axis |
| HP:0000444 | Convex nasal ridge | MP:0004471 | short nasal bone | reduced length of either of two rectangular bone plates forming the bridge of the nose |
| HP:0006101 | Finger syndactyly | MP:0000564 | syndactyly | any degree of webbing or fusion of the digits, may involve only soft tissues or also can include bone |
| HP:0000164 | Abnormality of the teeth | MP:0010382 | abnormal dosage compensation, by inactivation of X chromosome | anomaly in the process of compensating for the two-fold variation in X-chromosome:autosome ratios between sexes by a global inactivation of all, or most of, the genes on one of the X-chromosomes in the XX sex |
| HP:0007018 | Attention deficit hyperactivity disorder | MP:0001399 | hyperactivity | general restlessness or excessive movement; more frequent movement from one place to another or having an increased state of activity |
| HP:0009832 | Abnormality of the distal phalanx of finger | MP:0009886 | failure of palatal shelf elevation | the palatal shelves fail to move from a vertical position in the orofacial cavity to a horizontal apposition above the developing tongue |
| HP:0100760 | Clubbing of toes | MP:0001841 | decreased level of surface class I molecules | reduced expression of major histocompatibility complex class I molecules at the cell surface |
Mapped by homologous gene(Total Items:43) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0001385 | Hip dysplasia | MP:0013293 | embryonic lethality prior to tooth bud stage | death prior to the appearance of tooth buds (Mus: E12-E12.5) |
| HP:0000739 | Anxiety | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0000987 | Atypical scarring of skin | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000508 | Ptosis | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000164 | Abnormality of the teeth | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0001250 | Seizures | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000486 | Strabismus | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0004322 | Short stature | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000506 | Telecanthus | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0000501 | Glaucoma | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000347 | Micrognathia | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0007018 | Attention deficit hyperactivity disorder | MP:0020169 | increased thyroid gland weight | higher than average weight of the thyroid gland |
| HP:0000316 | Hypertelorism | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0002093 | Respiratory insufficiency | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002553 | Highly arched eyebrow | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0009832 | Abnormality of the distal phalanx of finger | MP:0011108 | embryonic lethality during organogenesis, incomplete penetrance | the appearance of lower than Mendelian ratios of organisms of a given genotype due to death of some, but not all of the organisms between embryo turning and the completion of organogenesis (Mus: E9-9.5 to less than E14) |
| HP:0000028 | Cryptorchidism | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0001156 | Brachydactyly syndrome | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0000670 | Carious teeth | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0006101 | Finger syndactyly | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002230 | Generalized hirsutism | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000444 | Convex nasal ridge | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0005306 | Capillary hemangiomas | MP:0013956 | decreased colon length | reduced length of the portion of the large intestine between the cecum and the rectum |
| HP:0000737 | Irritability | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001263 | Global developmental delay | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0001561 | Polyhydramnios | MP:0020214 | susceptible to malignant hyperthermia | increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine |
| HP:0001531 | Failure to thrive in infancy | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0001249 | Intellectual disability | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0000365 | Hearing impairment | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0008872 | Feeding difficulties in infancy | MP:0020214 | susceptible to malignant hyperthermia | increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine |
| HP:0000218 | High palate | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000286 | Epicanthus | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000494 | Downslanted palpebral fissures | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000579 | Nasolacrimal duct obstruction | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0100760 | Clubbing of toes | MP:0012009 | early parturition | the process of labor and delivery in female animals occurs earlier in gestation than expected |
| HP:0004209 | Clinodactyly of the 5th finger | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0000369 | Low-set ears | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0010562 | Keloids | MP:0012700 | abnormal endocardial heart tube morphology | any structural anomaly of the paired, longitudinal, endothelial-lined channels formed from the cardiogenic mesoderm in embryonic development; angiogenic cell clusters (aka angioblastic cords) located in a horse-shoe shape configuration in the cardiogenic |
| HP:0005692 | Joint hyperflexibility | MP:0012125 | decreased bronchoconstrictive response | reduction in the expected bronchoconstrictive response to provocation challenge with lipopolysaccharide, bradykinin, histamine or other antigen/allergen or agent, often measured by plethysmography |
| HP:0011304 | Broad thumb | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0002019 | Constipation | MP:0020234 | decreased basal metabolism | decrease in heat production of an organism at the lowest level of cell chemistry in an inactive, awake, and fasting state |
| HP:0000252 | Microcephaly | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000431 | Wide nasal bridge | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| Disease ID | 44 |
|---|---|
| Disease | rubinstein-taybi syndrome |
| Case | (Waiting for update.) |