eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| rigid spine syndrome | ||||
| Disease ID | 1117 |
|---|---|
| Disease | rigid spine syndrome |
| Definition | An inherited muscular dystrophy caused by mutations in the SEPN1 gene. It is characterized by severe limitation in flexion of the dorsolumbar and cervical spine, due to contracture of the spinal extensors. It leads to loss of movement of the spine and the thoracic cage. |
| Synonym | desmin-related myopathies with mallory bodies desmin-related myopathy with mallory bodies eichsfeld type congenital muscular dystrophy eichsfeld type congenital muscular dystrophy (disorder) mdrs1 minicore myopathy, severe classic form multicore myopathy, severe classic form multiminicore disease, severe classic form muscular dystrophy, congenital, eichsfeld type muscular dystrophy, congenital, merosin positive with early spine rigidity muscular dystrophy, congenital, merosin-positive, with early spine rigidity myopathy, sepn1-related rigid spine muscular dystrophy 1 rigid spine muscular dystrophy-1 rsmd1 |
| Orphanet | |
| OMIM | |
| UMLS | C0410180 |
| SNOMED-CT | |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:3) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:58) 65057 | ACD | 2.327 | DISEASES 262 | AMD1 | 2.284 | DISEASES 9212 | AURKB | 1.196 | DISEASES 573 | BAG1 | 1.588 | DISEASES 9531 | BAG3 | 1.823 | DISEASES 825 | CAPN3 | 2.53 | DISEASES 1041 | CDSN | 1.768 | DISEASES 1291 | COL6A1 | 1.974 | DISEASES 1491 | CTH | 1.546 | DISEASES 1756 | DMD | 2.569 | DISEASES 8291 | DYSF | 3.648 | DISEASES 1946 | EFNA5 | 2.066 | DISEASES 2010 | EMD | 2.295 | DISEASES 2235 | FECH | 1.473 | DISEASES 79147 | FKRP | 1.759 | DISEASES 4303 | FOXO4 | 1.487 | DISEASES 10020 | GNE | 1.715 | DISEASES 2811 | GP1BA | 2.238 | DISEASES 2879 | GPX4 | 1.373 | DISEASES 3376 | IARS | 1.141 | DISEASES 3476 | IGBP1 | 2.076 | DISEASES 3751 | KCND2 | 1.906 | DISEASES 3908 | LAMA2 | 4.421 | DISEASES 51520 | LARS | 1.097 | DISEASES 11155 | LDB3 | 1.749 | DISEASES 4000 | LMNA | 3.077 | DISEASES 51599 | LSR | 2.703 | DISEASES 4519 | MT-CYB | 1.193 | DISEASES 4625 | MYH7 | 1.338 | DISEASES 25915 | NDUFAF3 | 3.006 | DISEASES 5081 | PAX7 | 1.478 | DISEASES 5241 | PGR | 1.496 | DISEASES 374308 | PTCHD3 | 1.955 | DISEASES 8786 | RGS11 | 3.073 | DISEASES 6195 | RPS6KA1 | 1.427 | DISEASES 6196 | RPS6KA2 | 1.913 | DISEASES 6197 | RPS6KA3 | 1.598 | DISEASES 23212 | RRS1 | 1.665 | DISEASES 6261 | RYR1 | 3.242 | DISEASES 79048 | SECISBP2 | 3.552 | DISEASES 51091 | SEPSECS | 1.84 | DISEASES 5271 | SERPINB8 | 2.449 | DISEASES 5270 | SERPINE2 | 1.714 | DISEASES 10572 | SIVA1 | 2.637 | DISEASES 116085 | SLC22A12 | 2.711 | DISEASES 27286 | SRPX2 | 1.78 | DISEASES 63826 | SRR | 1.762 | DISEASES 8803 | SUCLA2 | 2.424 | DISEASES 25870 | SUMF2 | 1.449 | DISEASES 54790 | TET2 | 2.222 | DISEASES 7113 | TMPRSS2 | 1.116 | DISEASES 7156 | TOP3A | 1.645 | DISEASES 7169 | TPM2 | 2.113 | DISEASES 7273 | TTN | 1.102 | DISEASES 10587 | TXNRD2 | 1.698 | DISEASES 6944 | VPS72 | 2.967 | DISEASES 8565 | YARS | 1.806 | DISEASES 51067 | YARS2 | 2.644 | DISEASES |
| Locus | Symbol | Locus(Total Locus:2) |
| Disease ID | 1117 |
|---|---|
| Disease | rigid spine syndrome |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:23) HP:0003306 | Spinal rigidity HP:0001611 | Hypernasal speech HP:0002421 | Poor head control HP:0002111 | Restrictive respiratory insufficiency' HP:0003327 | Axial muscle weakness HP:0004322 | Stature below 3rd percentile HP:0002792 | Decreased vital capacity HP:0003557 | Increased fiber size variation HP:0003324 | Muscle weakness, diffuse HP:0002877 | Nocturnal under breathing HP:0001270 | Motor retardation HP:0001252 | Hypotonia HP:0001547 | Abnormality of the rib cage HP:0000218 | Increased palatal height HP:0002650 | Scoliosis HP:0001508 | Weight faltering HP:0005991 | Limited cervical flexion HP:0003560 | Muscular dystrophy HP:0003700 | Diffuse muscle wasting HP:0001371 | Flexion contractures of joints HP:0003787 | Type 1 and type 2 muscle fiber minicore regions HP:0001620 | High pitched voice HP:0010628 | Facial palsy, unilateral or bilateral |
| Text Mined Phenotype | (Waiting for update.) |
| Disease ID | 1117 |
|---|---|
| Disease | rigid spine syndrome |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:2) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:14) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs121908182 | NA | 57190 | SEPN1 | umls:C0410180 | CLINVAR | NA | 0.563528744 | NA | SEPN1 | 1 | 25809096 | G | A |
| rs121908184 | NA | 57190 | SEPN1 | umls:C0410180 | CLINVAR | NA | 0.563528744 | NA | SEPN1 | 1 | 25800231 | A | G |
| rs121908185 | NA | 57190 | SEPN1 | umls:C0410180 | CLINVAR | NA | 0.563528744 | NA | SEPN1 | 1 | 25813890 | G | A |
| rs121908186 | NA | 57190 | SEPN1 | umls:C0410180 | CLINVAR | NA | 0.563528744 | NA | SEPN1 | 1 | 25812763 | G | C |
| rs121908187 | NA | 57190 | SEPN1 | umls:C0410180 | CLINVAR | NA | 0.563528744 | NA | SEPN1 | 1 | 25812789 | T | G |
| rs121908188 | NA | 57190 | SEPN1 | umls:C0410180 | CLINVAR | NA | 0.563528744 | NA | SEPN1 | 1 | 25809753 | G | A |
| rs368104077 | NA | 57190 | SEPN1 | umls:C0410180 | CLINVAR | NA | 0.563528744 | NA | SEPN1 | 1 | 25808755 | - | A,C |
| rs377215510 | NA | 57190 | SEPN1 | umls:C0410180 | CLINVAR | NA | 0.563528744 | NA | SEPN1 | 1 | 25812720 | C | T |
| rs398124360 | NA | 57190 | SEPN1 | umls:C0410180 | CLINVAR | NA | 0.563528744 | NA | SEPN1 | 1 | 25801161 | G | T |
| rs587776597 | NA | 57190 | SEPN1 | umls:C0410180 | CLINVAR | NA | 0.563528744 | NA | SEPN1 | 1 | 25812790 | G | A |
| rs794727808 | NA | 57190 | SEPN1 | umls:C0410180 | CLINVAR | NA | 0.563528744 | NA | SEPN1 | 1 | 25809152 | T | C |
| rs794727976 | NA | 57190 | SEPN1 | umls:C0410180 | CLINVAR | NA | 0.563528744 | NA | SEPN1 | 1 | 25811694 | G | T |
| rs797044620 | NA | 57190 | SEPN1 | umls:C0410180 | CLINVAR | NA | 0.563528744 | NA | SEPN1 | 1 | 25800302 | - | GCCCCGCCGCGCAGCCTCCCGCGCCACCG |
| rs797044621 | NA | 57190 | SEPN1 | umls:C0410180 | CLINVAR | NA | 0.563528744 | NA | SEPN1 | 1 | 25800252 | - | CGGCCGGGCC |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:10) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0003557 | Increased variability in muscle fiber diameter | MP:0013237 | abnormal skeletal muscle regeneration | anomaly in the ability to repair skeletal muscle after injury or disease |
| HP:0002421 | Poor head control | MP:0011495 | abnormal head shape | any anomaly in the characteristic surface outline or contour of a head of an organism |
| HP:0003324 | Generalized muscle weakness | MP:0000747 | muscle weakness | loss of muscle strength |
| HP:0002111 | Restrictive respiratory insufficiency | MP:0002133 | abnormal respiratory system physiology | any functional anomaly of the pulmonary system; inability or reduced ability to intake and exchange oxygen and carbon dioxide with the environment |
| HP:0000218 | High palate | MP:0011615 | submucous cleft palate | a cleft of the palate with cardinal signs including a bifid uvula, a V-shaped notch at the back of the hard palate, and/or a translucent line in the midline of the soft palate and a short palate |
| HP:0001547 | Abnormality of the rib cage | MP:0009403 | increased variability of skeletal muscle fiber size | greater range or dispersion within a distribution of skeletal muscle fiber size within a muscle compared to controls |
| HP:0001508 | Failure to thrive | MP:0013294 | prenatal lethality prior to heart atrial septation | death prior to the completion of heart atrial septation (Mus: E14.5-15.5) |
| HP:0003327 | Axial muscle weakness | MP:0000747 | muscle weakness | loss of muscle strength |
| HP:0001252 | Muscular hypotonia | MP:0004144 | hypotonia | decreased muscle tension resulting in limpness of the muscles in the resting state, not to be confused with weakness |
| HP:0003787 | Type 1 and type 2 muscle fiber minicore regions | MP:0009409 | abnormal skeletal muscle fiber type ratio | deviation from the standard ratios of fiber types in a given skeletal muscle compared to control samples |
Mapped by homologous gene(Total Items:23) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0001252 | Muscular hypotonia | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0002650 | Scoliosis | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0002421 | Poor head control | MP:0013504 | increased embryonic tissue cell apoptosis | increase in the timing or the number of cells in embryonic tissue undergoing programmed cell death |
| HP:0001547 | Abnormality of the rib cage | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| HP:0001371 | Flexion contracture | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0004322 | Short stature | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0003700 | Generalized amyotrophy | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001620 | High pitched voice | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0003787 | Type 1 and type 2 muscle fiber minicore regions | MP:0020214 | susceptible to malignant hyperthermia | increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine |
| HP:0002111 | Restrictive respiratory insufficiency | MP:0013504 | increased embryonic tissue cell apoptosis | increase in the timing or the number of cells in embryonic tissue undergoing programmed cell death |
| HP:0001508 | Failure to thrive | MP:0020234 | decreased basal metabolism | decrease in heat production of an organism at the lowest level of cell chemistry in an inactive, awake, and fasting state |
| HP:0003560 | Muscular dystrophy | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0003324 | Generalized muscle weakness | MP:0020234 | decreased basal metabolism | decrease in heat production of an organism at the lowest level of cell chemistry in an inactive, awake, and fasting state |
| HP:0005991 | Limited neck flexion | MP:0013504 | increased embryonic tissue cell apoptosis | increase in the timing or the number of cells in embryonic tissue undergoing programmed cell death |
| HP:0003557 | Increased variability in muscle fiber diameter | MP:0020214 | susceptible to malignant hyperthermia | increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine |
| HP:0001611 | Nasal speech | MP:0020040 | decreased bone ossification | decrease in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0000218 | High palate | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0003327 | Axial muscle weakness | MP:0020214 | susceptible to malignant hyperthermia | increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine |
| HP:0001270 | Motor delay | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0010628 | Facial palsy | MP:0020240 | increased skeletal muscle cell apoptosis | increase in the number of skeletal muscle cells undergoing programmed cell death |
| HP:0003306 | Spinal rigidity | MP:0020234 | decreased basal metabolism | decrease in heat production of an organism at the lowest level of cell chemistry in an inactive, awake, and fasting state |
| HP:0002877 | Nocturnal hypoventilation | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002792 | Reduced vital capacity | MP:0013504 | increased embryonic tissue cell apoptosis | increase in the timing or the number of cells in embryonic tissue undergoing programmed cell death |
| Disease ID | 1117 |
|---|---|
| Disease | rigid spine syndrome |
| Case | (Waiting for update.) |