eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine

HOME
QUERY
- DISEASE
- GENOTYPE
NETWORK
- PHENOTYPE
- GENE
- COMMON
- DISEASE PAIR
DOWNLOAD
SUBMIT CASE
HELP&FAQ
- HELP&FAQ
- CONTACT US


	retinoblastoma

Disease ID	14
Disease	retinoblastoma
Definition	A malignant tumor arising from the nuclear layer of the retina that is the most common primary tumor of the eye in children. The tumor tends to occur in early childhood or infancy and may be present at birth. The majority are sporadic, but the condition may be transmitted as an autosomal dominant trait. Histologic features include dense cellularity, small round polygonal cells, and areas of calcification and necrosis. An abnormal pupil reflex (leukokoria); NYSTAGMUS, PATHOLOGIC; STRABISMUS; and visual loss represent common clinical characteristics of this condition. (From DeVita et al., Cancer: Principles and Practice of Oncology, 5th ed, p2104)
Synonym	[m]retinoblastoma nos [m]retinoblastoma nos (morphologic abnormality) [m]retinoblastomas [m]retinoblastomas (morphologic abnormality) disorders retinoblastoma eye cancer, retinoblastoma glioblastoma, retinal glioblastomas, retinal glioma, retinal gliomas, retinal neuroblastoma of retina neuroblastoma of the retina neuroblastoma, retinal neuroblastomas, retinal rb rb - retinoblastoma rb1 retina, glioma retinal glioblastoma retinal glioblastomas retinal glioma retinal gliomas retinal neuroblastoma retinal neuroblastomas retinoblastoma (disorder) retinoblastoma (m-95103) retinoblastoma (morphologic abnormality) retinoblastoma - morphology retinoblastoma [disease/finding] retinoblastoma, malignant retinoblastoma, nos retinoblastomas
Orphanet	ORPHANET:790
OMIM	OMIM:180200 OMIM:614041
DOID	DOID:768
UMLS	C0035335
MeSH	D012175
SNOMED-CT	SNOMEDCT_US_2016_09_01:370967009
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:30) C0205898 \| pineoblastoma \| 3 C0035305 \| retinal detachment \| 3 C0024299 \| lymphoma \| 2 C0149507 \| orbital cellulitis \| 2 C0015397 \| ocular disease \| 2 C0007138 \| urothelial carcinoma \| 1 C0002871 \| anemia \| 1 C0162666 \| mitochondrial encephalomyopathy \| 1 C0153382 \| oropharyngeal cancer \| 1 C0020581 \| hyphema \| 1 C0029463 \| osteosarcoma \| 1 C0035309 \| retinopathy \| 1 C0031347 \| pharyngeal cancer \| 1 C0007129 \| merkel cell carcinoma \| 1 C0014236 \| endophthalmitis \| 1 C0206695 \| neuroendocrine carcinoma \| 1 C0086543 \| cataracts \| 1 C0154832 \| coats' disease \| 1 C0854915 \| unilateral retinoblastoma \| 1 C0206695 \| neuroendocrine carcinomas \| 1 C0041327 \| phthisis \| 1 C0032000 \| pituitary adenoma \| 1 C0040561 \| ocular toxoplasmosis \| 1 C0031269 \| peutz-jeghers syndrome \| 1 C0154916 \| iris neovascularization \| 1 C0006413 \| burkitt lymphoma \| 1 C0029132 \| optic nerve disease \| 1 C0751483 \| hereditary retinoblastoma \| 1 C0398623 \| thrombophilia \| 1 C0376358 \| prostate cancer \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:1) 5925 \| RB1 \| CLINVAR;CTD_human;GHR;UNIPROT
Inferring Gene	Entrez_id \| Symbol \| Resource(Total Genes:2) 1815 \| DRD4 \| CIPHER 5925 \| RB1 \| CIPHER;CTD_human
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:328) 55324 \| ABCF3 \| 1.688 \| DISEASES 25 \| ABL1 \| 2.537 \| DISEASES 32 \| ACACB \| 1.218 \| DISEASES 60 \| ACTB \| 1.636 \| DISEASES 8125 \| ANP32A \| 1.925 \| DISEASES 317 \| APAF1 \| 2.214 \| DISEASES 367 \| AR \| 2.545 \| DISEASES 5926 \| ARID4A \| 3.34 \| DISEASES 11016 \| ATF7 \| 1.609 \| DISEASES 9212 \| AURKB \| 2.148 \| DISEASES 11177 \| BAZ1A \| 1.021 \| DISEASES 10018 \| BCL2L11 \| 2.157 \| DISEASES 54880 \| BCOR \| 1.595 \| DISEASES 627 \| BDNF \| 1.137 \| DISEASES 497258 \| BDNF-AS \| 1.029 \| DISEASES 55814 \| BDP1 \| 3.834 \| DISEASES 631 \| BFSP1 \| 1.264 \| DISEASES 128408 \| BHLHE23 \| 1.358 \| DISEASES 648 \| BMI1 \| 2.134 \| DISEASES 650 \| BMP2 \| 1.204 \| DISEASES 672 \| BRCA1 \| 2.344 \| DISEASES 675 \| BRCA2 \| 2.245 \| DISEASES 6046 \| BRD2 \| 1.031 \| DISEASES 138162 \| C9orf116 \| 2.707 \| DISEASES 801 \| CALM1 \| 1.596 \| DISEASES 840 \| CASP7 \| 1.347 \| DISEASES 841 \| CASP8 \| 2.318 \| DISEASES 842 \| CASP9 \| 2.207 \| DISEASES 859 \| CAV3 \| 1.017 \| DISEASES 11335 \| CBX3 \| 2.25 \| DISEASES 892 \| CCNC \| 1.899 \| DISEASES 896 \| CCND3 \| 5.179 \| DISEASES 899 \| CCNF \| 1.421 \| DISEASES 900 \| CCNG1 \| 1.706 \| DISEASES 960 \| CD44 \| 1.79 \| DISEASES 4267 \| CD99 \| 1.24 \| DISEASES 995 \| CDC25C \| 2.412 \| DISEASES 996 \| CDC27 \| 1.224 \| DISEASES 8318 \| CDC45 \| 1.224 \| DISEASES 55038 \| CDCA4 \| 1.591 \| DISEASES 1012 \| CDH13 \| 1.098 \| DISEASES 983 \| CDK1 \| 4.809 \| DISEASES 5129 \| CDK18 \| 1.045 \| DISEASES 1018 \| CDK3 \| 2.753 \| DISEASES 1020 \| CDK5 \| 3.088 \| DISEASES 1025 \| CDK9 \| 3.08 \| DISEASES 8814 \| CDKL1 \| 1.105 \| DISEASES 1028 \| CDKN1C \| 2.939 \| DISEASES 1029 \| CDKN2A \| 6.466 \| DISEASES 55602 \| CDKN2AIP \| 1.247 \| DISEASES 1032 \| CDKN2D \| 3.474 \| DISEASES 1033 \| CDKN3 \| 1.406 \| DISEASES 1050 \| CEBPA \| 2.561 \| DISEASES 1052 \| CEBPD \| 1.76 \| DISEASES 51286 \| CEND1 \| 1.02 \| DISEASES 1063 \| CENPF \| 1.333 \| DISEASES 9857 \| CEP350 \| 1.374 \| DISEASES 1108 \| CHD4 \| 1.459 \| DISEASES 1111 \| CHEK1 \| 3.09 \| DISEASES 11200 \| CHEK2 \| 2.181 \| DISEASES 10519 \| CIB1 \| 2.035 \| DISEASES 11113 \| CIT \| 1.357 \| DISEASES 10987 \| COPS5 \| 1.005 \| DISEASES 1378 \| CR1 \| 2.112 \| DISEASES 1385 \| CREB1 \| 2.191 \| DISEASES 1394 \| CRHR1 \| 1.221 \| DISEASES 1395 \| CRHR2 \| 1.228 \| DISEASES 1447 \| CSN2 \| 1.164 \| DISEASES 1499 \| CTNNB1 \| 3.007 \| DISEASES 8454 \| CUL1 \| 2.249 \| DISEASES 8453 \| CUL2 \| 1.925 \| DISEASES 9820 \| CUL7 \| 1.885 \| DISEASES 1523 \| CUX1 \| 1.04 \| DISEASES 1649 \| DDIT3 \| 1.06 \| DISEASES 7913 \| DEK \| 3.012 \| DISEASES 1606 \| DGKA \| 1.52 \| DISEASES 8525 \| DGKZ \| 2.685 \| DISEASES 1719 \| DHFR \| 3.596 \| DISEASES 56616 \| DIABLO \| 1.077 \| DISEASES 23405 \| DICER1 \| 1.264 \| DISEASES 1786 \| DNMT1 \| 2.923 \| DISEASES 1789 \| DNMT3B \| 1.232 \| DISEASES 1791 \| DNTT \| 2.324 \| DISEASES 1869 \| E2F1 \| 5.184 \| DISEASES 1870 \| E2F2 \| 4.89 \| DISEASES 1874 \| E2F4 \| 5.754 \| DISEASES 1875 \| E2F5 \| 4.706 \| DISEASES 1876 \| E2F6 \| 3.451 \| DISEASES 144455 \| E2F7 \| 2.934 \| DISEASES 23741 \| EID1 \| 2.739 \| DISEASES 1978 \| EIF4EBP1 \| 2.083 \| DISEASES 64100 \| ELSPBP1 \| 2.062 \| DISEASES 57634 \| EP400 \| 3.069 \| DISEASES 2098 \| ESD \| 4.052 \| DISEASES 2100 \| ESR2 \| 1.875 \| DISEASES 2130 \| EWSR1 \| 1.001 \| DISEASES 355 \| FAS \| 1.032 \| DISEASES 23014 \| FBXO21 \| 1.577 \| DISEASES 2258 \| FGF13 \| 1.395 \| DISEASES 2261 \| FGFR3 \| 1.402 \| DISEASES 2272 \| FHIT \| 1.218 \| DISEASES 2280 \| FKBP1A \| 1.362 \| DISEASES 642489 \| FKBP1C \| 1.458 \| DISEASES 23048 \| FNBP1 \| 1.618 \| DISEASES 2305 \| FOXM1 \| 1.35 \| DISEASES 2308 \| FOXO1 \| 1.694 \| DISEASES 2309 \| FOXO3 \| 1.435 \| DISEASES 4303 \| FOXO4 \| 1.062 \| DISEASES 2444 \| FRK \| 1.278 \| DISEASES 51343 \| FZR1 \| 2.042 \| DISEASES 1647 \| GADD45A \| 2.317 \| DISEASES 2623 \| GATA1 \| 1.036 \| DISEASES 54815 \| GATAD2A \| 1.41 \| DISEASES 2665 \| GDI2 \| 1.403 \| DISEASES 2737 \| GLI3 \| 1.393 \| DISEASES 29889 \| GNL2 \| 1.121 \| DISEASES 9402 \| GRAP2 \| 1.046 \| DISEASES 392862 \| GRID2IP \| 1.11 \| DISEASES 2932 \| GSK3B \| 2.503 \| DISEASES 2959 \| GTF2B \| 3.147 \| DISEASES 2962 \| GTF2F1 \| 1.283 \| DISEASES 2969 \| GTF2I \| 1.519 \| DISEASES 2975 \| GTF3C1 \| 1.116 \| DISEASES 3005 \| H1F0 \| 4.62 \| DISEASES 3014 \| H2AFX \| 2.417 \| DISEASES 3065 \| HDAC1 \| 3.937 \| DISEASES 3066 \| HDAC2 \| 2.52 \| DISEASES 55869 \| HDAC8 \| 1.918 \| DISEASES 3091 \| HIF1A \| 1.76 \| DISEASES 8359 \| HIST1H4A \| 2.772 \| DISEASES 8366 \| HIST1H4B \| 2.772 \| DISEASES 8364 \| HIST1H4C \| 2.772 \| DISEASES 8360 \| HIST1H4D \| 2.771 \| DISEASES 8367 \| HIST1H4E \| 2.772 \| DISEASES 8361 \| HIST1H4F \| 2.772 \| DISEASES 8294 \| HIST1H4I \| 2.772 \| DISEASES 8363 \| HIST1H4J \| 2.772 \| DISEASES 8362 \| HIST1H4K \| 2.772 \| DISEASES 8368 \| HIST1H4L \| 2.772 \| DISEASES 333932 \| HIST2H3A \| 1.404 \| DISEASES 8370 \| HIST2H4A \| 2.772 \| DISEASES 554313 \| HIST2H4B \| 2.772 \| DISEASES 121504 \| HIST4H4 \| 2.772 \| DISEASES 3122 \| HLA-DRA \| 2.714 \| DISEASES 3135 \| HLA-G \| 1.072 \| DISEASES 8091 \| HMGA2 \| 1.499 \| DISEASES 127540 \| HMGB4 \| 1.048 \| DISEASES 3320 \| HSP90AA1 \| 2.189 \| DISEASES 3397 \| ID1 \| 2.322 \| DISEASES 3399 \| ID3 \| 1.298 \| DISEASES 3451 \| IFNA17 \| 1.013 \| DISEASES 3441 \| IFNA4 \| 1.098 \| DISEASES 3481 \| IGF2 \| 1.708 \| DISEASES 3482 \| IGF2R \| 1.291 \| DISEASES 3486 \| IGFBP3 \| 1.007 \| DISEASES 11009 \| IL24 \| 1.146 \| DISEASES 3684 \| ITGAM \| 1.197 \| DISEASES 3713 \| IVL \| 1.247 \| DISEASES 3714 \| JAG2 \| 1.285 \| DISEASES 3725 \| JUN \| 3.898 \| DISEASES 10524 \| KAT5 \| 1.003 \| DISEASES 11104 \| KATNA1 \| 1.304 \| DISEASES 5927 \| KDM5A \| 3.536 \| DISEASES 10765 \| KDM5B \| 1.894 \| DISEASES 7403 \| KDM6A \| 1.638 \| DISEASES 9928 \| KIF14 \| 3.273 \| DISEASES 23633 \| KPNA6 \| 1.035 \| DISEASES 402569 \| KPNA7 \| 2.153 \| DISEASES 10660 \| LBX1 \| 1.207 \| DISEASES 3939 \| LDHA \| 1.17 \| DISEASES 10186 \| LHFP \| 1.066 \| DISEASES 91750 \| LIN52 \| 2.887 \| DISEASES 132660 \| LIN54 \| 2.8 \| DISEASES 286826 \| LIN9 \| 3.249 \| DISEASES 100862704 \| LINC00441 \| 1.999 \| DISEASES 9860 \| LRIG2 \| 1.378 \| DISEASES 4110 \| MAGEA11 \| 1.45 \| DISEASES 4133 \| MAP2 \| 1.309 \| DISEASES 5609 \| MAP2K7 \| 3.375 \| DISEASES 5599 \| MAPK8 \| 2.455 \| DISEASES 5601 \| MAPK9 \| 1.501 \| DISEASES 23383 \| MAU2 \| 1.013 \| DISEASES 4149 \| MAX \| 1.109 \| DISEASES 4170 \| MCL1 \| 2.397 \| DISEASES 4193 \| MDM2 \| 4.967 \| DISEASES 4194 \| MDM4 \| 3.705 \| DISEASES 4221 \| MEN1 \| 1.891 \| DISEASES 407975 \| MIR17HG \| 1.587 \| DISEASES 284424 \| MIR7-3HG \| 2.244 \| DISEASES 57591 \| MKL1 \| 1.315 \| DISEASES 4318 \| MMP9 \| 1.657 \| DISEASES 10933 \| MORF4L1 \| 2.654 \| DISEASES 9643 \| MORF4L2 \| 1.047 \| DISEASES 2475 \| MTOR \| 2.727 \| DISEASES 4602 \| MYB \| 2.099 \| DISEASES 4603 \| MYBL1 \| 1.162 \| DISEASES 4609 \| MYC \| 5.102 \| DISEASES 23310 \| NCAPD3 \| 2.447 \| DISEASES 4692 \| NDN \| 1.942 \| DISEASES 10763 \| NES \| 1.223 \| DISEASES 4763 \| NF1 \| 1.697 \| DISEASES 4771 \| NF2 \| 1.01 \| DISEASES 4799 \| NFX1 \| 1.033 \| DISEASES 4803 \| NGF \| 2.5 \| DISEASES 4831 \| NME2 \| 2.139 \| DISEASES 4893 \| NRAS \| 2.212 \| DISEASES 8204 \| NRIP1 \| 1.176 \| DISEASES 4901 \| NRL \| 1.758 \| DISEASES 28989 \| NTMT1 \| 1.502 \| DISEASES 4914 \| NTRK1 \| 1.4 \| DISEASES 26747 \| NUFIP1 \| 1.927 \| DISEASES 10896 \| OCLM \| 1.125 \| DISEASES 4998 \| ORC1 \| 1.374 \| DISEASES 5015 \| OTX2 \| 1.314 \| DISEASES 10606 \| PAICS \| 1.778 \| DISEASES 142 \| PARP1 \| 3.284 \| DISEASES 5080 \| PAX6 \| 2.606 \| DISEASES 5100 \| PCDH8 \| 1.44 \| DISEASES 56146 \| PCDHA2 \| 2.004 \| DISEASES 7703 \| PCGF2 \| 1.272 \| DISEASES 5111 \| PCNA \| 2.004 \| DISEASES 5148 \| PDE6G \| 1.681 \| DISEASES 5241 \| PGR \| 1.704 \| DISEASES 23654 \| PLXNB2 \| 1.108 \| DISEASES 5499 \| PPP1CA \| 3.467 \| DISEASES 5501 \| PPP1CC \| 2.509 \| DISEASES 5514 \| PPP1R10 \| 3.224 \| DISEASES 151242 \| PPP1R1C \| 1.42 \| DISEASES 9858 \| PPP1R26 \| 1.859 \| DISEASES 5515 \| PPP2CA \| 1.163 \| DISEASES 5537 \| PPP6C \| 2.301 \| DISEASES 639 \| PRDM1 \| 2.381 \| DISEASES 8842 \| PROM1 \| 1.247 \| DISEASES 5728 \| PTEN \| 3.128 \| DISEASES 5743 \| PTGS2 \| 1.662 \| DISEASES 5784 \| PTPN14 \| 1.514 \| DISEASES 9232 \| PTTG1 \| 1.109 \| DISEASES 5813 \| PURA \| 1.952 \| DISEASES 5814 \| PURB \| 1.089 \| DISEASES 5915 \| RARB \| 1.657 \| DISEASES 11186 \| RASSF1 \| 1.448 \| DISEASES 9770 \| RASSF2 \| 1.084 \| DISEASES 83593 \| RASSF5 \| 1.012 \| DISEASES 5928 \| RBBP4 \| 4.641 \| DISEASES 5931 \| RBBP7 \| 4.393 \| DISEASES 5932 \| RBBP8 \| 2.241 \| DISEASES 10741 \| RBBP9 \| 3.18 \| DISEASES 5933 \| RBL1 \| 7.369 \| DISEASES 3516 \| RBPJ \| 1.481 \| DISEASES 57109 \| REXO4 \| 1.086 \| DISEASES 28984 \| RGCC \| 4.474 \| DISEASES 6005 \| RHAG \| 1.706 \| DISEASES 387 \| RHOA \| 2.079 \| DISEASES 6025 \| RN5S1@ \| 1.818 \| DISEASES 63891 \| RNF123 \| 1.081 \| DISEASES 285533 \| RNF175 \| 1.859 \| DISEASES 6053 \| RNR2 \| 1.247 \| DISEASES 6118 \| RPA2 \| 1.215 \| DISEASES 6222 \| RPS18 \| 1.271 \| DISEASES 6194 \| RPS6 \| 1.53 \| DISEASES 6195 \| RPS6KA1 \| 1.194 \| DISEASES 860 \| RUNX2 \| 1.613 \| DISEASES 6256 \| RXRA \| 1.487 \| DISEASES 6295 \| SAG \| 2.248 \| DISEASES 29950 \| SERTAD1 \| 1.5 \| DISEASES 9792 \| SERTAD2 \| 2.036 \| DISEASES 6464 \| SHC1 \| 1.411 \| DISEASES 23309 \| SIN3B \| 1.746 \| DISEASES 7884 \| SLBP \| 1.765 \| DISEASES 6560 \| SLC12A4 \| 1.622 \| DISEASES 1811 \| SLC26A3 \| 1.363 \| DISEASES 22950 \| SLC4A1AP \| 2.011 \| DISEASES 4088 \| SMAD3 \| 1.492 \| DISEASES 4089 \| SMAD4 \| 1.148 \| DISEASES 6594 \| SMARCA1 \| 1.625 \| DISEASES 6597 \| SMARCA4 \| 3.485 \| DISEASES 27127 \| SMC1B \| 1.131 \| DISEASES 150572 \| SMYD1 \| 1.928 \| DISEASES 56950 \| SMYD2 \| 2.21 \| DISEASES 64754 \| SMYD3 \| 1.338 \| DISEASES 10322 \| SMYD5 \| 1.733 \| DISEASES 6619 \| SNAPC3 \| 1.756 \| DISEASES 26770 \| SNORD79 \| 1.083 \| DISEASES 6657 \| SOX2 \| 2.045 \| DISEASES 6667 \| SP1 \| 2.423 \| DISEASES 10638 \| SPHAR \| 2.912 \| DISEASES 6714 \| SRC \| 2.873 \| DISEASES 6428 \| SRSF3 \| 1.01 \| DISEASES 6736 \| SRY \| 1.241 \| DISEASES 23648 \| SSBP3 \| 1.09 \| DISEASES 6772 \| STAT1 \| 1.625 \| DISEASES 81551 \| STMN4 \| 1.399 \| DISEASES 8803 \| SUCLA2 \| 1.086 \| DISEASES 6839 \| SUV39H1 \| 2.812 \| DISEASES 6850 \| SYK \| 2.066 \| DISEASES 79718 \| TBL1XR1 \| 1.295 \| DISEASES 84260 \| TCHP \| 4.223 \| DISEASES 7005 \| TEAD3 \| 1.192 \| DISEASES 7027 \| TFDP1 \| 4.229 \| DISEASES 7029 \| TFDP2 \| 1.743 \| DISEASES 51270 \| TFDP3 \| 3.118 \| DISEASES 7042 \| TGFB2 \| 1.024 \| DISEASES 7068 \| THRB \| 1.517 \| DISEASES 79639 \| TMEM53 \| 2.281 \| DISEASES 7124 \| TNF \| 1.488 \| DISEASES 7150 \| TOP1 \| 1.327 \| DISEASES 7153 \| TOP2A \| 1.264 \| DISEASES 7155 \| TOP2B \| 1.526 \| DISEASES 7158 \| TP53BP1 \| 2.663 \| DISEASES 112858 \| TP53RK \| 1.039 \| DISEASES 7161 \| TP73 \| 1.023 \| DISEASES 8805 \| TRIM24 \| 1.6 \| DISEASES 8295 \| TRRAP \| 2.916 \| DISEASES 10628 \| TXNIP \| 1.129 \| DISEASES 7337 \| UBE3A \| 1.802 \| DISEASES 23352 \| UBR4 \| 2.681 \| DISEASES 7421 \| VDR \| 1.486 \| DISEASES 7422 \| VEGFA \| 2.704 \| DISEASES 23339 \| VPS39 \| 2.403 \| DISEASES 11193 \| WBP4 \| 1.552 \| DISEASES 7465 \| WEE1 \| 1.647 \| DISEASES 7490 \| WT1 \| 2.501 \| DISEASES 51741 \| WWOX \| 1.807 \| DISEASES 331 \| XIAP \| 2.073 \| DISEASES 7514 \| XPO1 \| 2.169 \| DISEASES 6935 \| ZEB1 \| 1.49 \| DISEASES 162239 \| ZFP1 \| 2.088 \| DISEASES 161882 \| ZFPM1 \| 1.141 \| DISEASES
Locus	(Waiting for update.)

Disease ID	14
Disease	retinoblastoma
Integrated Phenotype	HPO \| Name(Total Integrated Phenotypes:1) HP:0009919 \| Retinoblastoma
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:25) HP:0002664 \| Neoplasia \| 15 HP:0000541 \| Detached retina \| 3 HP:0030408 \| Pineoblastoma \| 3 HP:0000555 \| Leukocoria \| 2 HP:0002665 \| Lymphoma \| 2 HP:0012125 \| Prostate cancer \| 1 HP:0030080 \| Burkitt lymphoma \| 1 HP:0100724 \| Hypercoagulability \| 1 HP:0012683 \| Pineal cyst \| 1 HP:0000488 \| Noninflammatory retina disease \| 1 HP:0002669 \| Osteosarcoma \| 1 HP:0002893 \| Pituitary adenoma \| 1 HP:0000518 \| Cataract \| 1 HP:0000365 \| Hearing impairment \| 1 HP:0001510 \| Growth deficiency \| 1 HP:0001903 \| Anemia \| 1 HP:0011886 \| Hyphema \| 1 HP:0011497 \| New blood vessel formation in iris \| 1 HP:0012230 \| Rhegmatogenous retinal detachment \| 1 HP:0004322 \| Stature below 3rd percentile \| 1 HP:0001249 \| Mental retardation \| 1 HP:0030731 \| Carcinoma \| 1 HP:0000667 \| Phthisis bulbi \| 1 HP:0001289 \| Confusion \| 1 HP:0002597 \| Abnormality of blood vessels \| 1

Disease ID	14
Disease	retinoblastoma
Manually Symptom	UMLS \| Name(Total Manually Symptoms:32) C2697383 \| osteosarcoma C2063120 \| pineoblastoma C1963266 \| uveitis C1963229 \| retinal detachment C1962986 \| glaucoma C1704327 \| bone sarcomas C1658953 \| tumor vasculature C1608408 \| malignant transformation C1402829 \| leukoencephalitis C1261473 \| sarcoma C0920196 \| carcinoma of the eyelid C0686377 \| central nervous system metastases C0677930 \| primary neoplasm C0496836 \| ocular cancer C0426768 \| o sign C0422833 \| ent symptoms C0280449 \| secondary acute myelogenous leukemia C0265451 \| 13q deletion syndrome C0220654 \| malignant meningitis C0220650 \| brain metastasis C0162678 \| neurofibromatosis C0154916 \| rubeosis iridis C0153690 \| bone metastases C0152458 \| leukocoria C0149893 \| secondary glaucoma C0086543 \| cataracts C0036454 \| visual field defects C0027627 \| secondary malignancies C0025362 \| mental retardation C0025289 \| meningitis C0015414 \| ocular tumor C0008626 \| chromosomal abnormality
Text Mined Symptom	UMLS \| Name \| Sentences' Count(Total Symptoms:6) C0035305 \| retinal detachment \| 3 C0205898 \| pineoblastoma \| 3 C0152458 \| leukocoria \| 2 C0029463 \| osteosarcoma \| 1 C0015414 \| ocular tumor \| 1 C0086543 \| cataracts \| 1

Manually Genotype(Total Manually Genotypes:1)
Gene	Mutation	DOI	Article Title
RB1	-	doi:10.1038/gim.2015.51	Clinical performance of the CytoScan Dx Assay in diagnosing developmental delay/intellectual disability

Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:106)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs1051266	20310006	4524	MTHFR	umls:C0035335	BeFree	A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma.	0.002909916	2010	SLC19A1	21	45537880	T	C
rs1051266	20310006	6573	SLC19A1	umls:C0035335	BeFree	A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma.	0.000542884	2010	SLC19A1	21	45537880	T	C
rs1051266	20310006	7298	TYMS	umls:C0035335	BeFree	A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma.	0.002638474	2010	SLC19A1	21	45537880	T	C
rs121912431	12657672	6647	SOD1	umls:C0035335	BeFree	Pharmacological treatment of SOD1(G37R) mice with minocycline, a compound that attenuates microgliosis and slows down disease, lessened the dysregulation of Cdk5/Cdk4 and the phosphorylation of Rb.	0.000271442	2003	SOD1	21	31663829	G	A
rs121913296	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48345108	G	T
rs121913300	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48367512	C	G,T
rs121913301	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48368549	C	T
rs121913302	20059380	5925	RB1	umls:C0035335	BeFree	A c.1363C>T (p.R455X) nonsense mutation of RB1 gene in a southern Chinese retinoblastoma pedigree.	0.499992533	2010	RB1	13	48379624	C	T
rs121913302	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48379624	C	T
rs121913303	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48381402	C	T
rs121913304	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48381414	C	T
rs121913305	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48453032	C	T
rs137853292	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48452997	C	T
rs137853293	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48465238	C	T
rs137853294	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48459708	C	T
rs137853296	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48463758	T	C
rs137853297	16631255	5925	RB1	umls:C0035335	BeFree	To describe the documented growth, clinical course, and histopathology of retinoblastomas in an untreated and otherwise normal right eye of a 27-year-old white male with a g.153211T>A (p.Tyr606X) mutation in the retinoblastoma 1 gene, whose left eye was enucleated at age 2 years for 2 retinoblastomas.	0.499992533	2006	RB1	13	48456207	T	A
rs137853297	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48456207	T	A
rs1805087	20310006	4524	MTHFR	umls:C0035335	BeFree	A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma.	0.002909916	2010	MTR	1	236885200	A	G
rs1805087	20310006	7298	TYMS	umls:C0035335	BeFree	A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma.	0.002638474	2010	MTR	1	236885200	A	G
rs1805087	20310006	6573	SLC19A1	umls:C0035335	BeFree	A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma.	0.000542884	2010	MTR	1	236885200	A	G
rs1805087	20310006	4548	MTR	umls:C0035335	BeFree	MTR polymorphic variant A2756G and retinoblastoma risk in Brazilian children.	0.002638474	2010	MTR	1	236885200	A	G
rs3092891	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48379594	C	T
rs368087026	20310006	6573	SLC19A1	umls:C0035335	BeFree	A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma.	0.000542884	2010	SLC19A1	21	45530890	G	A
rs368087026	20310006	7298	TYMS	umls:C0035335	BeFree	A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma.	0.002638474	2010	SLC19A1	21	45530890	G	A
rs368087026	20310006	4524	MTHFR	umls:C0035335	BeFree	A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma.	0.002909916	2010	SLC19A1	21	45530890	G	A
rs386514057	20310006	7298	TYMS	umls:C0035335	BeFree	A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma.	0.002638474	2010	NA	NA	NA	NA	NA
rs386514057	20310006	6573	SLC19A1	umls:C0035335	BeFree	A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma.	0.000542884	2010	NA	NA	NA	NA	NA
rs386514057	20310006	4524	MTHFR	umls:C0035335	BeFree	A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma.	0.002909916	2010	NA	NA	NA	NA	NA
rs387906520	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1;LINC00441	13	48303724	G	T
rs387906521	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1;LINC00441	13	48303715	G	A
rs397507444	20310006	7298	TYMS	umls:C0035335	BeFree	A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma.	0.002638474	2010	MTHFR	1	11794407	T	G
rs397507444	20310006	6573	SLC19A1	umls:C0035335	BeFree	A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma.	0.000542884	2010	MTHFR	1	11794407	T	G
rs397507444	20310006	4524	MTHFR	umls:C0035335	BeFree	A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma.	0.002909916	2010	MTHFR	1	11794407	T	G
rs398123331	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48380062	C	T
rs398123332	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48381333	-	T
rs398123333	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48459794	GAATGAGTATGAA	CAC
rs55819519	22674453	7157	TP53	umls:C0035335	BeFree	Using immunohistochemistry, we investigated expression of R132H IDH1, and p53 and retinoblastoma pathways.	0.060551401	2012	TP53	17	7673751	C	T
rs587776779	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48473391	G	-
rs587776780	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48456351	T	C
rs587776781	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48465030	G	-
rs587776782	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48367604	G	A,T
rs587776783	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48373493	G	A
rs587776784	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48453057	AATCTGCTTG	-
rs587776785	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48456338	TTTATAAAA	-
rs587776786	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48464997	G	A
rs587776787	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48463835	G	A
rs587776788	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48380182	ACA	-
rs587776789	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48349024	G	T
rs587776790	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1;LINC00441	13	48303977	-	GCTGCCGCCGCGGAACCCCCGGC
rs587776791	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48471962	A	G
rs587778823	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1;LINC00441	13	48303984	GCC	-
rs587778824	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48307370	-	TA
rs587778825	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48342639	GT	-
rs587778826	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48347832	G	T
rs587778827	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48362891	A	-
rs587778828	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48364916	-	A
rs587778829	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48368537	CA	-
rs587778830	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48373424	-	C
rs587778831	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48376917	G	A
rs587778832	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48380199	TT	-
rs587778833	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48456298	C	T
rs587778834	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48459700	C	A,T
rs587778835	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48463821	C	T
rs587778836	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48465016	-	TTGA
rs587778837	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48465332	G	-
rs587778838	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48473359	G	A
rs587778839	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48476845	T	C
rs587778840	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48307359	A	-
rs587778841	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48345137	TGCT	-
rs587778842	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48362859	C	T
rs587778843	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48364969	G	T
rs587778844	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48367578	A	-
rs587778845	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48373443	T	A
rs587778846	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48377035	G	A,T
rs587778847	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48379607	G	T
rs587778848	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48380215	T	C
rs587778849	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48463788	A	T
rs587778850	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48473391	G	A
rs587778851	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48476705	-	C
rs587778853	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48342638	TG	-
rs587778854	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48345162	-	T
rs587778855	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48367575	A	T
rs587778857	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48381444	G	A
rs587778858	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48453035	G	T
rs587778859	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48459828	G	A
rs587778860	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48463730	G	C
rs587778861	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48465033	T	A,C
rs587778862	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48307361	AG	-
rs587778863	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48381436	G	A
rs587778864	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48453020	C	T
rs587778865	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48456314	T	A
rs587778866	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48456316	A	G
rs587778867	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48459686	A	T
rs587778868	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48463833	G	T
rs587778869	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1;LINC00441	13	48304015	C	T
rs587778870	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48345145	C	G,T
rs587778871	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48456354	G	A
rs587781256	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48380096	ACTTTTAGTAAAAAATTTTTT	-
rs587781257	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48456296	T	-
rs727504120	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1;LINC00441	13	48303966	GGAACCCCCGGCACCGCCGCCGCCGC	-
rs727504121	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48373468	A	-
rs794727199	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48452992	G	A
rs794727372	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48465249	C	A
rs794727481	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48342631	G	A
rs797044649	NA	5925	RB1	umls:C0035335	CLINVAR	NA	0.499992533	NA	RB1	13	48380074	-	ATTATCCATTC

GWASdb Annotation(Total Genotypes:2)
Chr	Pos	SNP_Id	RefGene	EnsemblGene	ENCODE_Factor	ENCODE_TFBS	Chromosome_interaction	GTEx_eQTL	SNP_TFBS_affinity_GWAS3D	SNP_miRNA_target_affinity_PolymiRTS	SNP_splicing_effect_Skippy	SNP_splicing_effect_MutPred_Splice	SNP_ns_protein_effect_dbNSFP	SNP_syn_effect_Silva	SNP_phosphorylation_effect_PhosSNP	PhastCons_score	PhyloP_score	GERP++_RS	Segway_state	Ancestral_allele	ESP_AF	ESP_AFR	ESP_AFR	ESP_EUR	TG_ASN	TG_AMR	TG_AFR	TG_EUR	Type	Consequence	bStatistic	EncH3K27Ac	EncH3K4Me1	EncH3K4Me3	EncNucleo	OMIM	Clinvar
13	48955201	rs2804085	NM_000321,RB1	ENST00000267163,ENSG00000139687	NA	NA	chr13,48950001,48960000,chr19,30210001,30220000,7,Hi-C	NA	Oct-1,49.9386	AhR,1.3138	Oct-1,18.1154	OCT-x,39.5563	MEF-2,1.8381	NA	NA	NA	NA	NA	NA	0.168	2.818	4.62	F1	A	NA	NA	NA	0.930	1.000	0.950	0.770	0.990	Transcript	INTRONIC	343	2.00	3.24
13	49035693	rs4151601	NM_000321,RB1	ENST00000267163,ENSG00000139687	NA	NA	chr13,49030001,49040000,chr12,60850001,60860000,25,Hi-C	chr13,49030001,49040000,chr7,149500001,149510000,26,Hi-C	chr13,49030001,49040000,chr8,40810001,40820000,29,Hi-C	chr13,49030001,49040000,chr13,30220001,30230000,51,Hi-C	chr13,49030001,49040000,chr13,33060001,33070000,54,Hi-C	chr13,49030001,49040000,chr7,7080001,7090000,15,Hi-C	chr13,49030001,49040000,chr16,7100001,7110000,18,Hi-C	chr13,49030001,49040000,chr7,23380001,23390000,6,Hi-C	chr13,49030001,49040000,chr5,11140001,11150000,8,Hi-C	chr13,49030001,49040000,chr1,231410001,231420000,8,Hi-C	chr13,49030001,49040000,chr3,37220001,37230000,9,Hi-C	chr13,49030001,49040000,chr1,233880001,233890000,10,Hi-C	chr13,49030001,49040000,chr8,95980001,95990000,10,Hi-C	chr13,49030001,49040000,chr16,1130001,1140000,25,Hi-C	NA	LM12,2.0316	LM71,10.4015	LM100,1.3897	LM217,1.8766	LM220,1.8826	NA	NA	NA	NA	NA	NA	0.000	0.039	0.181	F0	G

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:1)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0009919	Retinoblastoma	MP:0013886	increased CD4-negative, CD25-positive NK T cell number	increase in the number of CD4-negative NK T cells expressing the activation marker CD25

Disease ID	14
Disease	retinoblastoma
Case	(Waiting for update.)