eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| renpenning syndrome | ||||
| Disease ID | 1964 |
|---|---|
| Disease | renpenning syndrome |
| Synonym | golabi-ito-hall syndrome hamel cerebropalatocardiac syndrome mental retardation, x-linked 55 mental retardation, x-linked renpenning type mental retardation, x-linked, renpenning type mental retardation, x-linked, syndromic 3 mental retardation, x-linked, syndromic 8 mental retardation, x-linked, with spastic diplegia mrx55 mrxs3 mrxs8 porteous syndrome renpenning syndrome (disorder) renpenning syndrome 1 rens1 shs sutherland-haan syndrome sutherland-haan x-linked mental retardation syndrome x-linked intellectual deficit due to pqbp1 mutation x-linked intellectual deficit due to pqbp1 mutations x-linked intellectual deficit, renpenning type x-linked mental retardation syndromic 3 x-linked mental retardation with spastic diplegia |
| Orphanet | |
| OMIM | |
| DOID | |
| UMLS | C0796135 |
| SNOMED-CT | |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:7) |
| Locus | (Waiting for update.) |
| Disease ID | 1964 |
|---|---|
| Disease | renpenning syndrome |
| Integrated Phenotype | (Waiting for update.) |
| Text Mined Phenotype | (Waiting for update.) |
| Disease ID | 1964 |
|---|---|
| Disease | renpenning syndrome |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:8) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs121917899 | NA | 10084 | PQBP1 | umls:C0796135 | CLINVAR | NA | 0.362171535 | NA | PQBP1 | X | 48901944 | A | G |
| rs121917899 | 20410308 | 10084 | PQBP1 | umls:C0796135 | BeFree | Y65C missense mutation in the WW domain of the Golabi-Ito-Hall syndrome protein PQBP1 affects its binding activity and deregulates pre-mRNA splicing. | 0.362171535 | 2010 | PQBP1 | X | 48901944 | A | G |
| rs606231193 | NA | 10084 | PQBP1 | umls:C0796135 | CLINVAR | NA | 0.362171535 | NA | PQBP1 | X | 48902400 | - | AG |
| rs606231194 | NA | 10084 | PQBP1 | umls:C0796135 | CLINVAR | NA | 0.362171535 | NA | PQBP1 | X | 48902399 | AGAG | - |
| rs606231195 | NA | 10084 | PQBP1 | umls:C0796135 | CLINVAR | NA | 0.362171535 | NA | PQBP1 | X | 48902401 | AG | - |
| rs606231196 | NA | 10084 | PQBP1 | umls:C0796135 | CLINVAR | NA | 0.362171535 | NA | SLC35A2;PQBP1 | X | 48902793 | - | C |
| rs606231197 | NA | 10084 | PQBP1 | umls:C0796135 | CLINVAR | NA | 0.362171535 | NA | PQBP1 | X | 48902487 | GAGCTGGCTCCCTATCCCAAGAG | - |
| rs606231198 | NA | 10084 | PQBP1 | umls:C0796135 | CLINVAR | NA | 0.362171535 | NA | PQBP1 | X | 48902274 | AGGGGCCATGACAAGTCGGAC | - |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:0) |
|---|
| (Waiting for update.) |
Mapped by homologous gene(Total Items:0) |
|---|
| (Waiting for update.) |
| Disease ID | 1964 |
|---|---|
| Disease | renpenning syndrome |
| Case | (Waiting for update.) |