eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| papillorenal syndrome | ||||
| Disease ID | 1939 |
|---|---|
| Disease | papillorenal syndrome |
| Definition | A genetic disorder caused by PAX2 gene mutations that is characterized by renal hypoplasia and a spectrum of congenital anomalies of the eye and urinary tract.(NICHD) |
| Synonym | cakut with or without ocular abnormalities coloboma of optic nerve with renal disease coloboma-ureteral-renal syndrome congenital anomalies of the kidney and urinary tract with or without ocular abnormalities optic coloboma, vesicoureteral reflux, and renal anomalies optic nerve coloboma renal syndrome optic nerve coloboma with renal disease paprs renal coloboma syndrome renal coloboma syndrome (disorder) renal-coloboma syndrome renal-coloboma syndrome with macular abnormalities |
| Orphanet | |
| OMIM | |
| UMLS | C1852759 |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:1) |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:15) 186 | AGTR2 | 1.479 | DISEASES 55636 | CHD7 | 1.917 | DISEASES 1285 | COL4A3 | 1.935 | DISEASES 1286 | COL4A4 | 2.273 | DISEASES 1287 | COL4A5 | 1.832 | DISEASES 2138 | EYA1 | 2.81 | DISEASES 9573 | GDF3 | 1.348 | DISEASES 2668 | GDNF | 1.086 | DISEASES 55083 | KIF26B | 3.787 | DISEASES 54900 | LAX1 | 1.94 | DISEASES 5015 | OTX2 | 2.278 | DISEASES 5076 | PAX2 | 7.438 | DISEASES 5079 | PAX5 | 1.462 | DISEASES 5080 | PAX6 | 3.401 | DISEASES 7849 | PAX8 | 1.456 | DISEASES |
| Locus | (Waiting for update.) |
| Disease ID | 1939 |
|---|---|
| Disease | papillorenal syndrome |
| Integrated Phenotype | (Waiting for update.) |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:1) |
| Disease ID | 1939 |
|---|---|
| Disease | papillorenal syndrome |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:7) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs387906530 | NA | 5076 | PAX2 | umls:C1852759 | CLINVAR | NA | 0.568957582 | NA | PAX2 | 10 | 100750706 | - | GAGACC |
| rs75462234 | NA | 5076 | PAX2 | umls:C1852759 | CLINVAR | NA | 0.568957582 | NA | PAX2 | 10 | 100749778 | G | - |
| rs76675173 | NA | 5076 | PAX2 | umls:C1852759 | CLINVAR | NA | 0.568957582 | NA | PAX2 | 10 | 100749832 | CTGGCCCACCAGGGTGTGCGGC | - |
| rs77453353 | NA | 5076 | PAX2 | umls:C1852759 | CLINVAR | NA | 0.568957582 | NA | PAX2 | 10 | 100749778 | - | G,GG |
| rs77777862 | NA | 5076 | PAX2 | umls:C1852759 | CLINVAR | NA | 0.568957582 | NA | PAX2 | 10 | 100781310 | C | - |
| rs78122364 | NA | 5076 | PAX2 | umls:C1852759 | CLINVAR | NA | 0.568957582 | NA | PAX2 | 10 | 100824682 | C | A,T |
| rs79555199 | NA | 5076 | PAX2 | umls:C1852759 | CLINVAR | NA | 0.568957582 | NA | PAX2 | 10 | 100750707 | G | A |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:0) |
|---|
| (Waiting for update.) |
Mapped by homologous gene(Total Items:0) |
|---|
| (Waiting for update.) |
| Disease ID | 1939 |
|---|---|
| Disease | papillorenal syndrome |
| Case | (Waiting for update.) |