eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| opsismodysplasia | ||||
| Disease ID | 505 |
|---|---|
| Disease | opsismodysplasia |
| Definition | Opsismodysplasia is a type of skeletal dysplasia (a bone disease that interferes with bone development) first described by Zonana and associates in 1977, and designated under its current name by Maroteaux (1984). Derived from the Greek opsismos (late), the name opsismodysplasia describes a delay in bone maturation. In addition to this delay, the disorder is characterized by micromelia (short or undersized bones), particularly of the hands and feet, delay of ossification (bone cell formation), platyspondyly (flattened vertebrae), irregular metaphyses, an array of facial aberrations and respiratory distress related to chronic infection. Opsismodysplasia is congenital, being apparent at birth. It has a variable mortality, with some affected individuals living to adulthood. The disorder is rare, with an incidence of less than 1 per 1,000,000 worldwide. It is inherited in an autosomal recessive pattern, which means the defective (mutated) gene that causes the disorder is located on an autosome, and the disorder occurs when two copies of this defective gene are inherited. No specific gene has been found to be associated with the disorder. It is similar to spondylometaphyseal dysplasia, Sedaghatian type.[1][2][3][4][5] - Wikipedia Reference: https://en.wikipedia.org/wiki/opsismodysplasia |
| Synonym | opsismodysplasia (disorder) opsmd |
| Orphanet | |
| OMIM | |
| UMLS | C0432219 |
| SNOMED-CT | |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | (Waiting for update.) |
| Locus | Symbol | Locus(Total Locus:1) INPPL1 | 11q13.4 |
| Disease ID | 505 |
|---|---|
| Disease | opsismodysplasia |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:58) HP:0008905 | Rhizomelic short limbs HP:0000239 | Persistent wide fontanel HP:0000239 | Large fontanelles HP:0003196 | Short nose HP:0000463 | Nostrils anteverted HP:0000256 | Macrocrania HP:0000592 | Blue sclerae HP:0000316 | Increased distance between eye sockets HP:0002205 | Frequent respiratory infections HP:0005930 | Abnormality of epiphysis morphology HP:0003026 | shortened long tubular bones HP:0000343 | Vertical hyperplasia of philtrum HP:0004565 | Severe platyspondyly HP:0005280 | Depressed nasal bridge HP:0000767 | Pectus excavatum HP:0001561 | Hydramnios HP:0000470 | Decreased cervical height HP:0001156 | Brachydactyly syndrome HP:0002205 | Recurrent respiratory infections HP:0008479 | Hypoplastic vertebral bodies HP:0000117 | Decreased tubular maximum for phosphate reabsorption per glomerular filtration rate HP:0008873 | Dwarfism, short-limbed HP:0002007 | Frontal bossing HP:0004279 | Hypoplastic hands HP:0003177 | Squared iliac bones HP:0000774 | Narrow chest HP:0002007 | Frontal protruberance HP:0003175 | Hypoplastic ischia HP:0100569 | Abnormal vertebral ossification HP:0001538 | Protuberant abdomen HP:0001252 | Hypotonia HP:0000907 | Anteriorly splayed ribs HP:0002093 | Respiratory insufficiency HP:0000256 | Macrocephaly HP:0008479 | Small vertebrae HP:0005469 | Flat occiput HP:0003180 | Flat acetabular roof HP:0005280 | Flat, nasal bridge HP:0000774 | Low chest circumference HP:0001182 | Tapered finger HP:0000969 | Dropsy HP:0002240 | Hepatomegaly HP:0003173 | Hypoplastic pubic bones HP:0001591 | Narrow, bell-shaped thorax HP:0002148 | Hypophosphataemia HP:0001744 | Splenomegaly HP:0000922 | Anterior and posterior rib cupping HP:0003510 | Severe short stature HP:0001387 | Joint stiffness HP:0002750 | Delayed skeletal maturation HP:0011304 | Broad thumb HP:0001773 | Small feet HP:0003177 | Squaring of iliac bones HP:0003021 | Metaphyseal cupping HP:0001252 | Muscular hypotonia HP:0000944 | Abnormality of the metaphyses HP:0003175 | Hypoplastic ischium HP:0003173 | Hypoplastic pubic bone |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:1) |
| Disease ID | 505 |
|---|---|
| Disease | opsismodysplasia |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:2) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:9) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs397514508 | NA | 3636 | INPPL1 | umls:C0432219 | CLINVAR | NA | 0.361085767 | NA | INPPL1 | 11 | 72233099 | C | T |
| rs397514509 | NA | 3636 | INPPL1 | umls:C0432219 | CLINVAR | NA | 0.361085767 | NA | INPPL1 | 11 | 72229116 | C | A,G,T |
| rs397514510 | NA | 3636 | INPPL1 | umls:C0432219 | CLINVAR | NA | 0.361085767 | NA | INPPL1 | 11 | 72233098 | C | T |
| rs397514511 | NA | 3636 | INPPL1 | umls:C0432219 | CLINVAR | NA | 0.361085767 | NA | INPPL1 | 11 | 72230799 | C | T |
| rs397514512 | NA | 3636 | INPPL1 | umls:C0432219 | CLINVAR | NA | 0.361085767 | NA | INPPL1 | 11 | 72233696 | T | A |
| rs655423 | NA | 3636 | INPPL1 | umls:C0432219 | CLINVAR | NA | 0.361085767 | NA | INPPL1 | 11 | 72234616 | G | C |
| rs797044468 | NA | 3636 | INPPL1 | umls:C0432219 | CLINVAR | NA | 0.361085767 | NA | INPPL1 | 11 | 72229677 | A | - |
| rs797044469 | NA | 3636 | INPPL1 | umls:C0432219 | CLINVAR | NA | 0.361085767 | NA | INPPL1 | 11 | 72228379 | AGACC | - |
| rs797044470 | NA | 3636 | INPPL1 | umls:C0432219 | CLINVAR | NA | 0.361085767 | NA | INPPL1 | 11 | 72225078 | GAGGAGCTGCTGGCCCGGGCGGGCCGCG | - |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:20) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0001387 | Joint stiffness | MP:0003098 | decreased tendon stiffness | reduced ability of tendon to maintain tensile strength and load |
| HP:0001773 | Short foot | MP:0008138 | absent podocyte foot process | absence of the footlike extension of podocytes that interdigitate with one another to form the walls of the glomerular capillaries |
| HP:0005930 | Abnormality of epiphysis morphology | MP:0013621 | decreased internal diameter of femur | reduced cross-sectional distance that extends from one lateral edge of the femur long bone marrow cavity, through its center and to the opposite lateral edge of the bone marrow cavity through the mid point of the femur |
| HP:0100569 | Abnormal vertebral ossification | MP:0004623 | thoracic vertebral fusion | the union of one or more thoracic vertebrae into a single structure |
| HP:0000470 | Short neck | MP:0012720 | elongated neck | increased length of the neck |
| HP:0003196 | Short nose | MP:0002233 | abnormal nose morphology | any structural anomaly of the organ that is specialized for smell and is part of the respiratory system |
| HP:0000117 | Renal phosphate wasting | MP:0010110 | abnormal renal phosphate reabsorbtion | any anomaly in the process by which phosphate (salt or ester of phosphoric acid) is transported out of the renal tubules back into the bloodstream |
| HP:0000944 | Abnormality of the metaphyses | MP:0013621 | decreased internal diameter of femur | reduced cross-sectional distance that extends from one lateral edge of the femur long bone marrow cavity, through its center and to the opposite lateral edge of the bone marrow cavity through the mid point of the femur |
| HP:0003510 | Severe short stature | MP:0004355 | short radius | reduced length of the short bone of the lateral forearm |
| HP:0000907 | Anterior rib cupping | MP:0000150 | abnormal rib morphology | any structural anomaly of the bones forming the bony wall of the chest |
| HP:0000774 | Narrow chest | MP:0004134 | abnormal chest morphology | any structural anomaly of the part of the body between the neck and the abdomen |
| HP:0001252 | Muscular hypotonia | MP:0004144 | hypotonia | decreased muscle tension resulting in limpness of the muscles in the resting state, not to be confused with weakness |
| HP:0005280 | Depressed nasal bridge | MP:0013582 | abnormal lateral nasal gland morphology | any structural anomaly of the lateral nasal glands (the largest nasal secretory glands in rodents) which surround the maxillary sinus located in the lateral wall adjacent to each nasal passage and are characterized by cytologic features similar to those d |
| HP:0003026 | Short long bone | MP:0013618 | decreased areal bone mineral density | reduction of the mineral mass per unit area of bone, the hard, rigid form of connective tissue constituting most of the skeleton of vertebrates and composed chiefly of calcium salts; expressed as the amount of mineral per area cm^2 of bone (usually in g/c |
| HP:0008873 | Disproportionate short-limb short stature | MP:0004672 | short ribs | reduced length of the bones forming the bony wall of the chest |
| HP:0003177 | Squared iliac bones | MP:0004686 | decreased length of long bones | reduced end-to-end length of the several elongated bones of the extremities |
| HP:0001538 | Protuberant abdomen | MP:0001270 | distended abdomen | abdomen appears curved outward or swollen |
| HP:0002205 | Recurrent respiratory infections | MP:0014182 | decreased respiratory epithelial sodium ion transmembrane transport | decrease in the directed movement of sodium ions from one side of the respiratory epithelial cell membrane to the other |
| HP:0003173 | Hypoplastic pubic bone | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002750 | Delayed skeletal maturation | MP:0003379 | absent sexual maturation | failure to initiate pubertal changes that result in achievement of full sexual capacity |
Mapped by homologous gene(Total Items:47) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0001252 | Muscular hypotonia | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0008905 | Rhizomelia | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0005930 | Abnormality of epiphysis morphology | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000922 | Posterior rib cupping | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0001773 | Short foot | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0008479 | Hypoplastic vertebral bodies | MP:0013178 | tail necrosis | morphological changes resulting from pathological death of tail tissue; usually due to irreversible damage |
| HP:0000774 | Narrow chest | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002205 | Recurrent respiratory infections | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000463 | Anteverted nares | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0008873 | Disproportionate short-limb short stature | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000592 | Blue sclerae | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0003196 | Short nose | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0002240 | Hepatomegaly | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001744 | Splenomegaly | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000316 | Hypertelorism | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0003026 | Short long bone | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0003177 | Squared iliac bones | MP:0013774 | decreased KLRG1-positive T-helper cell number | reduction in the number of CD4-positive alpha-beta T-helper cells expressing KLRG1, a marker associated with activation |
| HP:0002093 | Respiratory insufficiency | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0001182 | Tapered finger | MP:0014178 | increased brain apoptosis | increase in the number of cells of the brain undergoing programmed cell death |
| HP:0000117 | Renal phosphate wasting | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0005280 | Depressed nasal bridge | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0001156 | Brachydactyly syndrome | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0003173 | Hypoplastic pubic bone | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001591 | Bell-shaped thorax | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0003021 | Metaphyseal cupping | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001561 | Polyhydramnios | MP:0020214 | susceptible to malignant hyperthermia | increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine |
| HP:0000767 | Pectus excavatum | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000969 | Edema | MP:0020154 | impaired humoral immune response | impaired response of the immune system that mediates secreted antibodies produced in B cells |
| HP:0002148 | Hypophosphatemia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000470 | Short neck | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0003510 | Severe short stature | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0003175 | Hypoplastic ischia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0005469 | Flat occiput | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0004279 | Short palm | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0004565 | Severe platyspondyly | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0000944 | Abnormality of the metaphyses | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000343 | Long philtrum | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0001538 | Protuberant abdomen | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001387 | Joint stiffness | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002750 | Delayed skeletal maturation | MP:0020169 | increased thyroid gland weight | higher than average weight of the thyroid gland |
| HP:0011304 | Broad thumb | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0000256 | Macrocephaly | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0002007 | Frontal bossing | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0100569 | Abnormal vertebral ossification | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0003180 | Flat acetabular roof | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000239 | Large fontanelles | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000907 | Anterior rib cupping | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| Disease ID | 505 |
|---|---|
| Disease | opsismodysplasia |
| Case | (Waiting for update.) |