| niemann-pick disease type b | ||||
| Disease ID | 305 |
|---|---|
| Disease | niemann-pick disease type b |
| Definition | An allelic disorder of TYPE A NIEMANN-PICK DISEASE, a late-onset form. It is also caused by mutation in SPHINGOMYELIN PHOSPHODIESTERASE but clinical signs involve only visceral organs (non-neuropathic type). |
| Synonym | niemann pick dis non neuronopathic type niemann pick dis type b niemann pick disease, non neuronopathic type niemann pick disease, type b niemann pick disease, visceral niemann pick's disease type b niemann picks dis type b niemann-pick disease non-neuropathic type niemann-pick disease, chronic non-neuronopathic niemann-pick disease, non-neuronopathic type niemann-pick disease, type b niemann-pick disease, type b (disorder) niemann-pick disease, type b [disease/finding] niemann-pick disease, visceral niemann-pick's disease type b type b niemann pick dis type b niemann pick disease type b niemann-pick disease |
| Orphanet | |
| OMIM | |
| DOID | |
| ICD10 | |
| UMLS | C0268243 |
| MeSH | |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:2) |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | (Waiting for update.) |
| Locus | Symbol | Locus(Total Locus:1) SMPD1 | 11p15.4 |
| Disease ID | 305 |
|---|---|
| Disease | niemann-pick disease type b |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:13) HP:0003233 | Low HDL-cholesterol HP:0002155 | Increased triglycerides HP:0001744 | Splenomegaly HP:0004322 | Stature below 3rd percentile HP:0002094 | Dyspnea HP:0002240 | Enlarged liver HP:0003141 | Hyperbetalipoproteinemia HP:0001103 | Macular abnormality HP:0002205 | Frequent respiratory infections HP:0004333 | Bone marrow foam cells HP:0002207 | Diffuse reticular or finely nodular infiltrations HP:0003609 | Foam cells with lamellar inclusion bodies HP:0001982 | Sea-blue histiocytosis |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:1) |
| Disease ID | 305 |
|---|---|
| Disease | niemann-pick disease type b |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:1) C0020473 | hyperlipidemia |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Manually Genotypes:1) | |||
|---|---|---|---|
| Gene | Mutation | DOI | Article Title |
| SMPD1 | p.R496L* | doi:10.1038/gim.2015.123 | Expanded genetic screening panel for the Ashkenazi Jewish population |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:24) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs120074117 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6394204 | G | A,T |
| rs120074118 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6394539 | CGC | - |
| rs120074122 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6391795 | G | A |
| rs120074123 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6393278 | A | G |
| rs120074124 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6391976 | T | C |
| rs120074126 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6393620 | C | T |
| rs120074127 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6393680 | C | G,T |
| rs120074128 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6391945 | C | A |
| rs182812968 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6393981 | C | T |
| rs267607073 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6393667 | C | A |
| rs281860677 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6391914 | - | TCCCCGCA |
| rs398123474 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6393215 | G | C |
| rs398123475 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6393652 | T | G |
| rs398123476 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6393975 | CT | - |
| rs398123478 | 23188845 | 6609 | SMPD1 | umls:C0268243 | BeFree | R542X mutation in SMPD1 gene: genetically novel mutation with phenotypic features intermediate between type A and type B Niemann-Pick disease. | 0.565167327 | 2014 | SMPD1 | 11 | 6394335 | C | T |
| rs398123478 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6394335 | C | T |
| rs398123479 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6391822 | G | C |
| rs727504165 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6391419 | C | - |
| rs727504166 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6391540 | T | C |
| rs727504167 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6391638 | T | - |
| rs756366019 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6391623 | - | C,T |
| rs769904764 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6394203 | C | T |
| rs794727252 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6391850 | TGTTGAGTGGGCTGGGCCCAGCC | - |
| rs794727780 | NA | 6609 | SMPD1 | umls:C0268243 | CLINVAR | NA | 0.565167327 | NA | SMPD1 | 11 | 6394540 | GCC | - |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:3) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0001103 | Abnormality of the macula | MP:0009886 | failure of palatal shelf elevation | the palatal shelves fail to move from a vertical position in the orofacial cavity to a horizontal apposition above the developing tongue |
| HP:0002205 | Recurrent respiratory infections | MP:0014182 | decreased respiratory epithelial sodium ion transmembrane transport | decrease in the directed movement of sodium ions from one side of the respiratory epithelial cell membrane to the other |
| HP:0004333 | Bone-marrow foam cells | MP:0009841 | foam cell reticulosis | an increase in cells with a vacuolated appearance due to abnormal deposition and retention of lipoproteins and derived from or related to the group of cells having the ability to take up and sequester inert particles and vital dyes, including macrophages |
Mapped by homologous gene(Total Items:13) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0003141 | Hyperbetalipoproteinemia | MP:0020215 | impaired blood coagulation | impaired ability of the blood to clot |
| HP:0002094 | Dyspnea | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| HP:0003233 | Hypoalphalipoproteinemia | MP:0020215 | impaired blood coagulation | impaired ability of the blood to clot |
| HP:0004333 | Bone-marrow foam cells | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| HP:0001982 | Sea-blue histiocytosis | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| HP:0002240 | Hepatomegaly | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001103 | Abnormality of the macula | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| HP:0002155 | Hypertriglyceridemia | MP:0020234 | decreased basal metabolism | decrease in heat production of an organism at the lowest level of cell chemistry in an inactive, awake, and fasting state |
| HP:0002205 | Recurrent respiratory infections | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0002207 | Diffuse reticular or finely nodular infiltrations | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| HP:0004322 | Short stature | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0003609 | Foam cells with lamellar inclusion bodies | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| HP:0001744 | Splenomegaly | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| Disease ID | 305 |
|---|---|
| Disease | niemann-pick disease type b |
| Case | (Waiting for update.) |