eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| muir-torre syndrome | ||||
| Disease ID | 303 |
|---|---|
| Disease | muir-torre syndrome |
| Definition | A form of LYNCH SYNDROME II associated with cutaneous SEBACEOUS GLAND NEOPLASMS. Muir-Torre syndrome is also associated with other visceral malignant diseases include colorectal, endometrial, urological, and upper gastrointestinal neoplasms. |
| Synonym | cutaneous sebaceous neoplasms and keratoacanthomas, multiple, with gastrointestinal and other carcinomas mrtes muir torre syndrome muir torres syndrome muir-torre syndrome [disease/finding] muir-torré syndrome syndrome, muir-torre torre-muir syndrome torré-muir syndrome torré-muir syndrome (disorder) |
| Orphanet | |
| OMIM | |
| DOID | |
| UMLS | C1321489 |
| MeSH | |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:11) C0036503 | sebaceous neoplasm | 4 C0001430 | adenoma | 1 C0039538 | teratoma | 1 C1368903 | cystic teratoma | 1 C0001418 | adenocarcinoma | 1 C0018553 | cowden syndrome | 1 C0007102 | colon cancer | 1 C0018553 | cowden's syndrome | 1 C0011649 | mature cystic teratoma | 1 C0279672 | cervical adenocarcinoma | 1 C0022572 | keratoacanthomas | 1 |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:3) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:16) 339883 | C3orf35 | 3.408 | DISEASES 1029 | CDKN2A | 1.237 | DISEASES 387836 | CLEC2A | 2.52 | DISEASES 1301 | COL11A1 | 1.629 | DISEASES 2272 | FHIT | 2.3 | DISEASES 2803 | GOLGA4 | 2.515 | DISEASES 9209 | LRRFIP2 | 3.56 | DISEASES 4439 | MSH5 | 2.284 | DISEASES 4595 | MUTYH | 3.602 | DISEASES 5378 | PMS1 | 4.168 | DISEASES 5728 | PTEN | 1.047 | DISEASES 7905 | REEP5 | 2.984 | DISEASES 6336 | SCN10A | 1.224 | DISEASES 6443 | SGCB | 1.757 | DISEASES 26801 | SNORD48 | 2.543 | DISEASES 6839 | SUV39H1 | 1.788 | DISEASES |
| Locus | Symbol | Locus(Total Locus:3) |
| Disease ID | 303 |
|---|---|
| Disease | muir-torre syndrome |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:12) HP:0009720 | Adenoma sebaceum HP:0006753 | Neoplasm of the stomach HP:0006758 | Malignant genitourinary tract tumor HP:0004377 | Hematological neoplasm HP:0012114 | Endometrial carcinoma HP:0002896 | Neoplasm of the liver HP:0012118 | Laryngeal carcinoma HP:0008069 | Neoplasm of the skin HP:0009726 | Renal neoplasm HP:0003002 | Breast carcinoma HP:0100684 | Salivary gland neoplasm HP:0003003 | Colon cancer |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:6) HP:0030731 | Carcinoma | 3 HP:0002664 | Neoplasia | 3 HP:0030410 | Sebaceous carcinoma | 2 HP:0009720 | Sebaceous adenoma | 1 HP:0009792 | Teratoma | 1 HP:0003003 | Colon cancer | 1 |
| Disease ID | 303 |
|---|---|
| Disease | muir-torre syndrome |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:10) C1709308 | ocular sebaceous carcinoma C1621958 | glioblastoma multiforme C1275210 | sebaceoma C0699885 | carcinoma of the bladder C0678222 | carcinoma of the breast C0338106 | adenocarcinoma of the colon C0206684 | sebaceous gland carcinoma C0206684 | sebaceous carcinoma C0037284 | skin lesions C0022572 | keratoacanthomas |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:2) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:3) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs113488022 | 24767862 | 673 | BRAF | umls:C1321489 | BeFree | We conclude that a V600E BRAF mutation may not be helpful in distinguishing sporadic from MTS-associated sebaceous neoplasms. | 0.000271442 | 2014 | BRAF | 7 | 140753336 | A | T,G,C |
| rs587776529 | NA | 4436 | MSH2 | umls:C1321489 | CLINVAR | NA | 0.375220608 | NA | MSH2 | 2 | 47408479 | - | AAGATCTTCTTCTGGTTCGTCA |
| rs63750047 | NA | 4436 | MSH2 | umls:C1321489 | CLINVAR | NA | 0.375220608 | NA | MSH2 | 2 | 47475066 | C | T |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:7) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0006753 | Neoplasm of the stomach | MP:0009536 | abnormal interstitial cell of Cajal morphology | any structural anomaly in the type of cell found in the gastrointestinal tract and serving as a pacemaker that triggers gut contraction; ICCs mediate inputs from the enteric nervous system to smooth muscle cells and are thought to be the cells from which |
| HP:0012114 | Endometrial carcinoma | MP:0010346 | increased thyroid carcinoma incidence | greater than the expected number of a malignant epithelial neoplasms of the thyroid gland, occurring in a specific population in a given time period |
| HP:0008069 | Neoplasm of the skin | MP:0011205 | excessive folding of visceral yolk sac | the appearance of wrinkles or folds on the surface of the visceral yolk sac |
| HP:0006758 | Malignant genitourinary tract tumor | MP:0010299 | increased mammary gland tumor incidence | greater than the expected number of neoplasms in the mammary gland, usually in the form of a distinct mass, in a specific population in a given time period |
| HP:0003002 | Breast carcinoma | MP:0010367 | increased spindle cell carcinoma incidence | greater than the expected number of a highly malignant variant of squamous cell carcinoma, occurring in a specific population in a given time period; spindle cell carcinoma shows biphasic proliferation of conventional SCC component and malignant spindle s |
| HP:0012118 | Laryngeal carcinoma | MP:0008714 | increased lung carcinoma incidence | greater than the expected number of a malignant neoplasm of the ling, arising from epithelial cells, usually glandular or squamous, occurring in a specific population in a given time period |
| HP:0100684 | Salivary gland neoplasm | MP:0000661 | small prostate gland ventral lobe | reduced size of the rodent prostate lobe that is located below the ventral aspect of the bladder neck |
Mapped by homologous gene(Total Items:11) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0100684 | Salivary gland neoplasm | MP:0013319 | seminal vesicle atrophy | acquired size diminution of the seminal vesicles, associated with wasting as from death and reabsorbtion of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| HP:0008069 | Neoplasm of the skin | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0003003 | Colon cancer | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0012114 | Endometrial carcinoma | MP:0014171 | increased fatty acid oxidation | increased rate or incidence of the process of removal of one or more electrons from a fatty acid, with or without the concomitant removal of a proton or protons, by reaction with an electron-accepting substance, by addition of oxygen or by removal of hydr |
| HP:0006758 | Malignant genitourinary tract tumor | MP:0012431 | increased lymphoma incidence | greater than the expected number of neoplasms characterized by a proliferation of malignant lymphocytes in lymphoid tissue in a specific population in a given time period |
| HP:0009726 | Renal neoplasm | MP:0014171 | increased fatty acid oxidation | increased rate or incidence of the process of removal of one or more electrons from a fatty acid, with or without the concomitant removal of a proton or protons, by reaction with an electron-accepting substance, by addition of oxygen or by removal of hydr |
| HP:0012118 | Laryngeal carcinoma | MP:0012431 | increased lymphoma incidence | greater than the expected number of neoplasms characterized by a proliferation of malignant lymphocytes in lymphoid tissue in a specific population in a given time period |
| HP:0003002 | Breast carcinoma | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0004377 | Hematological neoplasm | MP:0020154 | impaired humoral immune response | impaired response of the immune system that mediates secreted antibodies produced in B cells |
| HP:0009720 | Adenoma sebaceum | MP:0013696 | increased granulocyte monocyte progenitor cell number | increase in the number of a hematopoietic progenitor cell that is committed to the granulocyte and monocyte lineages; these cells are CD123-positive, and do not express Gata1 or Gata2 but do express C/EBPa, and Pu.1 |
| HP:0006753 | Neoplasm of the stomach | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| Disease ID | 303 |
|---|---|
| Disease | muir-torre syndrome |
| Case | (Waiting for update.) |