| mucolipidosis iv | ||||
| Disease ID | 638 |
|---|---|
| Disease | mucolipidosis iv |
| Definition | An autosomal recessive lysosomal storage disease caused by mutations in the MCOLN1 gene. It is characterized by psychomotor developmental delays and ophthalmologic abnormalities. |
| Synonym | defic dis ganglioside sialidase deficiency disease, ganglioside sialidase ganglioside sialidase defic dis ganglioside sialidase deficiency ganglioside sialidase deficiency (disorder) ganglioside sialidase deficiency disease ml iv ml4 mucolipidoses, type iv mucolipidosis type iv mucolipidosis, type iv sialolipidoses sialolipidosis type iv mucolipidoses type iv mucolipidosis |
| Orphanet | |
| OMIM | |
| DOID | |
| ICD10 | |
| UMLS | C0238286 |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:1) |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Text Mined Gene | (Waiting for update.) |
| Locus | (Waiting for update.) |
| Disease ID | 638 |
|---|---|
| Disease | mucolipidosis iv |
| Integrated Phenotype | (Waiting for update.) |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:1) |
| Disease ID | 638 |
|---|---|
| Disease | mucolipidosis iv |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:1) C2598155 | pain |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Manually Genotypes:3) | |||
|---|---|---|---|
| Gene | Mutation | DOI | Article Title |
| MCOLN1 | IVS3-2A>G, c.511_6944del | doi:10.1038/gim.2016.30 | Carrier screening in the era of expanding genetic technology |
| MCOLN1 | c.406-2A>G47 | doi:10.1038/gim.2015.123 | Expanded genetic screening panel for the Ashkenazi Jewish population |
| MCOLN1 | g.511_6943del | doi:10.1038/gim.2015.123 | Expanded genetic screening panel for the Ashkenazi Jewish population |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:25) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs104886461 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1;LOC105372261 | 19 | 7526759 | A | G |
| rs121908371 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1 | 19 | 7528683 | C | T |
| rs121908372 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1 | 19 | 7528920 | G | T |
| rs121908373 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1;LOC105372261 | 19 | 7526505 | C | T |
| rs121908374 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1 | 19 | 7529173 | C | T |
| rs751298168 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | PNPLA6;MCOLN1 | 19 | 7533651 | A | C,T |
| rs754097561 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1 | 19 | 7529689 | G | A |
| rs755042147 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1 | 19 | 7528639 | T | - |
| rs767122713 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1 | 19 | 7527877 | A | C |
| rs797044817 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1 | 19 | 7529187 | CTT | - |
| rs797044818 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1 | 19 | 7530332 | A | G |
| rs797044819 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | PNPLA6;MCOLN1 | 19 | 7533562 | G | - |
| rs797044820 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1;LOC105372261 | 19 | 7525092 | AAGTTTCGAGCCAAGGGCCGCAAGCCCTGCAAGCT | TCA |
| rs797044821 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1;LOC105372261 | 19 | 7526828 | CC | - |
| rs797044822 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1 | 19 | 7529176 | - | T |
| rs797044823 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1 | 19 | 7530389 | - | GGCCGCAGCAG |
| rs797044824 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1;LOC105372261 | 19 | 7526869 | C | T |
| rs797044825 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1;LOC105372261 | 19 | 7526518 | T | C |
| rs797044826 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1;LOC105372261 | 19 | 7526852 | G | T |
| rs797044827 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1 | 19 | 7529693 | T | C |
| rs797044828 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1 | 19 | 7530321 | C | G |
| rs797044829 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1 | 19 | 7530314 | G | A |
| rs797044830 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1;LOC105372261 | 19 | 7526503 | TC | - |
| rs797044831 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | PNPLA6;MCOLN1 | 19 | 7533561 | G | - |
| rs797044832 | NA | 57192 | MCOLN1 | umls:C0238286 | CLINVAR | NA | 0.452681823 | NA | MCOLN1;LOC105372261 | 19 | 7525164 | C | T |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:0) |
|---|
| (Waiting for update.) |
Mapped by homologous gene(Total Items:0) |
|---|
| (Waiting for update.) |
| Disease ID | 638 |
|---|---|
| Disease | mucolipidosis iv |
| Case | (Waiting for update.) |