eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine

HOME
QUERY
- DISEASE
- GENOTYPE
NETWORK
- PHENOTYPE
- GENE
- COMMON
- DISEASE PAIR
DOWNLOAD
SUBMIT CASE
HELP&FAQ
- HELP&FAQ
- CONTACT US


	menkes disease

Disease ID	156
Disease	menkes disease
Definition	X-linked recessive abnormality in copper absorption marked by severe cerebral degeneration and arterial changes resulting in death in infancy and by sparse, brittle scalp hair.
Synonym	congen hypocupremia congenital hypocupraemia congenital hypocupremia congenital hypocupremias copper transport disease disease, steely hair diseases, kinky hair diseases, menkes' diseases, steely hair hair diseases, kinky hair diseases, steely hypocupremia congen hypocupremia, congenital hypocupremias, congenital kinky hair dis kinky hair disease kinky hair diseases kinky hair syndrome menke disease menke syndrome menke's kinky hair syndrome menkea syndrome menkea syndromes menkes dis menkes kinky hair syndrome menkes kinky hair syndrome [disease/finding] menkes kinky-hair syndrome menkes kinky-hair syndrome (disorder) menkes syndrome menkes' disease menkes' diseases menkes' kinky hair syndrome menkes' syndrome mk mk - menkes syndrome mnk mnk - menkes syndrome steely hair dis steely hair disease steely hair diseases steely hair syndrome steely hair syndromes steely-hair syndrome syndrome, menkea syndrome, steely hair syndromes, menkea syndromes, steely hair trichopoliodystrophy x-linked copper deficiency
Orphanet	ORPHANET:565
OMIM	OMIM:309400
DOID	DOID:1838
UMLS	C0022716
MeSH	D007706
SNOMED-CT	SNOMEDCT_US_2016_09_01:59178007
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:10) C0014544 \| epilepsy \| 3 C0156273 \| bladder diverticula \| 2 C0017168 \| esophageal reflux disease \| 1 C0014544 \| epilepsia \| 1 C0017168 \| oesophageal reflux \| 1 C0017168 \| gastroesophageal reflux \| 1 C0017168 \| gastroesophageal reflux disease \| 1 C0085543 \| epilepsia partialis continua \| 1 C0017168 \| esophageal reflux \| 1 C0025362 \| mental retardation \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:2) 1356 \| CP \| CTD_human 538 \| ATP7A \| CLINVAR;CTD_human;GHR;UNIPROT;ORPHANET
Inferring Gene	(Waiting for update.)
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:49) 60 \| ACTB \| 1.948 \| DISEASES 5832 \| ALDH18A1 \| 2.254 \| DISEASES 1174 \| AP1S1 \| 3.594 \| DISEASES 1176 \| AP3S1 \| 3.291 \| DISEASES 9181 \| ARHGEF2 \| 2.334 \| DISEASES 23400 \| ATP13A2 \| 1.367 \| DISEASES 477 \| ATP1A2 \| 1.369 \| DISEASES 487 \| ATP2A1 \| 1.872 \| DISEASES 23545 \| ATP6V0A2 \| 1.536 \| DISEASES 538 \| ATP7A \| 8.039 \| DISEASES 546 \| ATRX \| 1.093 \| DISEASES 9973 \| CCS \| 3.802 \| DISEASES 1314 \| COPA \| 3.08 \| DISEASES 90639 \| COX19 \| 3.598 \| DISEASES 1621 \| DBH \| 3.519 \| DISEASES 84062 \| DTNBP1 \| 1.237 \| DISEASES 1892 \| ECHS1 \| 2.048 \| DISEASES 2060 \| EPS15 \| 2.937 \| DISEASES 92344 \| GORAB \| 2.498 \| DISEASES 54617 \| INO80 \| 2.508 \| DISEASES 22944 \| KIN \| 2.241 \| DISEASES 8569 \| MKNK1 \| 2.139 \| DISEASES 22921 \| MSRB2 \| 2.522 \| DISEASES 4566 \| MT-TK \| 2.175 \| DISEASES 4644 \| MYO5A \| 2.396 \| DISEASES 5053 \| PAH \| 1.061 \| DISEASES 57526 \| PCDH19 \| 1.873 \| DISEASES 5223 \| PGAM1 \| 1.961 \| DISEASES 441531 \| PGAM4 \| 3.534 \| DISEASES 5230 \| PGK1 \| 4.213 \| DISEASES 5831 \| PYCR1 \| 2.525 \| DISEASES 5873 \| RAB27A \| 1.494 \| DISEASES 6005 \| RHAG \| 2.716 \| DISEASES 6181 \| RPLP2 \| 1.958 \| DISEASES 6303 \| SAT1 \| 1.198 \| DISEASES 6334 \| SCN8A \| 1.459 \| DISEASES 8036 \| SHOC2 \| 1.918 \| DISEASES 1317 \| SLC31A1 \| 2.067 \| DISEASES 9197 \| SLC33A1 \| 2.513 \| DISEASES 10479 \| SLC9A6 \| 2.012 \| DISEASES 84679 \| SLC9A7 \| 2.265 \| DISEASES 114798 \| SLITRK1 \| 1.154 \| DISEASES 81609 \| SNX27 \| 2.705 \| DISEASES 25803 \| SPDEF \| 1.524 \| DISEASES 6812 \| STXBP1 \| 1.61 \| DISEASES 6888 \| TALDO1 \| 1.686 \| DISEASES 10618 \| TGOLN2 \| 2.606 \| DISEASES 7415 \| VCP \| 1.578 \| DISEASES 7503 \| XIST \| 2.466 \| DISEASES
Locus	Symbol \| Locus(Total Locus:1) ATP7A \| Xq21.1

Disease ID	156
Disease	menkes disease
Integrated Phenotype	HPO \| Name(Total Integrated Phenotypes:69) HP:0002239 \| Gastrointestinal hemorrhage HP:0006487 \| Bowing of the long bones HP:0012378 \| Fatigue HP:0000248 \| Brachycephaly HP:0002376 \| Developmental regression HP:0002072 \| Chorea HP:0002645 \| Wormian bones HP:0002224 \| Woolly hair HP:0100806 \| Sepsis HP:0000767 \| Pectus excavatum HP:0000974 \| Hyperextensible skin HP:0100545 \| Arterial stenosis HP:0000987 \| Atypical scarring of skin HP:0001257 \| Spasticity HP:0000973 \| Dermatomegaly HP:0004322 \| Stature below 3rd percentile HP:0000347 \| Micrognathia HP:0008368 \| Tarsal synostosis HP:0001537 \| Umbilical hernia HP:0005692 \| Joint hyperflexibility HP:0000934 \| Chondrocalcinosis HP:0001943 \| Hypoglycemia HP:0001010 \| Hypopigmentation of the skin HP:0000015 \| Bladder diverticulum HP:0000774 \| Narrow chest HP:0001511 \| Intrauterine growth retardation HP:0002017 \| Nausea and vomiting HP:0010318 \| Aplasia/Hypoplasia of the abdominal wall musculature HP:0002617 \| Aneurysm HP:0001276 \| Hypertonia HP:0001249 \| Mental retardation HP:0002024 \| Malabsorption HP:0006579 \| Prolonged neonatal jaundice HP:0008872 \| Feeding difficulties in infancy HP:0001250 \| Seizures HP:0000708 \| Behavioral abnormality HP:0003016 \| Wide metaphyses HP:0000252 \| Small head circumference HP:0002754 \| Osteomyelitis HP:0000298 \| Mask-like facies HP:0007420 \| Spontaneous hematomas HP:0005599 \| Hypopigmentation of hair HP:0001388 \| Joint laxity HP:0000252 \| Microcephaly HP:0000293 \| Full cheeks HP:0002757 \| Recurrent fractures HP:0000939 \| Osteoporosis HP:0005293 \| Venous insufficiency HP:0008070 \| Sparse hair HP:0000023 \| Inguinal hernia HP:0001511 \| Prenatal onset growth retardation HP:0001249 \| Intellectual disability HP:0005054 \| Metaphyseal spurs HP:0008070 \| Thinned hair HP:0002045 \| Hypothermia HP:0002045 \| Abnormally low body temperature HP:0000269 \| Prominent occiput HP:0000958 \| Dry skin HP:0001324 \| Muscle weakness HP:0002645 \| Extra bones within cranial sutures HP:0005344 \| Abnormality of the carotid arteries HP:0100777 \| Exostoses HP:0001072 \| Thickened skin HP:0100790 \| Hernia HP:0000174 \| Abnormality of the palate HP:0001252 \| Muscular hypotonia HP:0002170 \| Intracranial hemorrhage HP:0000944 \| Abnormality of the metaphyses HP:0000271 \| Abnormal face
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:4) HP:0000015 \| Bladder diverticula \| 2 HP:0002020 \| Heartburn \| 1 HP:0012847 \| Epilepsia partialis continua \| 1 HP:0001249 \| Mental retardation \| 1

Disease ID	156
Disease	menkes disease
Manually Symptom	UMLS \| Name(Total Manually Symptoms:11) C1302787 \| internal jugular phlebectasia C0730292 \| macular dystrophy C0268070 \| copper deficiency C0262405 \| brain dysfunction C0236048 \| gastric polyps C0235946 \| cortical atrophy C0156273 \| bladder diverticula C0154671 \| brain degeneration C0025517 \| metabolic disorder C0014544 \| epilepsy C0002940 \| aneurysms
Text Mined Symptom	UMLS \| Name \| Sentences' Count(Total Symptoms:2) C0014544 \| epilepsy \| 3 C0156273 \| bladder diverticula \| 1

Manually Genotype(Total Manually Genotypes:1)
Gene	Mutation	DOI	Article Title
ATP7A	-	doi:10.1038/gim.2015.51	Clinical performance of the CytoScan Dx Assay in diagnosing developmental delay/intellectual disability

Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:86)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs138958687	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78021066	A	G
rs151340631	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78011216	C	G,T
rs151340632	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78042694	A	G
rs151340633	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	77988722	C	T
rs72554636	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	77989847	C	T
rs72554639	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78011191	G	C
rs72554639	20714486	538	ATP7A	umls:C0022716	BeFree	A numerical investigation into possible mechanisms by that the A629P mutant of ATP7A causes Menkes Disease.	0.606244433	2010	ATP7A	X	78011191	G	C
rs72554640	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78011239	C	T
rs72554643	11043517	538	ATP7A	umls:C0022716	BeFree	Novel mutation of L718X in the ATP7A gene in a Japanese patient with classical Menkes disease, and four novel polymorphisms in the Japanese population.	0.606244433	2000	ATP7A	X	78011655	T	A
rs72554644	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78012885	G	A,T
rs72554645	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78013089	C	T
rs72554649	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78029271	C	T
rs72554650	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78029289	C	T
rs72554652	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78029389	G	A
rs72554652	12221109	538	ATP7A	umls:C0022716	BeFree	In this study, a Menkes disease mutation, G1019D, located in the large cytoplasmic loop of MNK, was characterized in transfected cultured cells.	0.606244433	2002	ATP7A	X	78029389	G	A
rs794729231	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78011448	G	A
rs797045325	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	77989628	G	T
rs797045327	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	77989646	-	GGGGC
rs797045329	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	77998496	T	-
rs797045330	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	77998601	C	A
rs797045331	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78003072	G	A
rs797045332	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78003168	C	T
rs797045333	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78003196	TA	-
rs797045336	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78009176	C	G
rs797045337	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78009225	G	T
rs797045338	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78011175	G	C
rs797045339	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78011180	T	G
rs797045340	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78011253	G	C
rs797045341	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78011257	G	A
rs797045342	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78011452	G	A
rs797045343	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78011510	-	TTCTGTATTCCTGTAATGGGGCTGATGATAT
rs797045344	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78011498	G	A,C
rs797045346	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78011662	T	A
rs797045347	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78011679	G	C
rs797045348	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78011674	G	T
rs797045349	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78012877	A	G
rs797045350	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78012889	G	A
rs797045351	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78012893	G	A
rs797045352	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78012957	-	ATTG
rs797045353	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78013008	G	-
rs797045354	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78013063	T	G
rs797045355	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78013101	CATATAGCAAA	AGCATC
rs797045356	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78013111	AGG	T
rs797045357	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78014755	T	A
rs797045358	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78015759	-	GTGAAGA
rs797045359	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78015753	G	A
rs797045360	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78015810	C	T
rs797045361	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78020262	-	C
rs797045362	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78020367	T	A
rs797045363	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78020398	G	C
rs797045364	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78021082	AAGT	-
rs797045365	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78029335	C	T
rs797045366	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78029401	GCATACTAATAAAAG	-
rs797045367	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78031399	G	A
rs797045368	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78031412	G	-
rs797045369	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78031415	TTTGA	AGTACAGG
rs797045370	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78031420	T	G
rs797045371	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78031440	ACGGA	NNNN
rs797045372	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78031573	T	G
rs797045373	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78031576	C	A
rs797045374	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78031583	G	T
rs797045375	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78033650	G	-
rs797045376	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78033662	G	T
rs797045377	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78033689	G	T
rs797045378	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78033776	C	T
rs797045379	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78033812	C	T
rs797045380	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78038861	A	-
rs797045382	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78040696	G	A
rs797045383	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78040706	T	ATGACTGG
rs797045384	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78040707	AA	TTAC
rs797045385	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78040732	A	T
rs797045386	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78040734	G	T
rs797045387	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78040737	A	G
rs797045388	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78042703	C	G
rs797045389	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78042703	C	-
rs797045390	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78042726	G	A
rs797045391	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78042789	G	T
rs797045392	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78043325	TCT	-
rs797045393	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78043435	G	A
rs797045394	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78043434	G	A
rs797045395	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78045478	-	A
rs797045396	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78045533	C	T
rs797045397	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	77988542	GA	-
rs797045398	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	78045577	G	A
rs797045399	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	77988719	C	T
rs797045400	NA	538	ATP7A	umls:C0022716	CLINVAR	NA	0.606244433	NA	ATP7A	X	77989498	G	-

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:28)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0001072	Thickened skin	MP:0009932	skin fibrosis	invasion of fibrous connective tissue into the skin, often resulting from inflammation or injury
HP:0008872	Feeding difficulties in infancy	MP:0011075	abnormal macrophage activation involved in immune response	anomaly in the process in which a change in response and behavior of a macrophage results from exposure to a cytokine, chemokine, cellular ligand, or soluble factor, leading to the initiation or perpetuation of an immune response
HP:0002645	Wormian bones	MP:0008915	fused carpal bones	anomaly of the nine nodular bones of the joint between the forelimb bones and the front paws/hands resulting in some or all the bones being joined together
HP:0000774	Narrow chest	MP:0004134	abnormal chest morphology	any structural anomaly of the part of the body between the neck and the abdomen
HP:0008070	Sparse hair	MP:0010202	focal dorsal hair loss	focal hair loss on the dorsal area of a rodent resulting in dorsal skin visible in a patch where hair loss occurs
HP:0000974	Hyperextensible skin	MP:0010678	abnormal skin adnexa morphology	any structural anomaly of the tissue or structures associated with or embedded in the skin such as hair and hair follicles, sweat glands, sebaceous glands and claws or nails
HP:0006487	Bowing of the long bones	MP:0013621	decreased internal diameter of femur	reduced cross-sectional distance that extends from one lateral edge of the femur long bone marrow cavity, through its center and to the opposite lateral edge of the bone marrow cavity through the mid point of the femur
HP:0000174	Abnormality of the palate	MP:0010701	fusion of atlas and odontoid process	the large protuberance that projects upward from the cervical axis (C2), around which the cervical atlas normally rotates, is instead fused to elements of the atlas; the odontoid process may or may not remain attached to the axis
HP:0002170	Intracranial hemorrhage	MP:0006203	eye hemorrhage	bleeding into the eye
HP:0000023	Inguinal hernia	MP:0010146	umbilical hernia	an outward bulging (protrusion) of the abdominal lining or part of the abdominal organ(s) through the area around the umbilicus; occurs when the muscle through which blood vessels pass to feed the developing fetus fails to completely close
HP:0001324	Muscle weakness	MP:0000746	weakness	state of being infirm or less strong than normal
HP:0001252	Muscular hypotonia	MP:0004144	hypotonia	decreased muscle tension resulting in limpness of the muscles in the resting state, not to be confused with weakness
HP:0001537	Umbilical hernia	MP:0010146	umbilical hernia	an outward bulging (protrusion) of the abdominal lining or part of the abdominal organ(s) through the area around the umbilicus; occurs when the muscle through which blood vessels pass to feed the developing fetus fails to completely close
HP:0000958	Dry skin	MP:0010678	abnormal skin adnexa morphology	any structural anomaly of the tissue or structures associated with or embedded in the skin such as hair and hair follicles, sweat glands, sebaceous glands and claws or nails
HP:0002757	Recurrent fractures	MP:0004675	rib fractures	a crack or break in the bones forming the bony wall of the chest
HP:0000987	Atypical scarring of skin	MP:0011205	excessive folding of visceral yolk sac	the appearance of wrinkles or folds on the surface of the visceral yolk sac
HP:0002239	Gastrointestinal hemorrhage	MP:0012305	umbilical cord hemorrhage	bleeding into or from the umbilical cord
HP:0001010	Hypopigmentation of the skin	MP:0010178	increased number of Howell-Jolly bodies	abnormal presence of basophilic nuclear remnants of condensed DNA (1 to 2 um in diameter) in circulating erythrocytes, typically seen in severe hemolytic anemias or after splenectomy; these inclusions are normally removed by the spleen but will persist in
HP:0002224	Woolly hair	MP:0010685	abnormal hair follicle inner root sheath morphology	any structural anomaly of the multilayered tube composed of terminally differentiated hair follicle keratinocytes that is surrounded by the outer root sheath; the layers of the inner root sheath include the companion layer, Henle's layer, Huxley's layer a
HP:0005599	Hypopigmentation of hair	MP:0009657	failure of chorioallantoic fusion	failure to initiate and/or complete the formation of a highly vascularized extra-embryonic fetal membrane by fusion of the chorion and allantois
HP:0006579	Prolonged neonatal jaundice	MP:0011087	neonatal lethality, complete penetrance	death of all organisms of a given genotype in a population within the neonatal period after birth (Mus: P0)
HP:0002017	Nausea and vomiting	MP:0010426	abnormal heart and great artery attachment	any anomaly in the in the position or pattern of the connection site of the heart to any of the great arteries, including the pulmonary artery and aorta
HP:0001511	Intrauterine growth retardation	MP:0011109	lethality throughout fetal growth and development, incomplete penetrance	the appearance of lower than Mendelian ratios of organisms of a given genotype due to death of some, but not all of the organisms between the completion of organogenesis and birth (Mus: E14 to approximately E18.5)
HP:0100545	Arterial stenosis	MP:0010641	descending aorta stenosis	diffuse constriction or narrowing of the descending aorta
HP:0000944	Abnormality of the metaphyses	MP:0013621	decreased internal diameter of femur	reduced cross-sectional distance that extends from one lateral edge of the femur long bone marrow cavity, through its center and to the opposite lateral edge of the bone marrow cavity through the mid point of the femur
HP:0008368	Tarsal synostosis	MP:0000566	synostosis	osseous union of two bones that are not normally connected
HP:0010318	Aplasia/Hypoplasia of the abdominal wall musculature	MP:0020010	decreased bone mineral density of femur	reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh
HP:0000271	Abnormality of the face	MP:0009889	persistence of medial edge epithelium during palatal shelf fusion	palatal shelves meet at the midline during development but do not adhere along the medial edge epithelia, and fail to form the midline epithelial seam

Mapped by homologous gene(Total Items:63)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0001252	Muscular hypotonia	MP:3000003	abnormal Ebner's gland morphology	any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0002754	Osteomyelitis	MP:0020080	increased bone mineralization	increase in the rate at which minerals are deposited into bone
HP:0002645	Wormian bones	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0005599	Hypopigmentation of hair	MP:0014178	increased brain apoptosis	increase in the number of cells of the brain undergoing programmed cell death
HP:0000987	Atypical scarring of skin	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0000774	Narrow chest	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0001250	Seizures	MP:3000003	abnormal Ebner's gland morphology	any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000708	Behavioral abnormality	MP:0020316	decreased vascular endothelial cell proliferation	decrease in the expansion rate of any vascular endothelial cell population by cell division
HP:0005054	Metaphyseal spurs	MP:0014178	increased brain apoptosis	increase in the number of cells of the brain undergoing programmed cell death
HP:0007420	Spontaneous hematomas	MP:0013693	abnormal hemopoiesis	any anomaly in the process whose specific outcome is the progression of the myeloid and lymphoid derived organ/tissue systems of the blood and other parts of the body over time, from formation to the mature structure; the site of hemopoiesis is variable d
HP:0002224	Woolly hair	MP:0014178	increased brain apoptosis	increase in the number of cells of the brain undergoing programmed cell death
HP:0001072	Thickened skin	MP:0020329	decreased capillary density	reduction in the number of capillaries in a given cross-sectional area of a tissue
HP:0100545	Arterial stenosis	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0000174	Abnormality of the palate	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0004322	Short stature	MP:3000003	abnormal Ebner's gland morphology	any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000347	Micrognathia	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0002024	Malabsorption	MP:0020220	decreased tear production	decreased production of the amount of fluid produced in the eye
HP:0005293	Venous insufficiency	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0000269	Prominent occiput	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0000271	Abnormality of the face	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0001257	Spasticity	MP:0020316	decreased vascular endothelial cell proliferation	decrease in the expansion rate of any vascular endothelial cell population by cell division
HP:0001511	Intrauterine growth retardation	MP:0020329	decreased capillary density	reduction in the number of capillaries in a given cross-sectional area of a tissue
HP:0000298	Mask-like facies	MP:0020329	decreased capillary density	reduction in the number of capillaries in a given cross-sectional area of a tissue
HP:0000248	Brachycephaly	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0000939	Osteoporosis	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0002239	Gastrointestinal hemorrhage	MP:0020215	impaired blood coagulation	impaired ability of the blood to clot
HP:0000934	Chondrocalcinosis	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0000973	Cutis laxa	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0002017	Nausea and vomiting	MP:0020220	decreased tear production	decreased production of the amount of fluid produced in the eye
HP:0006487	Bowing of the long bones	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0001324	Muscle weakness	MP:0020309	increased creatine kinase activity	increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+).
HP:0012378	Fatigue	MP:0013659	abnormal erythroid lineage cell morphology	any structural anomaly of an immature or mature cell in the lineage leading to and including erythrocytes
HP:0002617	Aneurysm	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0002757	Recurrent fractures	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0100806	Sepsis	MP:0011708	decreased fibroblast cell migration	reduced frequency of or less rapid fibroblast cell migration that is accomplished by extension and retraction of a fibroblast pseudopodium
HP:0000767	Pectus excavatum	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0001388	Joint laxity	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0001943	Hypoglycemia	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0001276	Hypertonia	MP:0020316	decreased vascular endothelial cell proliferation	decrease in the expansion rate of any vascular endothelial cell population by cell division
HP:0002045	Hypothermia	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0001249	Intellectual disability	MP:0020316	decreased vascular endothelial cell proliferation	decrease in the expansion rate of any vascular endothelial cell population by cell division
HP:0002376	Developmental regression	MP:0020214	susceptible to malignant hyperthermia	increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine
HP:0005344	Abnormality of the carotid arteries	MP:0014178	increased brain apoptosis	increase in the number of cells of the brain undergoing programmed cell death
HP:0008368	Tarsal synostosis	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0008872	Feeding difficulties in infancy	MP:0020214	susceptible to malignant hyperthermia	increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine
HP:0100790	Hernia	MP:0014185	cerebellum atrophy	acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal
HP:0010318	Aplasia/Hypoplasia of the abdominal wall musculature	MP:0020169	increased thyroid gland weight	higher than average weight of the thyroid gland
HP:0006579	Prolonged neonatal jaundice	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0001537	Umbilical hernia	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0000015	Bladder diverticulum	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0002072	Chorea	MP:0020329	decreased capillary density	reduction in the number of capillaries in a given cross-sectional area of a tissue
HP:0008070	Sparse hair	MP:0014179	abnormal blood-retinal barrier function	anomaly in the function of the part of the blood-ocular barrier that consists of cells that are joined tightly together to prevent certain substances from entering the tissue of the retina; the BRB consists of non-fenestrated capillaries of the retinal ci
HP:0000023	Inguinal hernia	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0000958	Dry skin	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0005692	Joint hyperflexibility	MP:0012125	decreased bronchoconstrictive response	reduction in the expected bronchoconstrictive response to provocation challenge with lipopolysaccharide, bradykinin, histamine or other antigen/allergen or agent, often measured by plethysmography
HP:0100777	Exostoses	MP:0014178	increased brain apoptosis	increase in the number of cells of the brain undergoing programmed cell death
HP:0002170	Intracranial hemorrhage	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0000974	Hyperextensible skin	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0000293	Full cheeks	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0000252	Microcephaly	MP:3000003	abnormal Ebner's gland morphology	any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000944	Abnormality of the metaphyses	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0003016	Metaphyseal widening	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0001010	Hypopigmentation of the skin	MP:0020039	increased bone ossification	increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance

Disease ID	156
Disease	menkes disease
Case	(Waiting for update.)