| menkes disease | ||||
| Disease ID | 156 |
|---|---|
| Disease | menkes disease |
| Definition | X-linked recessive abnormality in copper absorption marked by severe cerebral degeneration and arterial changes resulting in death in infancy and by sparse, brittle scalp hair. |
| Synonym | congen hypocupremia congenital hypocupraemia congenital hypocupremia congenital hypocupremias copper transport disease disease, steely hair diseases, kinky hair diseases, menkes' diseases, steely hair hair diseases, kinky hair diseases, steely hypocupremia congen hypocupremia, congenital hypocupremias, congenital kinky hair dis kinky hair disease kinky hair diseases kinky hair syndrome menke disease menke syndrome menke's kinky hair syndrome menkea syndrome menkea syndromes menkes dis menkes kinky hair syndrome menkes kinky hair syndrome [disease/finding] menkes kinky-hair syndrome menkes kinky-hair syndrome (disorder) menkes syndrome menkes' disease menkes' diseases menkes' kinky hair syndrome menkes' syndrome mk mk - menkes syndrome mnk mnk - menkes syndrome steely hair dis steely hair disease steely hair diseases steely hair syndrome steely hair syndromes steely-hair syndrome syndrome, menkea syndrome, steely hair syndromes, menkea syndromes, steely hair trichopoliodystrophy x-linked copper deficiency |
| Orphanet | |
| OMIM | |
| DOID | |
| UMLS | C0022716 |
| MeSH | |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:10) C0014544 | epilepsy | 3 C0156273 | bladder diverticula | 2 C0017168 | esophageal reflux disease | 1 C0014544 | epilepsia | 1 C0017168 | oesophageal reflux | 1 C0017168 | gastroesophageal reflux | 1 C0017168 | gastroesophageal reflux disease | 1 C0085543 | epilepsia partialis continua | 1 C0017168 | esophageal reflux | 1 C0025362 | mental retardation | 1 |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:2) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:49) 60 | ACTB | 1.948 | DISEASES 5832 | ALDH18A1 | 2.254 | DISEASES 1174 | AP1S1 | 3.594 | DISEASES 1176 | AP3S1 | 3.291 | DISEASES 9181 | ARHGEF2 | 2.334 | DISEASES 23400 | ATP13A2 | 1.367 | DISEASES 477 | ATP1A2 | 1.369 | DISEASES 487 | ATP2A1 | 1.872 | DISEASES 23545 | ATP6V0A2 | 1.536 | DISEASES 538 | ATP7A | 8.039 | DISEASES 546 | ATRX | 1.093 | DISEASES 9973 | CCS | 3.802 | DISEASES 1314 | COPA | 3.08 | DISEASES 90639 | COX19 | 3.598 | DISEASES 1621 | DBH | 3.519 | DISEASES 84062 | DTNBP1 | 1.237 | DISEASES 1892 | ECHS1 | 2.048 | DISEASES 2060 | EPS15 | 2.937 | DISEASES 92344 | GORAB | 2.498 | DISEASES 54617 | INO80 | 2.508 | DISEASES 22944 | KIN | 2.241 | DISEASES 8569 | MKNK1 | 2.139 | DISEASES 22921 | MSRB2 | 2.522 | DISEASES 4566 | MT-TK | 2.175 | DISEASES 4644 | MYO5A | 2.396 | DISEASES 5053 | PAH | 1.061 | DISEASES 57526 | PCDH19 | 1.873 | DISEASES 5223 | PGAM1 | 1.961 | DISEASES 441531 | PGAM4 | 3.534 | DISEASES 5230 | PGK1 | 4.213 | DISEASES 5831 | PYCR1 | 2.525 | DISEASES 5873 | RAB27A | 1.494 | DISEASES 6005 | RHAG | 2.716 | DISEASES 6181 | RPLP2 | 1.958 | DISEASES 6303 | SAT1 | 1.198 | DISEASES 6334 | SCN8A | 1.459 | DISEASES 8036 | SHOC2 | 1.918 | DISEASES 1317 | SLC31A1 | 2.067 | DISEASES 9197 | SLC33A1 | 2.513 | DISEASES 10479 | SLC9A6 | 2.012 | DISEASES 84679 | SLC9A7 | 2.265 | DISEASES 114798 | SLITRK1 | 1.154 | DISEASES 81609 | SNX27 | 2.705 | DISEASES 25803 | SPDEF | 1.524 | DISEASES 6812 | STXBP1 | 1.61 | DISEASES 6888 | TALDO1 | 1.686 | DISEASES 10618 | TGOLN2 | 2.606 | DISEASES 7415 | VCP | 1.578 | DISEASES 7503 | XIST | 2.466 | DISEASES |
| Locus | Symbol | Locus(Total Locus:1) ATP7A | Xq21.1 |
| Disease ID | 156 |
|---|---|
| Disease | menkes disease |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:69) HP:0002239 | Gastrointestinal hemorrhage HP:0006487 | Bowing of the long bones HP:0012378 | Fatigue HP:0000248 | Brachycephaly HP:0002376 | Developmental regression HP:0002072 | Chorea HP:0002645 | Wormian bones HP:0002224 | Woolly hair HP:0100806 | Sepsis HP:0000767 | Pectus excavatum HP:0000974 | Hyperextensible skin HP:0100545 | Arterial stenosis HP:0000987 | Atypical scarring of skin HP:0001257 | Spasticity HP:0000973 | Dermatomegaly HP:0004322 | Stature below 3rd percentile HP:0000347 | Micrognathia HP:0008368 | Tarsal synostosis HP:0001537 | Umbilical hernia HP:0005692 | Joint hyperflexibility HP:0000934 | Chondrocalcinosis HP:0001943 | Hypoglycemia HP:0001010 | Hypopigmentation of the skin HP:0000015 | Bladder diverticulum HP:0000774 | Narrow chest HP:0001511 | Intrauterine growth retardation HP:0002017 | Nausea and vomiting HP:0010318 | Aplasia/Hypoplasia of the abdominal wall musculature HP:0002617 | Aneurysm HP:0001276 | Hypertonia HP:0001249 | Mental retardation HP:0002024 | Malabsorption HP:0006579 | Prolonged neonatal jaundice HP:0008872 | Feeding difficulties in infancy HP:0001250 | Seizures HP:0000708 | Behavioral abnormality HP:0003016 | Wide metaphyses HP:0000252 | Small head circumference HP:0002754 | Osteomyelitis HP:0000298 | Mask-like facies HP:0007420 | Spontaneous hematomas HP:0005599 | Hypopigmentation of hair HP:0001388 | Joint laxity HP:0000252 | Microcephaly HP:0000293 | Full cheeks HP:0002757 | Recurrent fractures HP:0000939 | Osteoporosis HP:0005293 | Venous insufficiency HP:0008070 | Sparse hair HP:0000023 | Inguinal hernia HP:0001511 | Prenatal onset growth retardation HP:0001249 | Intellectual disability HP:0005054 | Metaphyseal spurs HP:0008070 | Thinned hair HP:0002045 | Hypothermia HP:0002045 | Abnormally low body temperature HP:0000269 | Prominent occiput HP:0000958 | Dry skin HP:0001324 | Muscle weakness HP:0002645 | Extra bones within cranial sutures HP:0005344 | Abnormality of the carotid arteries HP:0100777 | Exostoses HP:0001072 | Thickened skin HP:0100790 | Hernia HP:0000174 | Abnormality of the palate HP:0001252 | Muscular hypotonia HP:0002170 | Intracranial hemorrhage HP:0000944 | Abnormality of the metaphyses HP:0000271 | Abnormal face |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:4) |
| Disease ID | 156 |
|---|---|
| Disease | menkes disease |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:11) C1302787 | internal jugular phlebectasia C0730292 | macular dystrophy C0268070 | copper deficiency C0262405 | brain dysfunction C0236048 | gastric polyps C0235946 | cortical atrophy C0156273 | bladder diverticula C0154671 | brain degeneration C0025517 | metabolic disorder C0014544 | epilepsy C0002940 | aneurysms |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:2) |
Manually Genotype(Total Manually Genotypes:1) | |||
|---|---|---|---|
| Gene | Mutation | DOI | Article Title |
| ATP7A | - | doi:10.1038/gim.2015.51 | Clinical performance of the CytoScan Dx Assay in diagnosing developmental delay/intellectual disability |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:86) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs138958687 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78021066 | A | G |
| rs151340631 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78011216 | C | G,T |
| rs151340632 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78042694 | A | G |
| rs151340633 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 77988722 | C | T |
| rs72554636 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 77989847 | C | T |
| rs72554639 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78011191 | G | C |
| rs72554639 | 20714486 | 538 | ATP7A | umls:C0022716 | BeFree | A numerical investigation into possible mechanisms by that the A629P mutant of ATP7A causes Menkes Disease. | 0.606244433 | 2010 | ATP7A | X | 78011191 | G | C |
| rs72554640 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78011239 | C | T |
| rs72554643 | 11043517 | 538 | ATP7A | umls:C0022716 | BeFree | Novel mutation of L718X in the ATP7A gene in a Japanese patient with classical Menkes disease, and four novel polymorphisms in the Japanese population. | 0.606244433 | 2000 | ATP7A | X | 78011655 | T | A |
| rs72554644 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78012885 | G | A,T |
| rs72554645 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78013089 | C | T |
| rs72554649 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78029271 | C | T |
| rs72554650 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78029289 | C | T |
| rs72554652 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78029389 | G | A |
| rs72554652 | 12221109 | 538 | ATP7A | umls:C0022716 | BeFree | In this study, a Menkes disease mutation, G1019D, located in the large cytoplasmic loop of MNK, was characterized in transfected cultured cells. | 0.606244433 | 2002 | ATP7A | X | 78029389 | G | A |
| rs794729231 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78011448 | G | A |
| rs797045325 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 77989628 | G | T |
| rs797045327 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 77989646 | - | GGGGC |
| rs797045329 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 77998496 | T | - |
| rs797045330 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 77998601 | C | A |
| rs797045331 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78003072 | G | A |
| rs797045332 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78003168 | C | T |
| rs797045333 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78003196 | TA | - |
| rs797045336 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78009176 | C | G |
| rs797045337 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78009225 | G | T |
| rs797045338 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78011175 | G | C |
| rs797045339 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78011180 | T | G |
| rs797045340 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78011253 | G | C |
| rs797045341 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78011257 | G | A |
| rs797045342 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78011452 | G | A |
| rs797045343 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78011510 | - | TTCTGTATTCCTGTAATGGGGCTGATGATAT |
| rs797045344 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78011498 | G | A,C |
| rs797045346 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78011662 | T | A |
| rs797045347 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78011679 | G | C |
| rs797045348 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78011674 | G | T |
| rs797045349 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78012877 | A | G |
| rs797045350 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78012889 | G | A |
| rs797045351 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78012893 | G | A |
| rs797045352 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78012957 | - | ATTG |
| rs797045353 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78013008 | G | - |
| rs797045354 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78013063 | T | G |
| rs797045355 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78013101 | CATATAGCAAA | AGCATC |
| rs797045356 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78013111 | AGG | T |
| rs797045357 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78014755 | T | A |
| rs797045358 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78015759 | - | GTGAAGA |
| rs797045359 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78015753 | G | A |
| rs797045360 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78015810 | C | T |
| rs797045361 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78020262 | - | C |
| rs797045362 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78020367 | T | A |
| rs797045363 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78020398 | G | C |
| rs797045364 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78021082 | AAGT | - |
| rs797045365 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78029335 | C | T |
| rs797045366 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78029401 | GCATACTAATAAAAG | - |
| rs797045367 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78031399 | G | A |
| rs797045368 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78031412 | G | - |
| rs797045369 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78031415 | TTTGA | AGTACAGG |
| rs797045370 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78031420 | T | G |
| rs797045371 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78031440 | ACGGA | NNNN |
| rs797045372 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78031573 | T | G |
| rs797045373 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78031576 | C | A |
| rs797045374 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78031583 | G | T |
| rs797045375 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78033650 | G | - |
| rs797045376 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78033662 | G | T |
| rs797045377 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78033689 | G | T |
| rs797045378 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78033776 | C | T |
| rs797045379 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78033812 | C | T |
| rs797045380 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78038861 | A | - |
| rs797045382 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78040696 | G | A |
| rs797045383 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78040706 | T | ATGACTGG |
| rs797045384 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78040707 | AA | TTAC |
| rs797045385 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78040732 | A | T |
| rs797045386 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78040734 | G | T |
| rs797045387 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78040737 | A | G |
| rs797045388 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78042703 | C | G |
| rs797045389 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78042703 | C | - |
| rs797045390 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78042726 | G | A |
| rs797045391 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78042789 | G | T |
| rs797045392 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78043325 | TCT | - |
| rs797045393 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78043435 | G | A |
| rs797045394 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78043434 | G | A |
| rs797045395 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78045478 | - | A |
| rs797045396 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78045533 | C | T |
| rs797045397 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 77988542 | GA | - |
| rs797045398 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 78045577 | G | A |
| rs797045399 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 77988719 | C | T |
| rs797045400 | NA | 538 | ATP7A | umls:C0022716 | CLINVAR | NA | 0.606244433 | NA | ATP7A | X | 77989498 | G | - |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:28) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0001072 | Thickened skin | MP:0009932 | skin fibrosis | invasion of fibrous connective tissue into the skin, often resulting from inflammation or injury |
| HP:0008872 | Feeding difficulties in infancy | MP:0011075 | abnormal macrophage activation involved in immune response | anomaly in the process in which a change in response and behavior of a macrophage results from exposure to a cytokine, chemokine, cellular ligand, or soluble factor, leading to the initiation or perpetuation of an immune response |
| HP:0002645 | Wormian bones | MP:0008915 | fused carpal bones | anomaly of the nine nodular bones of the joint between the forelimb bones and the front paws/hands resulting in some or all the bones being joined together |
| HP:0000774 | Narrow chest | MP:0004134 | abnormal chest morphology | any structural anomaly of the part of the body between the neck and the abdomen |
| HP:0008070 | Sparse hair | MP:0010202 | focal dorsal hair loss | focal hair loss on the dorsal area of a rodent resulting in dorsal skin visible in a patch where hair loss occurs |
| HP:0000974 | Hyperextensible skin | MP:0010678 | abnormal skin adnexa morphology | any structural anomaly of the tissue or structures associated with or embedded in the skin such as hair and hair follicles, sweat glands, sebaceous glands and claws or nails |
| HP:0006487 | Bowing of the long bones | MP:0013621 | decreased internal diameter of femur | reduced cross-sectional distance that extends from one lateral edge of the femur long bone marrow cavity, through its center and to the opposite lateral edge of the bone marrow cavity through the mid point of the femur |
| HP:0000174 | Abnormality of the palate | MP:0010701 | fusion of atlas and odontoid process | the large protuberance that projects upward from the cervical axis (C2), around which the cervical atlas normally rotates, is instead fused to elements of the atlas; the odontoid process may or may not remain attached to the axis |
| HP:0002170 | Intracranial hemorrhage | MP:0006203 | eye hemorrhage | bleeding into the eye |
| HP:0000023 | Inguinal hernia | MP:0010146 | umbilical hernia | an outward bulging (protrusion) of the abdominal lining or part of the abdominal organ(s) through the area around the umbilicus; occurs when the muscle through which blood vessels pass to feed the developing fetus fails to completely close |
| HP:0001324 | Muscle weakness | MP:0000746 | weakness | state of being infirm or less strong than normal |
| HP:0001252 | Muscular hypotonia | MP:0004144 | hypotonia | decreased muscle tension resulting in limpness of the muscles in the resting state, not to be confused with weakness |
| HP:0001537 | Umbilical hernia | MP:0010146 | umbilical hernia | an outward bulging (protrusion) of the abdominal lining or part of the abdominal organ(s) through the area around the umbilicus; occurs when the muscle through which blood vessels pass to feed the developing fetus fails to completely close |
| HP:0000958 | Dry skin | MP:0010678 | abnormal skin adnexa morphology | any structural anomaly of the tissue or structures associated with or embedded in the skin such as hair and hair follicles, sweat glands, sebaceous glands and claws or nails |
| HP:0002757 | Recurrent fractures | MP:0004675 | rib fractures | a crack or break in the bones forming the bony wall of the chest |
| HP:0000987 | Atypical scarring of skin | MP:0011205 | excessive folding of visceral yolk sac | the appearance of wrinkles or folds on the surface of the visceral yolk sac |
| HP:0002239 | Gastrointestinal hemorrhage | MP:0012305 | umbilical cord hemorrhage | bleeding into or from the umbilical cord |
| HP:0001010 | Hypopigmentation of the skin | MP:0010178 | increased number of Howell-Jolly bodies | abnormal presence of basophilic nuclear remnants of condensed DNA (1 to 2 um in diameter) in circulating erythrocytes, typically seen in severe hemolytic anemias or after splenectomy; these inclusions are normally removed by the spleen but will persist in |
| HP:0002224 | Woolly hair | MP:0010685 | abnormal hair follicle inner root sheath morphology | any structural anomaly of the multilayered tube composed of terminally differentiated hair follicle keratinocytes that is surrounded by the outer root sheath; the layers of the inner root sheath include the companion layer, Henle's layer, Huxley's layer a |
| HP:0005599 | Hypopigmentation of hair | MP:0009657 | failure of chorioallantoic fusion | failure to initiate and/or complete the formation of a highly vascularized extra-embryonic fetal membrane by fusion of the chorion and allantois |
| HP:0006579 | Prolonged neonatal jaundice | MP:0011087 | neonatal lethality, complete penetrance | death of all organisms of a given genotype in a population within the neonatal period after birth (Mus: P0) |
| HP:0002017 | Nausea and vomiting | MP:0010426 | abnormal heart and great artery attachment | any anomaly in the in the position or pattern of the connection site of the heart to any of the great arteries, including the pulmonary artery and aorta |
| HP:0001511 | Intrauterine growth retardation | MP:0011109 | lethality throughout fetal growth and development, incomplete penetrance | the appearance of lower than Mendelian ratios of organisms of a given genotype due to death of some, but not all of the organisms between the completion of organogenesis and birth (Mus: E14 to approximately E18.5) |
| HP:0100545 | Arterial stenosis | MP:0010641 | descending aorta stenosis | diffuse constriction or narrowing of the descending aorta |
| HP:0000944 | Abnormality of the metaphyses | MP:0013621 | decreased internal diameter of femur | reduced cross-sectional distance that extends from one lateral edge of the femur long bone marrow cavity, through its center and to the opposite lateral edge of the bone marrow cavity through the mid point of the femur |
| HP:0008368 | Tarsal synostosis | MP:0000566 | synostosis | osseous union of two bones that are not normally connected |
| HP:0010318 | Aplasia/Hypoplasia of the abdominal wall musculature | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0000271 | Abnormality of the face | MP:0009889 | persistence of medial edge epithelium during palatal shelf fusion | palatal shelves meet at the midline during development but do not adhere along the medial edge epithelia, and fail to form the midline epithelial seam |
Mapped by homologous gene(Total Items:63) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0001252 | Muscular hypotonia | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0002754 | Osteomyelitis | MP:0020080 | increased bone mineralization | increase in the rate at which minerals are deposited into bone |
| HP:0002645 | Wormian bones | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0005599 | Hypopigmentation of hair | MP:0014178 | increased brain apoptosis | increase in the number of cells of the brain undergoing programmed cell death |
| HP:0000987 | Atypical scarring of skin | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000774 | Narrow chest | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0001250 | Seizures | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000708 | Behavioral abnormality | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0005054 | Metaphyseal spurs | MP:0014178 | increased brain apoptosis | increase in the number of cells of the brain undergoing programmed cell death |
| HP:0007420 | Spontaneous hematomas | MP:0013693 | abnormal hemopoiesis | any anomaly in the process whose specific outcome is the progression of the myeloid and lymphoid derived organ/tissue systems of the blood and other parts of the body over time, from formation to the mature structure; the site of hemopoiesis is variable d |
| HP:0002224 | Woolly hair | MP:0014178 | increased brain apoptosis | increase in the number of cells of the brain undergoing programmed cell death |
| HP:0001072 | Thickened skin | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0100545 | Arterial stenosis | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000174 | Abnormality of the palate | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0004322 | Short stature | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000347 | Micrognathia | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0002024 | Malabsorption | MP:0020220 | decreased tear production | decreased production of the amount of fluid produced in the eye |
| HP:0005293 | Venous insufficiency | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000269 | Prominent occiput | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000271 | Abnormality of the face | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0001257 | Spasticity | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0001511 | Intrauterine growth retardation | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0000298 | Mask-like facies | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0000248 | Brachycephaly | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000939 | Osteoporosis | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002239 | Gastrointestinal hemorrhage | MP:0020215 | impaired blood coagulation | impaired ability of the blood to clot |
| HP:0000934 | Chondrocalcinosis | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000973 | Cutis laxa | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0002017 | Nausea and vomiting | MP:0020220 | decreased tear production | decreased production of the amount of fluid produced in the eye |
| HP:0006487 | Bowing of the long bones | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001324 | Muscle weakness | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0012378 | Fatigue | MP:0013659 | abnormal erythroid lineage cell morphology | any structural anomaly of an immature or mature cell in the lineage leading to and including erythrocytes |
| HP:0002617 | Aneurysm | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0002757 | Recurrent fractures | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0100806 | Sepsis | MP:0011708 | decreased fibroblast cell migration | reduced frequency of or less rapid fibroblast cell migration that is accomplished by extension and retraction of a fibroblast pseudopodium |
| HP:0000767 | Pectus excavatum | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0001388 | Joint laxity | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0001943 | Hypoglycemia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001276 | Hypertonia | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0002045 | Hypothermia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001249 | Intellectual disability | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0002376 | Developmental regression | MP:0020214 | susceptible to malignant hyperthermia | increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine |
| HP:0005344 | Abnormality of the carotid arteries | MP:0014178 | increased brain apoptosis | increase in the number of cells of the brain undergoing programmed cell death |
| HP:0008368 | Tarsal synostosis | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0008872 | Feeding difficulties in infancy | MP:0020214 | susceptible to malignant hyperthermia | increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine |
| HP:0100790 | Hernia | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| HP:0010318 | Aplasia/Hypoplasia of the abdominal wall musculature | MP:0020169 | increased thyroid gland weight | higher than average weight of the thyroid gland |
| HP:0006579 | Prolonged neonatal jaundice | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0001537 | Umbilical hernia | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000015 | Bladder diverticulum | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0002072 | Chorea | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0008070 | Sparse hair | MP:0014179 | abnormal blood-retinal barrier function | anomaly in the function of the part of the blood-ocular barrier that consists of cells that are joined tightly together to prevent certain substances from entering the tissue of the retina; the BRB consists of non-fenestrated capillaries of the retinal ci |
| HP:0000023 | Inguinal hernia | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000958 | Dry skin | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0005692 | Joint hyperflexibility | MP:0012125 | decreased bronchoconstrictive response | reduction in the expected bronchoconstrictive response to provocation challenge with lipopolysaccharide, bradykinin, histamine or other antigen/allergen or agent, often measured by plethysmography |
| HP:0100777 | Exostoses | MP:0014178 | increased brain apoptosis | increase in the number of cells of the brain undergoing programmed cell death |
| HP:0002170 | Intracranial hemorrhage | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000974 | Hyperextensible skin | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000293 | Full cheeks | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000252 | Microcephaly | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000944 | Abnormality of the metaphyses | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0003016 | Metaphyseal widening | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001010 | Hypopigmentation of the skin | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| Disease ID | 156 |
|---|---|
| Disease | menkes disease |
| Case | (Waiting for update.) |