eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| meckel syndrome | ||||
| Disease ID | 762 |
|---|---|
| Disease | meckel syndrome |
| Definition | Meckel syndrome (also known as Meckel–Gruber Syndrome, Gruber Syndrome, Dysencephalia Splanchnocystica) is a rare, lethal, ciliopathic, genetic disorder, characterized by renal cystic dysplasia, central nervous system malformations (occipital encephalocele), polydactyly (post axial), hepatic developmental defects, and pulmonary hypoplasia due to oligohydramnios. - Wikipedia Reference: https://en.wikipedia.org/wiki/meckel syndrome |
| Synonym | dysencephalia splachnocystica gruber syndrome meckel syndrome type 1 meckel syndrome type1 meckel-gruber syndrome, type 1 |
| Orphanet | |
| OMIM | |
| DOID | |
| UMLS | C3714506 |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:2) |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:9) |
| Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:68) 174 | AFP | 2.62 | DISEASES 257 | ALX3 | 1.63 | DISEASES 392509 | ARL13A | 4.802 | DISEASES 200894 | ARL13B | 5.141 | DISEASES 50807 | ASAP1 | 2.512 | DISEASES 26005 | C2CD3 | 3.597 | DISEASES 65250 | C5orf42 | 3.741 | DISEASES 800 | CALD1 | 1.95 | DISEASES 57545 | CC2D2A | 6.175 | DISEASES 387707 | CC2D2B | 4.595 | DISEASES 8814 | CDKL1 | 3.276 | DISEASES 8999 | CDKL2 | 3.526 | DISEASES 80184 | CEP290 | 6.033 | DISEASES 55165 | CEP55 | 2.388 | DISEASES 23059 | CLUAP1 | 3.426 | DISEASES 54875 | CNTLN | 4.277 | DISEASES 51473 | DCDC2 | 2.21 | DISEASES 1855 | DVL1 | 1.607 | DISEASES 79659 | DYNC2H1 | 2.615 | DISEASES 2108 | ETFA | 1.969 | DISEASES 132884 | EVC2 | 1.743 | DISEASES 2673 | GFPT1 | 1.123 | DISEASES 2736 | GLI2 | 1.042 | DISEASES 2737 | GLI3 | 2.726 | DISEASES 2804 | GOLGB1 | 1.592 | DISEASES 219844 | HYLS1 | 2.619 | DISEASES 80173 | IFT74 | 3.337 | DISEASES 8100 | IFT88 | 3.034 | DISEASES 56623 | INPP5E | 2.781 | DISEASES 9851 | KIAA0753 | 2.117 | DISEASES 11127 | KIF3A | 2.09 | DISEASES 3980 | LIG3 | 1.136 | DISEASES 85444 | LRRCC1 | 4.904 | DISEASES 54903 | MKS1 | 6.99 | DISEASES 51199 | NIN | 1.93 | DISEASES 27031 | NPHP3 | 3.242 | DISEASES 261734 | NPHP4 | 4.524 | DISEASES 11247 | NXPH4 | 3.312 | DISEASES 4952 | OCRL | 1.504 | DISEASES 8481 | OFD1 | 3.623 | DISEASES 5158 | PDE6B | 1.153 | DISEASES 51230 | PHF20 | 2.202 | DISEASES 5314 | PKHD1 | 2.205 | DISEASES 5730 | PTGDS | 1.426 | DISEASES 5991 | RFX3 | 2.984 | DISEASES 387 | RHOA | 1.278 | DISEASES 6103 | RPGR | 2.238 | DISEASES 57096 | RPGRIP1 | 3.779 | DISEASES 23322 | RPGRIP1L | 5.795 | DISEASES 6303 | SAT1 | 1.49 | DISEASES 10806 | SDCCAG8 | 2.421 | DISEASES 23345 | SYNE1 | 1.686 | DISEASES 23224 | SYNE2 | 1.782 | DISEASES 23336 | SYNM | 2.701 | DISEASES 10732 | TCFL5 | 1.521 | DISEASES 79600 | TCTN1 | 4.967 | DISEASES 200728 | TMEM17 | 4.545 | DISEASES 51259 | TMEM216 | 6.407 | DISEASES 79583 | TMEM231 | 5.273 | DISEASES 65062 | TMEM237 | 3.767 | DISEASES 91147 | TMEM67 | 7.321 | DISEASES 283232 | TMEM80 | 4.456 | DISEASES 83857 | TMTC1 | 1.724 | DISEASES 27095 | TRAPPC3 | 2.797 | DISEASES 7106 | TSPAN4 | 2.018 | DISEASES 79770 | TXNDC15 | 4.975 | DISEASES 57728 | WDR19 | 2.828 | DISEASES 63929 | XPNPEP3 | 3.359 | DISEASES |
| Locus | Symbol | Locus(Total Locus:13) |
| Disease ID | 762 |
|---|---|
| Disease | meckel syndrome |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:45) HP:0001830 | Postaxial foot polydactyly HP:0000028 | Cryptorchidism HP:0001746 | Asplenia HP:0000037 | Male pseudohermaphroditism HP:0006487 | Bowing of the long bones HP:0000568 | Microphthalmia HP:0100732 | Pancreatic fibrosis HP:0000068 | Urethral atresia HP:0000647 | Sclerocornea HP:0000518 | Cataract HP:0001562 | Oligohydramnios HP:0001696 | Situs inversus totalis HP:0010295 | Aplasia/Hypoplasia of the tongue HP:0000347 | Micrognathia HP:0007370 | Aplasia/Hypoplasia of the corpus callosum HP:0002564 | Malformation of the heart and great vessels HP:0000532 | Chorioretinal abnormality HP:0008053 | Aplasia/Hypoplasia of the iris HP:0000316 | Hypertelorism HP:0001162 | Postaxial hand polydactyly HP:0000062 | Ambiguous genitalia HP:0001737 | Pancreatic cysts HP:0002612 | Congenital hepatic fibrosis HP:0006706 | Cystic liver disease HP:0000175 | Cleft palate HP:0000003 | Multicystic kidney dysplasia HP:0001177 | Preaxial hand polydactyly HP:0000457 | Depressed nasal ridge HP:0000221 | Furrowed tongue HP:0000293 | Full cheeks HP:0000252 | Microcephaly HP:0000528 | Anophthalmia HP:0000648 | Optic atrophy HP:0010459 | True hermaphroditism HP:0001305 | Dandy-Walker malformation HP:0001883 | Talipes HP:0000073 | Ureteral duplication HP:0000368 | Low-set, posteriorly rotated ears HP:0001747 | Accessory spleen HP:0002084 | Encephalocele HP:0006870 | Lobar holoprosencephaly HP:0000340 | Sloping forehead HP:0000238 | Hydrocephalus HP:0002323 | Anencephaly HP:0000482 | Microcornea |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:2) |
| Disease ID | 762 |
|---|---|
| Disease | meckel syndrome |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:18) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs199874059 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1 | 17 | 58210658 | C | T |
| rs201933838 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1 | 17 | 58214740 | C | T |
| rs386834041 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1 | 17 | 58208560 | G | C,A |
| rs386834042 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1 | 17 | 58207083 | A | - |
| rs386834043 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1 | 17 | 58206554 | CATGCCATTGGGACAGCCTCAGGTTTCTG | - |
| rs386834044 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1 | 17 | 58206501 | - | TGCC |
| rs386834045 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1 | 17 | 58206465 | C | T |
| rs386834046 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1;LOC105371841 | 17 | 58218620 | TGGCAGT | - |
| rs386834047 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1 | 17 | 58216112 | AG | - |
| rs386834048 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1 | 17 | 58216088 | C | T |
| rs386834049 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1 | 17 | 58214832 | G | A |
| rs386834050 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1 | 17 | 58214784 | G | A |
| rs386834051 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1;LOC105371841 | 17 | 58219175 | - | CCCGG |
| rs386834052 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1;LOC105371841 | 17 | 58219149 | A | G |
| rs386834053 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1 | 17 | 58210980 | C | T |
| rs730880323 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1;LOC105371841 | 17 | 58219176 | - | CCGGG |
| rs794727070 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1 | 17 | 58208585 | T | G |
| rs797045706 | NA | 54903 | MKS1 | umls:C3714506 | CLINVAR | NA | 0.327719925 | NA | MKS1 | 17 | 58212996 | G | A |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:20) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0008053 | Aplasia/Hypoplasia of the iris | MP:0011665 | d-loop transposition of the great arteries | complete transposition of the great arteries; the d- refers to the dextroposition of the bulboventricular loop (ie, the position of the right ventricle, which is on the right side); in addition, the aorta also tends to be on the right and anterior, and th |
| HP:0000175 | Cleft palate | MP:0013550 | abnormal secondary palate morphology | |
| HP:0001162 | Postaxial hand polydactyly | MP:0009743 | preaxial polydactyly | duplication of all or part of the first ray on one or more of the autopods |
| HP:0006487 | Bowing of the long bones | MP:0013621 | decreased internal diameter of femur | reduced cross-sectional distance that extends from one lateral edge of the femur long bone marrow cavity, through its center and to the opposite lateral edge of the bone marrow cavity through the mid point of the femur |
| HP:0000062 | Ambiguous genitalia | MP:0009202 | small external male genitalia | reduced size of the external masculine genital organs |
| HP:0000003 | Multicystic kidney dysplasia | MP:0011376 | abnormal kidney corticomedullary boundary morphology | any structural anomaly of the region demarcating the renal medulla from the surrounding cortex; end-stage renal failure may be associated with loss of the normal corticomedullary boundary |
| HP:0001177 | Preaxial hand polydactyly | MP:0009744 | postaxial polydactyly | duplication of all or part of any of the rays except the first ray on one or more of the autopods |
| HP:0000457 | Depressed nasal ridge | MP:0004872 | absent nasal septum | absence of the structure that separates the two nasal cavities |
| HP:0001696 | Situs inversus totalis | MP:0011252 | situs inversus totalis | the complete right to left reversal (transposition) of the thoracic and abdominal organs, including the heart (dextrocardia) |
| HP:0001747 | Accessory spleen | MP:0003342 | accessory spleen | the splenic tissue is divided into equal masses; often related to situs inversus |
| HP:0000221 | Furrowed tongue | MP:0000764 | abnormal tongue epithelium morphology | any structural anomaly of the epithelial layer of the tongue |
| HP:0000648 | Optic atrophy | MP:0012506 | brain atrophy | acquired diminution of the size of the brain associated with wasting as from death and reabsorbtion of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal chan |
| HP:0000073 | Ureteral duplication | MP:0012156 | rostral-caudal axis duplication | partial or complete duplication of rostral-caudal axis structures |
| HP:0007370 | Aplasia/Hypoplasia of the corpus callosum | MP:0013283 | failure of ventral body wall closure | failure of the lateral body wall folds (a combination of mesoderm and ectoderm arising on each side of the embryo) to progress ventrally and meet in the midline and/or fuse to close the ventral body wall; normally, this closure is aided by growth of the h |
| HP:0001830 | Postaxial foot polydactyly | MP:0009744 | postaxial polydactyly | duplication of all or part of any of the rays except the first ray on one or more of the autopods |
| HP:0001737 | Pancreatic cysts | MP:0011682 | renal glomerulus cysts | abnormal membranous sacs in any portion of the renal glomerulus |
| HP:0100732 | Pancreatic fibrosis | MP:0003985 | renal fibrosis | formation of fibrous tissue in the kidney as a result of repair or a reactive process |
| HP:0010295 | Aplasia/Hypoplasia of the tongue | MP:0003409 | decreased width of hypertrophic chondrocyte zone | decreased width of cartilage cell matrix layer |
| HP:0006706 | Cystic liver disease | MP:0003333 | liver fibrosis | invasion of fibrous connective tissue into the liver, often resulting from inflammation or injury |
| HP:0002612 | Congenital hepatic fibrosis | MP:0009501 | abnormal hepatic duct morphology | any structural anomaly of the two canals (left and right) that collect and drain bile from the left and right half of the liver from the biliary ductules and join external to the liver to form the common hepatic duct |
Mapped by homologous gene(Total Items:44) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0001883 | Talipes | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000528 | Anophthalmia | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0002323 | Anencephaly | MP:0013349 | small Rathke's pouch | reduced size of the pouch of ectoderm which grows out from the upper surface of the embryonic stomodeum and gives rise to the anterior and intermediate lobes of the pituitary gland |
| HP:0000221 | Furrowed tongue | MP:0014171 | increased fatty acid oxidation | increased rate or incidence of the process of removal of one or more electrons from a fatty acid, with or without the concomitant removal of a proton or protons, by reaction with an electron-accepting substance, by addition of oxygen or by removal of hydr |
| HP:0001830 | Postaxial foot polydactyly | MP:0013901 | absent female preputial gland | absence of the paired, lobulated, modified sebaceous glands located on the side of the clitoris in female rodents; in contrast to the preputial glands in male rodents, clitoral glands are a minor source of olfactory stimuli contributing to sexual attracti |
| HP:0001177 | Preaxial hand polydactyly | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0001162 | Postaxial hand polydactyly | MP:0014117 | increased pancreatic beta cell apoptosis | increase in the number of pancreatic beta cells undergoing programmed cell death |
| HP:0000238 | Hydrocephalus | MP:0020080 | increased bone mineralization | increase in the rate at which minerals are deposited into bone |
| HP:0000347 | Micrognathia | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000062 | Ambiguous genitalia | MP:0014198 | absent pituitary infundibular stalk | absence of the apical portion of the tubular structure extending from the hypothalamus to the posterior lobe of the pituitary gland |
| HP:0001696 | Situs inversus totalis | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| HP:0001746 | Asplenia | MP:0020220 | decreased tear production | decreased production of the amount of fluid produced in the eye |
| HP:0000316 | Hypertelorism | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000003 | Multicystic kidney dysplasia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000482 | Microcornea | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000340 | Sloping forehead | MP:0020040 | decreased bone ossification | decrease in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0100732 | Pancreatic fibrosis | MP:0013502 | decreased fibroblast apoptosis | reduction in the timing or the number of fibroblast cells undergoing programmed cell death |
| HP:0000518 | Cataract | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0008053 | Aplasia/Hypoplasia of the iris | MP:0014164 | abnormal ciliary process morphology | any structural anomaly of any of the pigmented processes that radiate from the ciliary muscle and give attachments to ligaments supporting the lens of the eye; these processes increase in thickness as they advance from the orbiculus ciliaris to the exter |
| HP:0001747 | Accessory spleen | MP:0013349 | small Rathke's pouch | reduced size of the pouch of ectoderm which grows out from the upper surface of the embryonic stomodeum and gives rise to the anterior and intermediate lobes of the pituitary gland |
| HP:0000028 | Cryptorchidism | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0007370 | Aplasia/Hypoplasia of the corpus callosum | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0002084 | Encephalocele | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001305 | Dandy-Walker malformation | MP:0013785 | abnormal mammary gland bud morphology | any structural anomaly of the morphologically distinct bulb of epithelial cells formed once each mammary placode expands and invaginates into the underlying mesenchyme; in mouse embryos at E12.5, each epithelial bud with its contiguous mesenchyme is eleva |
| HP:0010459 | True hermaphroditism | MP:0014198 | absent pituitary infundibular stalk | absence of the apical portion of the tubular structure extending from the hypothalamus to the posterior lobe of the pituitary gland |
| HP:0006706 | Cystic liver disease | MP:0013349 | small Rathke's pouch | reduced size of the pouch of ectoderm which grows out from the upper surface of the embryonic stomodeum and gives rise to the anterior and intermediate lobes of the pituitary gland |
| HP:0006487 | Bowing of the long bones | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000457 | Depressed nasal ridge | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000532 | Chorioretinal abnormality | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000568 | Microphthalmia | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000175 | Cleft palate | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0001562 | Oligohydramnios | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0010295 | Aplasia/Hypoplasia of the tongue | MP:0013906 | absent embryonic telencephalon | absence of the paired diverticula of the embryonic telencephalon, from which the forebrain develops |
| HP:0001737 | Pancreatic cysts | MP:0013293 | embryonic lethality prior to tooth bud stage | death prior to the appearance of tooth buds (Mus: E12-E12.5) |
| HP:0000647 | Sclerocornea | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000073 | Ureteral duplication | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000368 | Low-set, posteriorly rotated ears | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002612 | Congenital hepatic fibrosis | MP:0013504 | increased embryonic tissue cell apoptosis | increase in the timing or the number of cells in embryonic tissue undergoing programmed cell death |
| HP:0000293 | Full cheeks | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000252 | Microcephaly | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000068 | Urethral atresia | MP:0012739 | abnormal anterior primitive streak morphology | any structural anomaly of the anterior region of the vertebrate primitive streak which gives rise to the axial and paraxial mesoderm, the definitive endoderm, the primitive groove, and the primitive node |
| HP:0000648 | Optic atrophy | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000037 | Male pseudohermaphroditism | MP:0013745 | abnormal eyelid margin morphology | any structural anomaly of the confluence of the mucosal surface of the conjunctiva, the edge of the orbicularis, and the cutaneous epithelium |
| HP:0006870 | Lobar holoprosencephaly | MP:0014051 | abnormal maxillary-premaxillary suture morphology | any structural anomaly of the line of union of the two portions of the maxilla (pre- and postmaxilla) |
| Disease ID | 762 |
|---|---|
| Disease | meckel syndrome |
| Case | (Waiting for update.) |