| kabuki syndrome | ||||
| Disease ID | 69 |
|---|---|
| Disease | kabuki syndrome |
| Definition | A rare, autosomal dominant or X-linked dominant inherited syndrome caused by mutations in the KMT2D gene (also known as MLL2) or the KDM6A gene. It is characterized by distinctive facial features including arched eyebrows, long eyelashes, long palpebral fissures with the lower lids turned out at the outside edges, a flat nose, and large protruding earlobes, developmental delay and intellectual disability. |
| Synonym | kabuk1 kabuki make up syndrome kabuki make-up syndrome kabuki make-up syndrome (disorder) kabuki makeup syndrome kabuki syndrome 1 niikawa-kuroki syndrome |
| Orphanet | |
| OMIM | |
| DOID | |
| UMLS | C0796004 |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:13) C0152101 | hypoplastic left heart | 2 C0020598 | hypoglycemia | 2 C0152101 | hypoplastic left heart syndrome | 2 C0024437 | macular dystrophy | 1 C0010278 | craniosynostosis | 1 C0206624 | hepatoblastoma | 1 C0014544 | epilepsy | 1 C0017658 | glomerulonephritis | 1 C1535927 | charge syndrome | 1 C0014877 | esotropia | 1 C0017662 | membranoproliferative glomerulonephritis | 1 C0038379 | strabismus | 1 C0235618 | proliferative glomerulonephritis | 1 |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:3) |
| Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:101) 23597 | ACOT9 | 5.191 | DISEASES 257 | ALX3 | 1.322 | DISEASES 353 | APRT | 1.5 | DISEASES 9070 | ASH2L | 3.683 | DISEASES 438 | ASMT | 2.037 | DISEASES 1822 | ATN1 | 1.129 | DISEASES 481 | ATP1B1 | 2.332 | DISEASES 64919 | BCL11B | 1.484 | DISEASES 64115 | C10orf54 | 1.049 | DISEASES 79823 | CAMKMT | 1.749 | DISEASES 875 | CBS | 1.689 | DISEASES 9560 | CCL4L2 | 1.195 | DISEASES 930 | CD19 | 1.627 | DISEASES 11314 | CD300A | 4.117 | DISEASES 1029 | CDKN2A | 1.692 | DISEASES 3075 | CFH | 1.561 | DISEASES 1429 | CRYZ | 1.108 | DISEASES 10675 | CSPG5 | 4.024 | DISEASES 1491 | CTH | 1.112 | DISEASES 1555 | CYP2B6 | 1.361 | DISEASES 1719 | DHFR | 2.287 | DISEASES 80712 | ESX1 | 1.347 | DISEASES 83416 | FCRL5 | 2.303 | DISEASES 2242 | FES | 1.283 | DISEASES 2246 | FGF1 | 1.524 | DISEASES 2261 | FGFR3 | 3.29 | DISEASES 344018 | FIGLA | 2.871 | DISEASES 23767 | FLRT3 | 2.738 | DISEASES 5349 | FXYD3 | 1.865 | DISEASES 1647 | GADD45A | 1.652 | DISEASES 9573 | GDF3 | 1.892 | DISEASES 2731 | GLDC | 1.872 | DISEASES 132158 | GLYCTK | 3.404 | DISEASES 2805 | GOT1 | 1.864 | DISEASES 54363 | HAO1 | 1.674 | DISEASES 10614 | HEXIM1 | 2.032 | DISEASES 3141 | HLCS | 1.641 | DISEASES 3190 | HNRNPK | 2.266 | DISEASES 100124700 | HOTAIR | 1.987 | DISEASES 3570 | IL6R | 2.315 | DISEASES 3660 | IRF2 | 1.568 | DISEASES 3662 | IRF4 | 1.562 | DISEASES 3664 | IRF6 | 1.968 | DISEASES 9445 | ITM2B | 2.014 | DISEASES 152789 | JAKMIP1 | 2.923 | DISEASES 8242 | KDM5C | 1.774 | DISEASES 7403 | KDM6A | 6.121 | DISEASES 9314 | KLF4 | 1.353 | DISEASES 687 | KLF9 | 1.87 | DISEASES 54900 | LAX1 | 1.88 | DISEASES 4038 | LRP4 | 1.725 | DISEASES 126364 | LRRC25 | 2.147 | DISEASES 147719 | LYPD4 | 2.458 | DISEASES 256691 | MAMDC2 | 3.267 | DISEASES 84930 | MASTL | 2.362 | DISEASES 4170 | MCL1 | 1.646 | DISEASES 90550 | MCU | 1.49 | DISEASES 10873 | ME3 | 2.733 | DISEASES 83552 | MFRP | 2.479 | DISEASES 8972 | MGAM | 1.173 | DISEASES 25834 | MGAT4C | 1.336 | DISEASES 51660 | MPC1 | 3.953 | DISEASES 57380 | MRS2 | 1.592 | DISEASES 4609 | MYC | 1.194 | DISEASES 25915 | NDUFAF3 | 3.352 | DISEASES 11188 | NISCH | 2.676 | DISEASES 4839 | NOP2 | 3.633 | DISEASES 23467 | NPTXR | 1.495 | DISEASES 22978 | NT5C2 | 1.683 | DISEASES 22976 | PAXIP1 | 2.391 | DISEASES 103164619 | PCAT2 | 1.816 | DISEASES 9124 | PDLIM1 | 1.166 | DISEASES 100861550 | PDX1-AS1 | 2.436 | DISEASES 5174 | PDZK1 | 1.867 | DISEASES 11040 | PIM2 | 2.945 | DISEASES 5336 | PLCG2 | 2.699 | DISEASES 5366 | PMAIP1 | 1.483 | DISEASES 54496 | PRMT7 | 2.727 | DISEASES 5693 | PSMB5 | 2.125 | DISEASES 5813 | PURA | 1.921 | DISEASES 5906 | RAP1A | 2.248 | DISEASES 253260 | RICTOR | 1.091 | DISEASES 23322 | RPGRIP1L | 1.621 | DISEASES 286205 | SCAI | 1.61 | DISEASES 9962 | SLC23A2 | 1.971 | DISEASES 23137 | SMC5 | 2.722 | DISEASES 677825 | SNORA44 | 2.74 | DISEASES 6658 | SOX3 | 1.638 | DISEASES 27286 | SRPX2 | 1.257 | DISEASES 51347 | TAOK3 | 1.646 | DISEASES 6917 | TCEA1 | 1.879 | DISEASES 80036 | TRPM3 | 1.715 | DISEASES 7278 | TUBA3C | 3.307 | DISEASES 113457 | TUBA3D | 1.98 | DISEASES 7322 | UBE2D2 | 2.064 | DISEASES 7323 | UBE2D3 | 2.512 | DISEASES 127933 | UHMK1 | 3.047 | DISEASES 7404 | UTY | 3.267 | DISEASES 11091 | WDR5 | 3.133 | DISEASES 7503 | XIST | 3.662 | DISEASES 23567 | ZNF346 | 3.038 | DISEASES |
| Locus | Symbol | Locus(Total Locus:4) |
| Disease ID | 69 |
|---|---|
| Disease | kabuki syndrome |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:63) HP:0000639 | Nystagmus HP:0000028 | Cryptorchidism HP:0003316 | Butterfly vertebrae HP:0007655 | Eversion of lateral third of lower eyelids HP:0009237 | Short 5th finger HP:0010978 | Abnormality of immune system physiology HP:0002553 | Highly arched eyebrow HP:0000826 | Precocious puberty HP:0004322 | Short stature HP:0002119 | Ventriculomegaly HP:0000592 | Blue sclerae HP:0000776 | Congenital diaphragmatic hernia HP:0000527 | Long eyelashes HP:0000218 | High palate HP:0005338 | Sparse lateral eyebrow HP:0007477 | Abnormal dermatoglyphics HP:0000508 | Ptosis HP:0000074 | Ureteropelvic junction obstruction HP:0008736 | Hypoplasia of penis HP:0002937 | Hemivertebrae HP:0000047 | Hypospadias HP:0008678 | Renal hypoplasia/aplasia HP:0000126 | Hydronephrosis HP:0001680 | Coarctation of aorta HP:0000486 | Strabismus HP:0006482 | Abnormality of dental morphology HP:0005692 | Joint hyperflexibility HP:0000668 | Hypodontia HP:0000081 | Duplicated collecting system HP:0000164 | Abnormality of the teeth HP:0002120 | Cerebral cortical atrophy HP:0004736 | Crossed fused renal ectopia HP:0000407 | Sensorineural hearing impairment HP:0002719 | Recurrent infections HP:0000384 | Preauricular skin tag HP:0002000 | Short columella HP:0011968 | Feeding difficulties HP:0002353 | EEG abnormality HP:0001250 | Seizures HP:0000175 | Cleft palate HP:0000589 | Coloboma HP:0003312 | Abnormal form of the vertebral bodies HP:0000298 | Mask-like facies HP:0002650 | Scoliosis HP:0000252 | Microcephaly HP:0005819 | Short middle phalanx of finger HP:0001508 | Failure to thrive HP:0100267 | Lip pit HP:0200055 | Small hand HP:0000405 | Conductive hearing impairment HP:0000202 | Oral cleft HP:0000411 | Protruding ear HP:0000691 | Microdontia HP:0001513 | Obesity HP:0100542 | Abnormal localization of kidney HP:0002827 | Hip dislocation HP:0000400 | Macrotia HP:0000687 | Widely spaced teeth HP:0001252 | Muscular hypotonia HP:0000238 | Hydrocephalus HP:0001671 | Abnormality of the cardiac septa HP:0008428 | Vertebral clefting HP:0000482 | Microcornea |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:18) HP:0001943 | Hypoglycemia | 2 HP:0004383 | Underdeveloped left heart | 2 HP:0012393 | Allergy | 1 HP:0001363 | Early fusion of cranial sutures | 1 HP:0010891 | Scheuermann disease | 1 HP:0000486 | Squint eyes | 1 HP:0001627 | Congenital heart defects | 1 HP:0007754 | Macular dystrophy | 1 HP:0100257 | Cleft hand | 1 HP:0002888 | Ependymoma | 1 HP:0002827 | Hip dislocation | 1 HP:0000099 | Glomerular nephritis | 1 HP:0000793 | Membranoproliferative glomerulonephritis | 1 HP:0000565 | Inward turning of one or both eyes | 1 HP:0002999 | Dislocated kneecap | 1 HP:0004313 | Decreased immunoglobulin level | 1 HP:0002884 | Hepatoblastoma | 1 HP:0002539 | Cortical dysplasia | 1 |
| Disease ID | 69 |
|---|---|
| Disease | kabuki syndrome |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:15) C2240378 | cleft palate C1611280 | allergy C0741916 | cardiac defects C0239946 | hepatic fibrosis C0206624 | hepatoblastoma C0152101 | hypoplastic left heart syndrome C0078981 | arachnoid cyst C0043117 | idiopathic thrombocytopenic purpura C0037769 | west syndrome C0033377 | ptosis C0014877 | esotropia C0005411 | biliary atresia C0004364 | autoimmune disorders C0004352 | autistic disorder C0000889 | acanthosis nigricans |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:5) C0152101 | hypoplastic left heart syndrome | 2 C0014877 | esotropia | 1 C0741916 | cardiac defects | 1 C0206624 | hepatoblastoma | 1 C0002111 | allergy | 1 |
Manually Genotype(Total Manually Genotypes:2) | |||
|---|---|---|---|
| Gene | Mutation | DOI | Article Title |
| KMT2D | Chr12:g.49423183C>T, heterozygous;NM_003482.3, NP_003473.3;c.14075+1G>A | doi:10.1038/gim.2016.1 | A prospective evaluation of whole-exome sequencing as a first-tier molecular test in infants with suspected monogenic disorders |
| KMT2D(MLL2) | IVS31:c.8047-15C>T (Benign); Ex31:c.6836G>A / p.Gly2279E (Benign) | doi:10.1038/gim.2015.30 | Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:114) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs183347186 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49027234 | G | A |
| rs267607237 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49026430 | C | T |
| rs267607238 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49022301 | G | A |
| rs267607239 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49022332 | G | A |
| rs267607240 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49030985 | T | A |
| rs35584294 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49040288 | - | A |
| rs398123699 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49034178 | ACACAGA | CGTGACTTGCG |
| rs398123700 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49034067 | C | T |
| rs398123701 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49033886 | G | A |
| rs398123702 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49033871 | G | A |
| rs398123704 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49033556 | G | A |
| rs398123706 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49033503 | CA | - |
| rs398123708 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49033013 | G | A |
| rs398123711 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49032299 | G | A |
| rs398123712 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49032275 | G | A |
| rs398123715 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49052382 | - | G |
| rs398123716 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49031673 | G | - |
| rs398123720 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49027865 | - | A |
| rs398123721 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49027256 | G | A |
| rs398123722 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49026935 | - | T |
| rs398123723 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49026862 | C | G |
| rs398123724 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49026824 | G | A |
| rs398123729 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49026325 | C | T |
| rs398123732 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49024674 | AATA | - |
| rs398123733 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49022819 | C | - |
| rs398123735 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49022606 | TTCTCCCGCCGGTTGGC | G |
| rs398123741 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49050056 | G | A |
| rs398123743 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49049742 | GCCTCCGCTGATA | - |
| rs398123744 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49048065 | AT | - |
| rs398123750 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49042880 | T | C |
| rs398123751 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49042283 | GGGCTGTC | - |
| rs398123753 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49041175 | A | - |
| rs398123757 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49040704 | G | A |
| rs398123758 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49040630 | C | - |
| rs556669370 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49041974 | G | A,T |
| rs574622908 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49046358 | G | T |
| rs587778449 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49051407 | GGCTCCTCAGGCCGGGGGGACAGGTGC | - |
| rs587783681 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49033442 | G | A |
| rs587783682 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49033415 | G | A |
| rs587783683 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49033319 | G | - |
| rs587783685 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49032113 | G | A |
| rs587783686 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49031809 | C | - |
| rs587783687 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49031748 | TC | - |
| rs587783688 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49031743 | G | T |
| rs587783689 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49052351 | AGGT | - |
| rs587783690 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49031255 | G | A |
| rs587783691 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49031187 | G | - |
| rs587783692 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49030958 | G | A |
| rs587783693 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49030282 | CT | - |
| rs587783695 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49026905 | G | A |
| rs587783696 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49026771 | C | T |
| rs587783697 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49024940 | C | T |
| rs587783698 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49024887 | G | A |
| rs587783699 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49024687 | G | A |
| rs587783700 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49022281 | T | A |
| rs587783702 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49022151 | C | A |
| rs587783703 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49022123 | AGTT | - |
| rs587783704 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49022073 | GAT | - |
| rs587783705 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49051870 | C | A |
| rs587783708 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49054672 | C | A |
| rs587783711 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49050467 | G | A |
| rs587783712 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49050035 | G | A |
| rs587783713 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49049893 | G | - |
| rs587783714 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49054527 | C | G |
| rs587783715 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49047980 | G | - |
| rs587783718 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49046422 | C | T |
| rs587783719 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49045922 | G | - |
| rs587783723 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49042112 | G | - |
| rs587783725 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49041096 | TCCCC | - |
| rs587783727 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49039611 | G | A |
| rs587783728 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49039489 | GCTGG | - |
| rs587783729 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49038613 | G | A |
| rs727503979 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49026710 | G | A |
| rs727503983 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49038868 | G | A |
| rs727503986 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49049116 | C | A |
| rs727503987 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49049834 | G | A |
| rs727503988 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49050885 | C | T |
| rs727503989 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49051868 | CT | - |
| rs727503990 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49054943 | T | - |
| rs756471180 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49048032 | - | C |
| rs793888511 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49032017 | G | A |
| rs793888512 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49037395 | G | A |
| rs793888513 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49027307 | C | A |
| rs793888514 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49026728 | CATT | - |
| rs793888515 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49022152 | C | G |
| rs793888516 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49032892 | TGCTGCTGTTGCTGCTGT | - |
| rs794727143 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49046762 | C | T |
| rs794727342 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49044257 | T | A |
| rs794727379 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49043679 | C | - |
| rs794727420 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49042846 | G | A |
| rs794727497 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49054753 | TGTGGACACAC | - |
| rs794727548 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49040394 | GA | - |
| rs794727549 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49039867 | G | A |
| rs794727610 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49032766 | T | - |
| rs794727611 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49032224 | C | - |
| rs794727689 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49026794 | C | - |
| rs794727752 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49022279 | C | A |
| rs796065328 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49050005 | - | G |
| rs797044630 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49050935 | CG | GGATGGCTCAGCT |
| rs797044740 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49030659 | - | C |
| rs797044744 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49027080 | - | T |
| rs797045001 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49046792 | T | G |
| rs797045658 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49032860 | G | A |
| rs797045659 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49026887 | G | A |
| rs797045660 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49050633 | - | A |
| rs797045661 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49054625 | C | - |
| rs797045662 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49050002 | - | T |
| rs797045663 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49049997 | G | - |
| rs797045667 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49044504 | - | C |
| rs797045668 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49041928 | - | T |
| rs797045669 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49041928 | C | - |
| rs797045670 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49053478 | - | C |
| rs797045671 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49038880 | - | TGCTGTTGCCTGTTGTTGCTGCCACAGTTGT |
| rs797045672 | NA | 8085 | KMT2D | umls:C0796004 | CLINVAR | NA | 0.489424521 | NA | KMT2D | 12 | 49037816 | A | - |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:25) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0000687 | Widely spaced teeth | MP:0004033 | supernumerary teeth | occurrence of more than the usual number of teeth |
| HP:0000384 | Preauricular skin tag | MP:0001786 | skin edema | accumulation of an excessive amount of fluid in the skin layers or just underneath the skin |
| HP:0000776 | Congenital diaphragmatic hernia | MP:0010146 | umbilical hernia | an outward bulging (protrusion) of the abdominal lining or part of the abdominal organ(s) through the area around the umbilicus; occurs when the muscle through which blood vessels pass to feed the developing fetus fails to completely close |
| HP:0001508 | Failure to thrive | MP:0013294 | prenatal lethality prior to heart atrial septation | death prior to the completion of heart atrial septation (Mus: E14.5-15.5) |
| HP:0010978 | Abnormality of immune system physiology | MP:0011205 | excessive folding of visceral yolk sac | the appearance of wrinkles or folds on the surface of the visceral yolk sac |
| HP:0005819 | Short middle phalanx of finger | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0000202 | Oral cleft | MP:0009890 | cleft secondary palate | congenital fissure of the tissues normally uniting to form the secondary palate |
| HP:0000218 | High palate | MP:0011615 | submucous cleft palate | a cleft of the palate with cardinal signs including a bifid uvula, a V-shaped notch at the back of the hard palate, and/or a translucent line in the midline of the soft palate and a short palate |
| HP:0000405 | Conductive hearing impairment | MP:0006325 | impaired hearing | reduced ability to perceive auditory stimuli |
| HP:0001252 | Muscular hypotonia | MP:0004144 | hypotonia | decreased muscle tension resulting in limpness of the muscles in the resting state, not to be confused with weakness |
| HP:0006482 | Abnormality of dental morphology | MP:0012069 | abnormal horizontal basal cell of olfactory epithelium morphology | any structural anomaly of the flat or angular epithelial cell with condensed nuclei and darkly staining cytoplasm containing numerous intermediate filaments inserted into desmosomes contacting surrounding supporting cells, that lie in contact with the bas |
| HP:0003312 | Abnormal form of the vertebral bodies | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0001680 | Coarctation of aorta | MP:0011665 | d-loop transposition of the great arteries | complete transposition of the great arteries; the d- refers to the dextroposition of the bulboventricular loop (ie, the position of the right ventricle, which is on the right side); in addition, the aorta also tends to be on the right and anterior, and th |
| HP:0000175 | Cleft palate | MP:0013550 | abnormal secondary palate morphology | |
| HP:0001671 | Abnormality of the cardiac septa | MP:0012167 | abnormal epigenetic regulation of gene expression | any anomaly in the process that modulates the frequency, rate or extent of gene expression, in which the process is mitotically or meiotically heritable, or is stably self-propagated in the cytoplasm of a resting cell, and does not entail a change in DNA |
| HP:0100542 | Abnormal localization of kidney | MP:0009657 | failure of chorioallantoic fusion | failure to initiate and/or complete the formation of a highly vascularized extra-embryonic fetal membrane by fusion of the chorion and allantois |
| HP:0000407 | Sensorineural hearing impairment | MP:0006330 | syndromic hearing impairment | hearing impairment that is usually associated with malformations of the external ear and other inherited signs and symptoms |
| HP:0004736 | Crossed fused renal ectopia | MP:0003446 | renal hypoplasia | underdevelopment or reduced size of the kidney, usually due to a reduced number of cells |
| HP:0000074 | Ureteropelvic junction obstruction | MP:0003270 | intestinal obstruction | any impediment, blockage, or reversal of the normal flow of the intestinal contents toward the anus |
| HP:0000081 | Duplicated collecting system | MP:0002396 | abnormal hematopoietic system morphology/development | any structural or developmental anomaly of the blood cells or the organs associated with the development and formation of blood cells |
| HP:0000411 | Protruding ear | MP:0005105 | abnormal middle ear ossicle morphology | any structural anomaly of the three small bones of the middle ear |
| HP:0007655 | Eversion of lateral third of lower eyelids | MP:0004251 | failure of heart looping | failure of the primitive heart tube to loop asymmetrically during early development |
| HP:0002120 | Cerebral cortical atrophy | MP:0012506 | brain atrophy | acquired diminution of the size of the brain associated with wasting as from death and reabsorbtion of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal chan |
| HP:0000164 | Abnormality of the teeth | MP:0010382 | abnormal dosage compensation, by inactivation of X chromosome | anomaly in the process of compensating for the two-fold variation in X-chromosome:autosome ratios between sexes by a global inactivation of all, or most of, the genes on one of the X-chromosomes in the XX sex |
| HP:0008736 | Hypoplasia of penis | MP:0013283 | failure of ventral body wall closure | failure of the lateral body wall folds (a combination of mesoderm and ectoderm arising on each side of the embryo) to progress ventrally and meet in the midline and/or fuse to close the ventral body wall; normally, this closure is aided by growth of the h |
Mapped by homologous gene(Total Items:63) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0001252 | Muscular hypotonia | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0002650 | Scoliosis | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0000411 | Protruding ear | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0002000 | Short columella | MP:0014117 | increased pancreatic beta cell apoptosis | increase in the number of pancreatic beta cells undergoing programmed cell death |
| HP:0100267 | Lip pit | MP:0013818 | abnormal oral cavity morphology | any structural anomaly of the anatomical cavity at the start of the digestive tract that is enclosed by the mouth |
| HP:0200055 | Small hand | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0000508 | Ptosis | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000164 | Abnormality of the teeth | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002120 | Cerebral cortical atrophy | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001250 | Seizures | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000486 | Strabismus | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0002353 | EEG abnormality | MP:0020214 | susceptible to malignant hyperthermia | increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine |
| HP:0002119 | Ventriculomegaly | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0000592 | Blue sclerae | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000687 | Widely spaced teeth | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0004322 | Short stature | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0009237 | Short 5th finger | MP:0013781 | abnormal mammary gland luminal epithelium morphology | any structural anomaly of the inner cell layer of the mammary epithelium bilayer that lines the luminal surface of mammary gland ducts and alveoli; luminal cells have only limited contact with the underlying basement membrane and surrounding connective ti |
| HP:0005338 | Sparse lateral eyebrow | MP:0014175 | abnormal ciliary epithelium morphology | any structural anomaly of the double layer lining the inner surfaces of the ciliary processes and the pars plana (i.e. the posterior portion of the ciliary body, aka orbicularis ciliari); the outer layer is the pigmented epithelium, which is composed of l |
| HP:0007655 | Eversion of lateral third of lower eyelids | MP:0013239 | impaired skeletal muscle regeneration | reduced ability to repair skeletal muscle after injury or disease |
| HP:0001680 | Coarctation of aorta | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0000238 | Hydrocephalus | MP:0020080 | increased bone mineralization | increase in the rate at which minerals are deposited into bone |
| HP:0000081 | Duplicated collecting system | MP:0014040 | increased cellular sensitivity to DNA damaging agents | greater incidence of cell death following exposure to agents that cause DNA damage |
| HP:0007477 | Abnormal dermatoglyphics | MP:0013696 | increased granulocyte monocyte progenitor cell number | increase in the number of a hematopoietic progenitor cell that is committed to the granulocyte and monocyte lineages; these cells are CD123-positive, and do not express Gata1 or Gata2 but do express C/EBPa, and Pu.1 |
| HP:0000047 | Hypospadias | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000407 | Sensorineural hearing impairment | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000776 | Congenital diaphragmatic hernia | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000482 | Microcornea | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002553 | Highly arched eyebrow | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0000126 | Hydronephrosis | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0001508 | Failure to thrive | MP:0020234 | decreased basal metabolism | decrease in heat production of an organism at the lowest level of cell chemistry in an inactive, awake, and fasting state |
| HP:0011968 | Feeding difficulties | MP:0020234 | decreased basal metabolism | decrease in heat production of an organism at the lowest level of cell chemistry in an inactive, awake, and fasting state |
| HP:0000028 | Cryptorchidism | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0002827 | Hip dislocation | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000384 | Preauricular skin tag | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000298 | Mask-like facies | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0004736 | Crossed fused renal ectopia | MP:0013239 | impaired skeletal muscle regeneration | reduced ability to repair skeletal muscle after injury or disease |
| HP:0005819 | Short middle phalanx of finger | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0003316 | Butterfly vertebrae | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0002937 | Hemivertebrae | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0008428 | Vertebral clefting | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000405 | Conductive hearing impairment | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001513 | Obesity | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000826 | Precocious puberty | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000175 | Cleft palate | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000589 | Coloboma | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000074 | Ureteropelvic junction obstruction | MP:0013901 | absent female preputial gland | absence of the paired, lobulated, modified sebaceous glands located on the side of the clitoris in female rodents; in contrast to the preputial glands in male rodents, clitoral glands are a minor source of olfactory stimuli contributing to sexual attracti |
| HP:0000218 | High palate | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0008678 | Renal hypoplasia/aplasia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000639 | Nystagmus | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0003312 | Abnormal form of the vertebral bodies | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000691 | Microdontia | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0001671 | Abnormality of the cardiac septa | MP:0013901 | absent female preputial gland | absence of the paired, lobulated, modified sebaceous glands located on the side of the clitoris in female rodents; in contrast to the preputial glands in male rodents, clitoral glands are a minor source of olfactory stimuli contributing to sexual attracti |
| HP:0010978 | Abnormality of immune system physiology | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0000202 | Oral cleft | MP:0014198 | absent pituitary infundibular stalk | absence of the apical portion of the tubular structure extending from the hypothalamus to the posterior lobe of the pituitary gland |
| HP:0002719 | Recurrent infections | MP:0020234 | decreased basal metabolism | decrease in heat production of an organism at the lowest level of cell chemistry in an inactive, awake, and fasting state |
| HP:0008736 | Hypoplasia of penis | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0100542 | Abnormal localization of kidney | MP:0013901 | absent female preputial gland | absence of the paired, lobulated, modified sebaceous glands located on the side of the clitoris in female rodents; in contrast to the preputial glands in male rodents, clitoral glands are a minor source of olfactory stimuli contributing to sexual attracti |
| HP:0000400 | Macrotia | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0005692 | Joint hyperflexibility | MP:0012125 | decreased bronchoconstrictive response | reduction in the expected bronchoconstrictive response to provocation challenge with lipopolysaccharide, bradykinin, histamine or other antigen/allergen or agent, often measured by plethysmography |
| HP:0000668 | Hypodontia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000527 | Long eyelashes | MP:0013956 | decreased colon length | reduced length of the portion of the large intestine between the cecum and the rectum |
| HP:0000252 | Microcephaly | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0006482 | Abnormality of dental morphology | MP:0014176 | abnormal cilary zonule morphology | any structural anomaly of the circumferential suspensory ligaments that anchor the lens to the ciliary process and are made of bundles of fibrillin microfibrils, an elaborate system of fibers that spans the gap between the lens and the adjacent nonpigment |
| Disease ID | 69 |
|---|---|
| Disease | kabuki syndrome |
| Case | (Waiting for update.) |