eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine

HOME
QUERY
- DISEASE
- GENOTYPE
NETWORK
- PHENOTYPE
- GENE
- COMMON
- DISEASE PAIR
DOWNLOAD
SUBMIT CASE
HELP&FAQ
- HELP&FAQ
- CONTACT US


	idiopathic pulmonary fibrosis

Disease ID	97
Disease	idiopathic pulmonary fibrosis
Definition	Idiopathic pulmonary fibrosis (IPF) is a chronic and ultimately fatal disease characterized by a progressive decline in lung function.[2][3] The term pulmonary fibrosis means scarring of lung tissue and is the cause of worsening dyspnea (shortness of breath). Fibrosis is usually associated with a poor prognosis.[2][3][4] - Wikipedia Reference: https://en.wikipedia.org/wiki/idiopathic pulmonary fibrosis
Synonym	alveolitides, fibrosing alveolitis fibrosing alveolitis, chronic diffuse fibrosing alveolitis, chronic diffuse sclerosing alveolitis, fibrosing alveolitis-idiopath. fibrosing cryptogenic fibrosing alveolitis diffuse idiopathic pulmonary fibrosis diffuse interstitial pulmonary fibrosis diffuse interstitial pulmonary fibrosis (disorder) dipf - diffuse interstitial pulmonary fibrosis disease hammans rich fibrosing alveolitides fibrosing alveolitis fibrosing alveolitis-idiopath. fibrosis idiopathic ipf pulmonary fibrosis idiopathic pulmonary fibrosis, pulmonary, interstitial diffuse hamman - rich syndrome hamman rich disease hamman rich syndrome hamman-rich disease hamman-rich syndrome idiopath. fibrosing alveolitis idiopath. fibrosing alveolitis (& hamman-rich syndrome) idiopath. fibrosing alveolitis (& hamman-rich syndrome) (disorder) idiopathic fibrosing alveolitis idiopathic fibrosing alveolitis (disorder) idiopathic fibrosing alveolitis nos idiopathic fibrosing alveolitis nos (disorder) idiopathic pulmonary fibrosis (disorder) syndrome, hamman-rich uip usual interstitial pneumonia usual interstitial pneumonitis
Orphanet	ORPHANET:79126 ORPHANET:2032
OMIM	OMIM:178500
DOID	DOID:2800 DOID:2797 DOID:0050156
ICD10	ICD10CM:J84.112
UMLS	C0085786
MeSH	D054990
SNOMED-CT	SNOMEDCT_US_2016_09_01:700250006;SNOMEDCT_US_2016_09_01:196125002
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:55) C1800706 \| usual interstitial pneumonia \| 24 C0020542 \| pulmonary hypertension \| 19 C0242379 \| lung cancer \| 19 C0020538 \| hypertension \| 17 C0034069 \| pulmonary fibrosis \| 8 C0013990 \| emphysema \| 7 C1145670 \| respiratory failure \| 7 C0024115 \| lung disease \| 4 C0017168 \| oesophageal reflux \| 4 C0017168 \| esophageal reflux \| 4 C0002390 \| hypersensitivity pneumonitis \| 3 C0017168 \| gastroesophageal reflux \| 3 C0034067 \| pulmonary emphysema \| 3 C0032285 \| pneumonitis \| 3 C0520679 \| obstructive sleep apnea \| 3 C0149925 \| small cell lung cancer \| 3 C0037315 \| sleep-disordered breathing \| 3 C0032285 \| pneumonia \| 3 C0037315 \| sleep apnea \| 3 C0009782 \| connective tissue disease \| 3 C0035229 \| respiratory insufficiency \| 3 C0024115 \| pulmonary disease \| 2 C0007131 \| non-small cell lung cancer \| 2 C0003949 \| asbestosis \| 2 C0206062 \| interstitial lung disease \| 2 C0600260 \| obstructive pulmonary disease \| 2 C0010068 \| coronary artery disease \| 2 C0006267 \| bronchiectasis \| 1 C1140680 \| ovarian cancer \| 1 C0851578 \| sleep disorders \| 1 C0032231 \| pleuritis \| 1 C0010674 \| cystic fibrosis \| 1 C0011847 \| diabetes \| 1 C0006271 \| bronchiolitis \| 1 C0011570 \| depression \| 1 C0017168 \| gastroesophageal reflux disease \| 1 C1619734 \| pulmonary arterial hypertension \| 1 C0042769 \| virus infection \| 1 C0032285 \| lung inflammation \| 1 C0035222 \| acute respiratory distress syndrome \| 1 C1800706 \| idiopathic pulmonary fibrosis \| 1 C0042769 \| viral infection \| 1 C0042373 \| vascular disease \| 1 C0011849 \| diabetes mellitus \| 1 C1290344 \| nonspecific interstitial pneumonia \| 1 C1704437 \| respiratory distress syndrome \| 1 C1800706 \| cryptogenic fibrosing alveolitis \| 1 C0036202 \| sarcoidosis \| 1 C0017168 \| esophageal reflux disease \| 1 C0007222 \| cardiovascular disease \| 1 C1140680 \| ovarian ca \| 1 C0155912 \| pulmonary alveolar microlithiasis \| 1 C0085786 \| idiopathic interstitial pneumonia \| 1 C0024117 \| chronic obstructive pulmonary disease \| 1 C0017168 \| gastro-oesophageal reflux \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:17) 5073 \| PARN \| CTD_human;ORPHANET 7015 \| TERT \| CLINVAR;CTD_human;GWASCAT;GHR;ORPHANET 7012 \| TERC \| CLINVAR;CTD_human;ORPHANET 51750 \| RTEL1 \| CTD_human;ORPHANET 1832 \| DSP \| CTD_human;ORPHANET 10144 \| FAM13A \| CTD_human;ORPHANET 5328 \| PLAU \| CTD_human 100507436 \| MICA \| GHR 6440 \| SFTPC \| CTD_human;ORPHANET;GHR 727897 \| MUC5B \| CLINVAR;CTD_human;ORPHANET;GHR 653509 \| SFTPA1 \| CTD_human;ORPHANET;GHR 23250 \| ATP11A \| CTD_human;ORPHANET 54472 \| TOLLIP \| GWASCAT 729238 \| SFTPA2 \| CLINVAR;CTD_human;GHR;ORPHANET;UNIPROT 91039 \| DPP9 \| CTD_human;ORPHANET 255520 \| ELMOD2 \| CTD_human;GHR 100128977 \| MAPT-AS1 \| GWASCAT
Inferring Gene	Entrez_id \| Symbol \| Resource(Total Genes:29) 7124 \| TNF \| CIPHER 183 \| AGT \| CIPHER 1378 \| CR1 \| CIPHER 3627 \| CXCL10 \| CIPHER 6374 \| CXCL5 \| CIPHER 2212 \| FCGR2A \| CIPHER 2215 \| FCGR3B \| CIPHER 3569 \| IL6 \| CIPHER 4049 \| LTA \| CIPHER 100507436 \| MICA \| CIPHER 4312 \| MMP1 \| CIPHER 5743 \| PTGS2 \| CIPHER 7015 \| TERT \| CIPHER;CTD_human 7040 \| TGFB1 \| CIPHER 7133 \| TNFRSF1B \| CIPHER 7012 \| TERC \| CTD_human 10144 \| FAM13A \| CTD_human 5328 \| PLAU \| CTD_human 1832 \| DSP \| CTD_human 6440 \| SFTPC \| CTD_human 727897 \| MUC5B \| CTD_human 51750 \| RTEL1 \| CTD_human 79991 \| OBFC1 \| CTD_human 23250 \| ATP11A \| CTD_human 729238 \| SFTPA2 \| CTD_human 653509 \| SFTPA1 \| CTD_human 5073 \| PARN \| CTD_human 91039 \| DPP9 \| CTD_human 255520 \| ELMOD2 \| CTD_human
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:182) 94 \| ACVRL1 \| 2.506 \| DISEASES 177 \| AGER \| 1.791 \| DISEASES 183 \| AGT \| 1.465 \| DISEASES 186 \| AGTR2 \| 1.594 \| DISEASES 9447 \| AIM2 \| 1.07 \| DISEASES 338699 \| ANKRD42 \| 2.017 \| DISEASES 23294 \| ANKS1A \| 1.325 \| DISEASES 383 \| ARG1 \| 1.161 \| DISEASES 50650 \| ARHGEF3 \| 1.443 \| DISEASES 419 \| ART3 \| 1.609 \| DISEASES 116969 \| ART5 \| 1.921 \| DISEASES 23192 \| ATG4B \| 1.137 \| DISEASES 10533 \| ATG7 \| 1.152 \| DISEASES 8678 \| BECN1 \| 1.393 \| DISEASES 659 \| BMPR2 \| 1.267 \| DISEASES 51297 \| BPIFA1 \| 1.879 \| DISEASES 834 \| CASP1 \| 1.083 \| DISEASES 857 \| CAV1 \| 2.875 \| DISEASES 388372 \| CCL4L1 \| 1.84 \| DISEASES 1235 \| CCR6 \| 1.188 \| DISEASES 977 \| CD151 \| 1.124 \| DISEASES 50489 \| CD207 \| 1.019 \| DISEASES 959 \| CD40LG \| 1.364 \| DISEASES 960 \| CD44 \| 1.214 \| DISEASES 1032 \| CDKN2D \| 1.553 \| DISEASES 1490 \| CTGF \| 3.891 \| DISEASES 115908 \| CTHRC1 \| 1.692 \| DISEASES 1499 \| CTNNB1 \| 2.862 \| DISEASES 1520 \| CTSS \| 1.349 \| DISEASES 1523 \| CUX1 \| 1.263 \| DISEASES 2919 \| CXCL1 \| 1.315 \| DISEASES 6387 \| CXCL12 \| 2.44 \| DISEASES 9547 \| CXCL14 \| 1.031 \| DISEASES 284340 \| CXCL17 \| 1.702 \| DISEASES 4283 \| CXCL9 \| 2.311 \| DISEASES 2833 \| CXCR3 \| 2.715 \| DISEASES 7852 \| CXCR4 \| 2.147 \| DISEASES 1536 \| CYBB \| 1.085 \| DISEASES 64421 \| DCLRE1C \| 1.521 \| DISEASES 1649 \| DDIT3 \| 1.069 \| DISEASES 780 \| DDR1 \| 2.507 \| DISEASES 4921 \| DDR2 \| 1.222 \| DISEASES 51428 \| DDX41 \| 1.345 \| DISEASES 1668 \| DEFA3 \| 1.717 \| DISEASES 140596 \| DEFB104A \| 1.016 \| DISEASES 503618 \| DEFB104B \| 1.017 \| DISEASES 1736 \| DKC1 \| 2.781 \| DISEASES 1791 \| DNTT \| 1.038 \| DISEASES 1889 \| ECE1 \| 1.031 \| DISEASES 1906 \| EDN1 \| 2.948 \| DISEASES 10919 \| EHMT2 \| 1.168 \| DISEASES 255520 \| ELMOD2 \| 3.426 \| DISEASES 2058 \| EPRS \| 1.057 \| DISEASES 3266 \| ERAS \| 1.261 \| DISEASES 2159 \| F10 \| 1.487 \| DISEASES 2149 \| F2R \| 1.352 \| DISEASES 2152 \| F3 \| 1.709 \| DISEASES 356 \| FASLG \| 2.533 \| DISEASES 2192 \| FBLN1 \| 1.989 \| DISEASES 2246 \| FGF1 \| 1.691 \| DISEASES 2254 \| FGF9 \| 1.394 \| DISEASES 2272 \| FHIT \| 1.285 \| DISEASES 2309 \| FOXO3 \| 1.436 \| DISEASES 50943 \| FOXP3 \| 1.107 \| DISEASES 2358 \| FPR2 \| 1.112 \| DISEASES 84750 \| FUT10 \| 2.84 \| DISEASES 2736 \| GLI2 \| 1.584 \| DISEASES 2934 \| GSN \| 1.013 \| DISEASES 28996 \| HIPK2 \| 1.519 \| DISEASES 85235 \| HIST1H2AH \| 1.565 \| DISEASES 8336 \| HIST1H2AM \| 1.588 \| DISEASES 3146 \| HMGB1 \| 1.546 \| DISEASES 3200 \| HOXA3 \| 1.293 \| DISEASES 89781 \| HPS4 \| 1.99 \| DISEASES 90161 \| HS6ST2 \| 1.522 \| DISEASES 3326 \| HSP90AB1 \| 1.21 \| DISEASES 3316 \| HSPB2 \| 1.022 \| DISEASES 3486 \| IGFBP3 \| 1.294 \| DISEASES 3586 \| IL10 \| 2.436 \| DISEASES 3597 \| IL13RA1 \| 1.072 \| DISEASES 3605 \| IL17A \| 2.061 \| DISEASES 90865 \| IL33 \| 2.171 \| DISEASES 3684 \| ITGAM \| 1.14 \| DISEASES 3725 \| JUN \| 1.573 \| DISEASES 11202 \| KLK8 \| 1.847 \| DISEASES 83999 \| KREMEN1 \| 1.486 \| DISEASES 3880 \| KRT19 \| 1.228 \| DISEASES 3965 \| LGALS9 \| 1.123 \| DISEASES 8513 \| LIPF \| 1.545 \| DISEASES 4017 \| LOXL2 \| 1.792 \| DISEASES 1902 \| LPAR1 \| 2.935 \| DISEASES 9170 \| LPAR2 \| 1.496 \| DISEASES 2846 \| LPAR4 \| 1.542 \| DISEASES 4052 \| LTBP1 \| 3.245 \| DISEASES 80122 \| MAP3K19 \| 2.478 \| DISEASES 5599 \| MAPK8 \| 2.046 \| DISEASES 161357 \| MDGA2 \| 1.809 \| DISEASES 4239 \| MFAP4 \| 1.245 \| DISEASES 57591 \| MKL1 \| 2.658 \| DISEASES 4312 \| MMP1 \| 2.733 \| DISEASES 4318 \| MMP9 \| 3.068 \| DISEASES 10198 \| MPHOSPH9 \| 1.584 \| DISEASES 2475 \| MTOR \| 1.316 \| DISEASES 4582 \| MUC1 \| 4.598 \| DISEASES 4586 \| MUC5AC \| 1.485 \| DISEASES 727897 \| MUC5B \| 4.888 \| DISEASES 10608 \| MXD4 \| 1.311 \| DISEASES 4615 \| MYD88 \| 1.132 \| DISEASES 93649 \| MYOCD \| 1.213 \| DISEASES 58484 \| NLRC4 \| 2.689 \| DISEASES 114548 \| NLRP3 \| 1.587 \| DISEASES 55505 \| NOP10 \| 3.056 \| DISEASES 27035 \| NOX1 \| 1.625 \| DISEASES 100128731 \| OST4 \| 1.932 \| DISEASES 283208 \| P4HA3 \| 2.23 \| DISEASES 5073 \| PARN \| 3.716 \| DISEASES 5110 \| PCMT1 \| 1.417 \| DISEASES 5148 \| PDE6G \| 1.522 \| DISEASES 5154 \| PDGFA \| 2.741 \| DISEASES 5155 \| PDGFB \| 2.259 \| DISEASES 5294 \| PIK3CG \| 1.289 \| DISEASES 5328 \| PLAU \| 1.425 \| DISEASES 5329 \| PLAUR \| 1.035 \| DISEASES 10631 \| POSTN \| 3.07 \| DISEASES 5493 \| PPL \| 2.035 \| DISEASES 9701 \| PPP6R2 \| 1.167 \| DISEASES 5554 \| PRH1 \| 1.349 \| DISEASES 5555 \| PRH2 \| 1.349 \| DISEASES 5627 \| PROS1 \| 1.225 \| DISEASES 5728 \| PTEN \| 2.091 \| DISEASES 5743 \| PTGS2 \| 1.743 \| DISEASES 5747 \| PTK2 \| 1.678 \| DISEASES 5788 \| PTPRC \| 2.186 \| DISEASES 387 \| RHOA \| 1.436 \| DISEASES 6014 \| RIT2 \| 1.625 \| DISEASES 140823 \| ROMO1 \| 1.414 \| DISEASES 51750 \| RTEL1 \| 2.622 \| DISEASES 6275 \| S100A4 \| 2.047 \| DISEASES 6280 \| S100A9 \| 1.126 \| DISEASES 5265 \| SERPINA1 \| 1.323 \| DISEASES 871 \| SERPINH1 \| 2.955 \| DISEASES 653509 \| SFTPA1 \| 2.742 \| DISEASES 729238 \| SFTPA2 \| 3.752 \| DISEASES 6439 \| SFTPB \| 2.157 \| DISEASES 6441 \| SFTPD \| 4.536 \| DISEASES 8879 \| SGPL1 \| 1.855 \| DISEASES 23410 \| SIRT3 \| 1.09 \| DISEASES 51548 \| SIRT6 \| 1.724 \| DISEASES 6590 \| SLPI \| 1.394 \| DISEASES 4088 \| SMAD3 \| 4.485 \| DISEASES 4089 \| SMAD4 \| 1.552 \| DISEASES 23583 \| SMUG1 \| 1.307 \| DISEASES 197187 \| SNAI3-AS1 \| 2.84 \| DISEASES 692233 \| SNORD117 \| 1.87 \| DISEASES 8651 \| SOCS1 \| 1.789 \| DISEASES 6649 \| SOD3 \| 1.939 \| DISEASES 6696 \| SPP1 \| 2.206 \| DISEASES 162540 \| SPPL2C \| 2.26 \| DISEASES 6714 \| SRC \| 1.103 \| DISEASES 140809 \| SRXN1 \| 1.711 \| DISEASES 6788 \| STK3 \| 1.446 \| DISEASES 80222 \| TARS2 \| 1.188 \| DISEASES 123283 \| TARSL2 \| 1.225 \| DISEASES 9096 \| TBX18 \| 1.481 \| DISEASES 7010 \| TEK \| 1.13 \| DISEASES 7012 \| TERC \| 4.179 \| DISEASES 7042 \| TGFB2 \| 1.363 \| DISEASES 7046 \| TGFBR1 \| 3.601 \| DISEASES 7056 \| THBD \| 2.204 \| DISEASES 7099 \| TLR4 \| 1.322 \| DISEASES 54106 \| TLR9 \| 2.014 \| DISEASES 7124 \| TNF \| 3.546 \| DISEASES 8764 \| TNFRSF14 \| 1.098 \| DISEASES 7133 \| TNFRSF1B \| 1.667 \| DISEASES 8740 \| TNFSF14 \| 1.656 \| DISEASES 85480 \| TSLP \| 1.722 \| DISEASES 79805 \| VASH2 \| 1.359 \| DISEASES 7422 \| VEGFA \| 2.773 \| DISEASES 7477 \| WNT7B \| 2.316 \| DISEASES 55135 \| WRAP53 \| 1.149 \| DISEASES 55146 \| ZDHHC4 \| 1.595 \| DISEASES 7620 \| ZNF69 \| 2.574 \| DISEASES
Locus	Symbol \| Locus(Total Locus:13) DSP \| 6p24.3 SFTPA1 \| 10q22.3 TERT \| 5p15.33 TERC \| 3q26.2 SFTPC \| 8p21.3 DPP9 \| 19p13.3 ATP11A \| 13q34 MUC5B \| 11p15.5 PARN \| 16p13.12 STN1 \| 10q24.33 FAM13A \| 4q22.1 SFTPA2 \| 10q22.3 RTEL1 \| 20q13.33

Disease ID	97
Disease	idiopathic pulmonary fibrosis
Integrated Phenotype	(Waiting for update.)
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:32) HP:0002092 \| Pulmonary artery hypertension \| 19 HP:0000822 \| Hypertension \| 18 HP:0012735 \| Coughing \| 8 HP:0002206 \| Pulmonary fibrosis \| 8 HP:0002097 \| Pulmonary emphysema \| 8 HP:0002878 \| Respiratory failure \| 6 HP:0002090 \| Pneumonia \| 4 HP:0002020 \| Heartburn \| 4 HP:0002104 \| Absence of spontaneous respiration \| 3 HP:0002870 \| Obstructive sleep apnea \| 3 HP:0010535 \| Sleep apnea \| 3 HP:0030357 \| Small cell lung carcinoma \| 3 HP:0006516 \| Hypersensitivity pneumonitis \| 3 HP:0002093 \| progressive respiratory failure \| 3 HP:0002110 \| Bronchiectasis \| 2 HP:0002094 \| Dyspnea \| 2 HP:0006530 \| Interstitial lung disease \| 2 HP:0011950 \| Bronchiolitis \| 2 HP:0001677 \| Coronary artery disease \| 2 HP:0030358 \| Non-small cell lung carcinoma \| 2 HP:0000819 \| Diabetes mellitus \| 1 HP:0002875 \| Exertional dyspnea \| 1 HP:0006510 \| Chronic obstructive pulmonary disease \| 1 HP:0040213 \| Hypopnea \| 1 HP:0001907 \| Thromboembolic disease \| 1 HP:0002102 \| Pleuritis \| 1 HP:0002098 \| Respiratory distress \| 1 HP:0002960 \| Autoimmune condition \| 1 HP:0002835 \| Aspiration \| 1 HP:0006532 \| Pneumonia, recurrent episodes \| 1 HP:0000716 \| Depression \| 1 HP:0100324 \| Progressive systemic scleroderma \| 1

Disease ID	97
Disease	idiopathic pulmonary fibrosis
Manually Symptom	UMLS \| Name(Total Manually Symptoms:29) C2712340 \| dyspnoea C2240374 \| eosinophilia C1963220 \| pulmonary hypertension C1963215 \| pneumothorax C1963158 \| left ventricular diastolic dysfunction C1961131 \| cough C1956346 \| coronary artery disease C1800706 \| usual interstitial pneumonia C1619734 \| pulmonary arterial hypertension C0887914 \| tt virus C0684249 \| pulmonary carcinoma C0684249 \| lung carcinoma C0684249 \| lung cancers C0684249 \| lung cancer C0549493 \| alveolitis C0343034 \| cutaneous alternariosis C0264523 \| pulmonary ossification C0240035 \| interstitial fibrosis C0231807 \| exercise dyspnoea C0041327 \| pulmonary tuberculosis C0041296 \| tuberculosis C0037315 \| sleep-disordered breathing C0034069 \| lung fibrosis C0034065 \| pulmonary embolism C0031036 \| polyarteritis nodosa C0017168 \| gastroesophageal reflux disease C0017168 \| gastroesophageal reflux C0017168 \| gastro-oesophageal reflux C0007120 \| bronchioloalveolar carcinoma
Text Mined Symptom	UMLS \| Name \| Sentences' Count(Total Symptoms:13) C0242379 \| lung cancer \| 20 C0020542 \| pulmonary hypertension \| 19 C0010200 \| cough \| 7 C0037315 \| sleep-disordered breathing \| 3 C0010068 \| coronary artery disease \| 2 C0017168 \| gastroesophageal reflux \| 2 C0017168 \| gastro-oesophageal reflux \| 1 C0013404 \| dyspnoea \| 1 C1619734 \| pulmonary arterial hypertension \| 1 C0264523 \| pulmonary ossification \| 1 C1800706 \| usual interstitial pneumonia \| 1 C0017168 \| gastroesophageal reflux disease \| 1 C1800706 \| idiopathic pulmonary fibrosis \| 1

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:39)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs111576740	NA	7015	TERT	umls:C1800706	CLINVAR	NA	0.49298306	NA	TERT	5	1266537	T	C,G
rs121917737	NA	729238	SFTPA2	umls:C1800706	CLINVAR	NA	0.480271442	NA	SFTPA2	10	79557264	C	A
rs121917738	NA	729238	SFTPA2	umls:C1800706	CLINVAR	NA	0.480271442	NA	SFTPA2	10	79557363	A	G
rs121917834	20371530	6440	SFTPC	umls:C1800706	BeFree	A man with usual interstitial pneumonia (age of onset 58 years) was previously found to have an Ile73Thr (I73T) surfactant protein C (SFTPC) mutation.	0.243257302	2010	SFTPC	8	22163096	T	A,C
rs121917834	20371530	6440	SFTPC	umls:C0085786	BeFree	A man with usual interstitial pneumonia (age of onset 58 years) was previously found to have an Ile73Thr (I73T) surfactant protein C (SFTPC) mutation.	0.001357209	2010	SFTPC	8	22163096	T	A,C
rs121918666	NA	7015	TERT	umls:C1800706	CLINVAR	NA	0.49298306	NA	TERT	5	1266524	C	T
rs17690703	24429156	100128977	MAPT-AS1	umls:C1800706	GWASCAT	Genetic variants associated with idiopathic pulmonary fibrosis susceptibility and mortality: a genome-wide association study.	0.12	2014	MAPT-AS1	17	45847931	C	T
rs1800925	23549736	3596	IL13	umls:C1800706	BeFree	Association of the SNP rs1800925(C/T) in the interleukin-13 gene promoter with pulmonary function in Chinese Han patients with idiopathic pulmonary fibrosis.	0.003810118	2014	IL13;LOC101927761	5	132657117	C	T
rs1800925	23549736	450095	PLF	umls:C1800706	BeFree	Association of the SNP rs1800925(C/T) in the interleukin-13 gene promoter with pulmonary function in Chinese Han patients with idiopathic pulmonary fibrosis.	0.001357209	2014	IL13;LOC101927761	5	132657117	C	T
rs199422268	NA	7012	TERC	umls:C1800706	CLINVAR	NA	0.361085767	NA	TERC	3	169764963	C	T
rs199422289	NA	7015	TERT	umls:C1800706	CLINVAR	NA	0.49298306	NA	TERT	5	1294893	G	A
rs199422290	NA	7015	TERT	umls:C1800706	CLINVAR	NA	0.49298306	NA	TERT	5	1294878	G	-
rs199422291	NA	7015	TERT	umls:C1800706	CLINVAR	NA	0.49298306	NA	TERT	5	1294456	C	T
rs199422293	NA	7015	TERT	umls:C1800706	CLINVAR	NA	0.49298306	NA	TERT	5	1293430	G	A
rs199422294	NA	7015	TERT	umls:C1800706	CLINVAR	NA	0.49298306	NA	TERT	5	1280216	C	T
rs199422300	NA	7015	TERT	umls:C1800706	CLINVAR	NA	0.49298306	NA	TERT	5	1278687	A	-
rs199422306	NA	7015	TERT	umls:C1800706	CLINVAR	NA	0.49298306	NA	TERT;LOC105374613	5	1253798	G	A
rs199422308	NA	7015	TERT	umls:C1800706	CLINVAR	NA	0.49298306	NA	TERT;LOC105374613	5	1253547	GCCTCAGCCGGACACTCAGCCTTCAGCCGGACATGCAGGCCTCGGCCAAACACTCACTCAGGCCTCAGACTCCCAGCGGTGCGGGCCTGGGTGTGGGCCGCCCCTCCCTCCCTGGGACGTAGAGCCCGGCGTGACAGGGCTGCTGGTGTCTGCTCTCGGCCTGGCTGTGGGCGGGTG	-
rs199422309	NA	7015	TERT	umls:C1800706	CLINVAR	NA	0.49298306	NA	TERT	5	1294770	C	T
rs2004640	19116937	3663	IRF5	umls:C0085786	BeFree	In a multivariate analysis model including the diffuse cutaneous subtype of SSc and positivity for anti-topoisomerase I antibodies, the IRF5 rs2004640 TT genotype remained associated with fibrosing alveolitis (P=0.029, OR 1.92, 95% CI 1.07-3.44).	0.000542884	2009	IRF5	7	128938247	T	G
rs2305619	22822025	5806	PTX3	umls:C1800706	BeFree	The minor allele of rs2305619 was significantly associated with higher plasma PTX3 levels measured pretransplantation (P = 0.014) and at 24 hours (P = 0.047) after transplantation in patients with idiopathic pulmonary fibrosis.	0.000271442	2012	PTX3;VEPH1	3	157437072	A	G
rs2736100	18835860	7015	TERT	umls:C1800706	GAD	[A genome-wide association study identifies an association of a common variant in TERT with susceptibility to idiopathic pulmonary fibrosis.]	0.49298306	2008	TERT	5	1286401	C	A
rs2736100	24434656	7015	TERT	umls:C1800706	BeFree	Associations between 2 polymorphisms in TERT (rs2736100) and MUC5B (rs35705950) and IPF or non-IPF sporadic ILD were tested using 227 patients with ILD and 689 control subjects.	0.49298306	2013	TERT	5	1286401	C	A
rs2736100	24434656	727897	MUC5B	umls:C1800706	BeFree	Associations between 2 polymorphisms in TERT (rs2736100) and MUC5B (rs35705950) and IPF or non-IPF sporadic ILD were tested using 227 patients with ILD and 689 control subjects.	0.36434307	2013	TERT	5	1286401	C	A
rs2736100	18835860	7015	TERT	umls:C1800706	GWASCAT	A genome-wide association study identifies an association of a common variant in TERT with susceptibility to idiopathic pulmonary fibrosis.	0.49298306	2008	TERT	5	1286401	C	A
rs35705950	24434656	727897	MUC5B	umls:C1800706	BeFree	Associations between 2 polymorphisms in TERT (rs2736100) and MUC5B (rs35705950) and IPF or non-IPF sporadic ILD were tested using 227 patients with ILD and 689 control subjects.	0.36434307	2013	NA	11	1219991	G	A,T
rs35705950	25184687	727897	MUC5B	umls:C1800706	BeFree	Baseline bacterial burden predicted the rate of decline in lung volume and risk of death and associated independently with the rs35705950 polymorphism of the MUC5B mucin gene, a proven host susceptibility factor for IPF.	0.36434307	2014	NA	11	1219991	G	A,T
rs35705950	NA	727897	MUC5B	umls:C1800706	CLINVAR	NA	0.36434307	NA	NA	11	1219991	G	A,T
rs35705950	24434656	7015	TERT	umls:C1800706	BeFree	Associations between 2 polymorphisms in TERT (rs2736100) and MUC5B (rs35705950) and IPF or non-IPF sporadic ILD were tested using 227 patients with ILD and 689 control subjects.	0.49298306	2013	NA	11	1219991	G	A,T
rs35705950	26512610	727897	MUC5B	umls:C1800706	BeFree	Association Between the MUC5B Promoter Polymorphism rs35705950 and Idiopathic Pulmonary Fibrosis: A Meta-analysis and Trial Sequential Analysis in Caucasian and Asian Populations.	0.36434307	2016	NA	11	1219991	G	A,T
rs35705950	25926289	727897	MUC5B	umls:C1800706	BeFree	A meta-analysis examining the association between the MUC5B rs35705950 T/G polymorphism and susceptibility to idiopathic pulmonary fibrosis.	0.36434307	2015	NA	11	1219991	G	A,T
rs35705950	23692170	727897	MUC5B	umls:C1800706	BeFree	A common promoter polymorphism (rs35705950) in MUC5B, the gene encoding mucin 5B, is associated with idiopathic pulmonary fibrosis.	0.36434307	2013	NA	11	1219991	G	A,T
rs386586050	24070541	7098	TLR3	umls:C1800706	BeFree	The Toll-like receptor 3 L412F polymorphism and disease progression in idiopathic pulmonary fibrosis.	0.000814326	2014	NA	NA	NA	NA	NA
rs387907247	NA	7015	TERT	umls:C1800706	CLINVAR	NA	0.49298306	NA	TERT	5	1294826	A	T
rs397728201	22884059	653509	SFTPA1	umls:C1800706	BeFree	In particular, while pathophysiological mechanisms need to be illustrated, the Gln238Lys missense variant of exon 6 in the SFTPA1 may have potential susceptibility in the development of IPF, which was shown in patients with sporadic IPF with a statistically higher frequency.	0.240814326	2012	SFTPA1	10	79614033	C	A
rs4073	21649933	3576	CXCL8	umls:C1800706	BeFree	A promoter SNP rs4073T>A in the common allele of the interleukin 8 gene is associated with the development of idiopathic pulmonary fibrosis via the IL-8 protein enhancing mode.	0.001628651	2011	CXCL8	4	73740307	A	T
rs5743890	24429156	54472	TOLLIP	umls:C1800706	GWASCAT	These associations and the reduced expression of TOLLIP in patients with IPF who carry TOLLIP SNPs emphasise the importance of this gene in the disease.	0.120542884	2014	TOLLIP	11	1304599	T	C
rs5743894	24429156	54472	TOLLIP	umls:C1800706	GWASCAT	These associations and the reduced expression of TOLLIP in patients with IPF who carry TOLLIP SNPs emphasise the importance of this gene in the disease.	0.120542884	2014	TOLLIP;LOC105376512	11	1303542	T	C,A
rs733590	22291954	5063	PAK3	umls:C1800706	BeFree	Rs2395655 and rs733590, in CDKN1A, were associated with an increased risk of developing IPF.	0.000271442	2012	CDKN1A;LOC105375039	6	36677426	T	C

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:7)
CHR	POS	SNPID	REF	ALT	ORI_SNPID	PMID	P_VALUE	P_VALUE_TEXT	OR/BETA	CI95_TEXT	GWAS_INITIAL_SAMPLE_SIZE	SUB_POPULATION	SUPER_POPULATION	GWAS_TRAIT	HPO_ID	HPO_TERM	DO_ID	DO_TERM	MESH_ID	MESH_TERM	EFO_ID	EFO_TERM	DOLITE_TERM	RISK_ALLELE	PUBLICATION_TYPE	AA	GENE_SYMBOL	TYPE	REFGENE
5	1286516	rs2736100	C	A	rs2736100	18835860	3.00E-08		2.11	[1.61-2.78]	159 Japanese ancestry cases; 934 Japanese ancestry controls	Japanese(1093)	ALL(1093)	ASN(1093)	ALL(1093)	Idiopathic pulmonary fibrosis	HPOID:0002206	Pulmonary fibrosis	DOID:0050156	idiopathic pulmonary fibrosis	D054990	Idiopathic Pulmonary Fibrosis	EFOID:0000768	idiopathic pulmonary fibrosis	Pulmonary fibrosis	rs2736100-A	NA	T	TERT
11	1241221	rs35705950	G	A,T	rs35705950	24429156	2.00E-50	NA	2.43	[2.13-2.77]	542 European ancestry cases; 542 European ancestry controls	European(1084)	ALL(1084)	EUR(1084)	ALL(1084)	Idiopathic pulmonary fibrosis	HPOID:0002206	Pulmonary fibrosis	DOID:0050156	idiopathic pulmonary fibrosis	D054990	Idiopathic Pulmonary Fibrosis	EFOID:0000768	idiopathic pulmonary fibrosis	Pulmonary fibrosis	rs35705950-T	Multicenter Study	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't
11	1312706	rs111521887	C	G	rs111521887	24429156	2.20E-12	NA	1.48	[1.32-1.66]	542 European ancestry cases; 542 European ancestry controls	European(1084)	ALL(1084)	EUR(1084)	ALL(1084)	Idiopathic pulmonary fibrosis	HPOID:0002206	Pulmonary fibrosis	DOID:0050156	idiopathic pulmonary fibrosis	D054990	Idiopathic Pulmonary Fibrosis	EFOID:0000768	idiopathic pulmonary fibrosis	Pulmonary fibrosis	rs111521887-G	Multicenter Study	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't
11	1324772	rs5743894	T	C	rs5743894	24429156	1.00E-12	NA	1.49	[1.33-1.68]	542 European ancestry cases; 542 European ancestry controls	European(1084)	ALL(1084)	EUR(1084)	ALL(1084)	Idiopathic pulmonary fibrosis	HPOID:0002206	Pulmonary fibrosis	DOID:0050156	idiopathic pulmonary fibrosis	D054990	Idiopathic Pulmonary Fibrosis	EFOID:0000768	idiopathic pulmonary fibrosis	Pulmonary fibrosis	rs5743894-G	Multicenter Study	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't
11	1325829	rs5743890	T	C	rs5743890	24429156	3.00E-11	NA	1.64	[1.41-1.92]	542 European ancestry cases; 542 European ancestry controls	European(1084)	ALL(1084)	EUR(1084)	ALL(1084)	Idiopathic pulmonary fibrosis	HPOID:0002206	Pulmonary fibrosis	DOID:0050156	idiopathic pulmonary fibrosis	D054990	Idiopathic Pulmonary Fibrosis	EFOID:0000768	idiopathic pulmonary fibrosis	Pulmonary fibrosis	rs5743890-A	Multicenter Study	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't
14	48040375	rs7144383	G	A	rs7144383	24429156	4.00E-06	NA	1.44	[1.23-1.69]	542 European ancestry cases; 542 European ancestry controls	European(1084)	ALL(1084)	EUR(1084)	ALL(1084)	Idiopathic pulmonary fibrosis	HPOID:0002206	Pulmonary fibrosis	DOID:0050156	idiopathic pulmonary fibrosis	D054990	Idiopathic Pulmonary Fibrosis	EFOID:0000768	idiopathic pulmonary fibrosis	Pulmonary fibrosis	rs7144383-G	Multicenter Study	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't
17	43925297	rs17690703	C	T	rs17690703	24429156	6.00E-09	NA	1.43	[1.27-1.61]	542 European ancestry cases; 542 European ancestry controls	European(1084)	ALL(1084)	EUR(1084)	ALL(1084)	Idiopathic pulmonary fibrosis	HPOID:0002206	Pulmonary fibrosis	DOID:0050156	idiopathic pulmonary fibrosis	D054990	Idiopathic Pulmonary Fibrosis	EFOID:0000768	idiopathic pulmonary fibrosis	Pulmonary fibrosis	rs17690703-C	Multicenter Study	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:0)
(Waiting for update.)

Disease ID	97
Disease	idiopathic pulmonary fibrosis
Case	(Waiting for update.)