| hypokalemic periodic paralysis | ||||
| Disease ID | 170 |
|---|---|
| Disease | hypokalemic periodic paralysis |
| Definition | An autosomal dominant familial disorder characterized by recurrent episodes of skeletal muscle weakness associated with falls in serum potassium levels. The condition usually presents in the first or second decade of life with attacks of trunk and leg paresis during sleep or shortly after awakening. Symptoms may persist for hours to days and generally are precipitated by exercise or a meal high in carbohydrates. (Adams et al., Principles of Neurology, 6th ed, p1483) |
| Synonym | familial hypokalaemic periodic paralysis familial hypokalemic periodic paralysis familial hypokalemic periodic paralysis (disorder) familial periodic paralysis (& [hypokalaemic]) familial periodic paralysis (& [hypokalaemic]) (disorder) familial periodic paralysis (& [hypokalemic]) familial periodic paralysis familial periodic paralysis hypokalemic form hokpp hypokalaemic paralysis periodic hypokalaemic periodic paralysis hypokalemic familial periodic paralysis hypokalemic paralysis periodic hypokalemic periodic paralysis (disorder) hypokalemic periodic paralysis [disease/finding] hypokalemic periodic paralysis, familial hypokpp hypopp paralysis, hypokalemic periodic periodic hypokalaemic paralysis periodic hypokalemic paralysis periodic paralysis hypokalemic periodic paralysis i periodic paralysis, hypokalemic periodic paralysis- hypokalemic periodic paralysis- hypokalemics primary hypokalemic periodic paralysis westphall disease |
| Orphanet | |
| OMIM | |
| DOID | |
| UMLS | C0238358 |
| MeSH | |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:9) C1527336 | sjogren's syndrome | 2 C0020676 | hypothyroidism | 2 C0020550 | hyperthyroidism | 1 C0001126 | renal tubular acidosis | 1 C0007570 | celiac disease | 1 C0040156 | thyrotoxicosis | 1 C0014544 | epilepsy | 1 C0026848 | myopathy | 1 C0030443 | periodic paralysis | 1 |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:3) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:30) 488 | ATP2A2 | 1.2 | DISEASES 56244 | BTNL2 | 1.811 | DISEASES 778 | CACNA1F | 1.79 | DISEASES 779 | CACNA1S | 8.113 | DISEASES 785 | CACNB4 | 2.574 | DISEASES 1180 | CLCN1 | 4.473 | DISEASES 7555 | CNBP | 1.223 | DISEASES 1760 | DMPK | 1.257 | DISEASES 1798 | DPAGT1 | 1.606 | DISEASES 2512 | FTL | 1.728 | DISEASES 2705 | GJB1 | 1.164 | DISEASES 3753 | KCNE1 | 1.194 | DISEASES 3758 | KCNJ1 | 1.578 | DISEASES 3767 | KCNJ11 | 1.301 | DISEASES 3768 | KCNJ12 | 3.669 | DISEASES 3778 | KCNMA1 | 1.264 | DISEASES 3786 | KCNQ3 | 1.849 | DISEASES 56479 | KCNQ5 | 2.485 | DISEASES 3932 | LCK | 1.094 | DISEASES 4038 | LRP4 | 2.119 | DISEASES 27445 | PCLO | 1.888 | DISEASES 6261 | RYR1 | 3.546 | DISEASES 6329 | SCN4A | 7.387 | DISEASES 123228 | SENP8 | 2.279 | DISEASES 6557 | SLC12A1 | 1.534 | DISEASES 6559 | SLC12A3 | 2.082 | DISEASES 6597 | SMARCA4 | 1.173 | DISEASES 29110 | TBK1 | 1.511 | DISEASES 7068 | THRB | 1.269 | DISEASES 10345 | TRDN | 2.141 | DISEASES |
| Locus | Symbol | Locus(Total Locus:3) |
| Disease ID | 170 |
|---|---|
| Disease | hypokalemic periodic paralysis |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:16) HP:0003470 | Paralysis HP:0008256 | Adrenocortical adenoma HP:0030196 | Fatigable weakness of respiratory muscles HP:0004303 | Abnormality of muscle fibers HP:0011998 | Postprandial hyperglycemia HP:0003694 | Late-onset proximal muscle weakness HP:0003457 | EMG abnormality HP:0002203 | Respiratory paralysis HP:0003752 | Episodic flaccid weakness HP:0012240 | Increased intramyocellular lipid droplets HP:0006670 | Impaired myocardial contractility HP:0012726 | Episodic hypokalemia HP:0008180 | Mildly elevated creatine phosphokinase HP:0002486 | Myotonia HP:0008153 | Periodic hypokalemic paresis HP:0009020 | Exercise-induced muscle fatigue |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:11) HP:0000969 | Dropsy | 2 HP:0000836 | Overactive thyroid | 2 HP:0002900 | Hypokalemia | 2 HP:0000821 | Underactive thyroid | 2 HP:0003470 | Inability to move | 2 HP:0001999 | Facial dysmorphism | 1 HP:0003768 | Periodic paralysis | 1 HP:0002608 | Celiac disease | 1 HP:0003198 | Myopathic changes | 1 HP:0001947 | Renal tubular acidosis | 1 HP:0011675 | Arrhythmias | 1 |
| Disease ID | 170 |
|---|---|
| Disease | hypokalemic periodic paralysis |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:9) |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:4) C0020676 | hypothyroidism | 1 C0014548 | generalized epilepsy | 1 C0026848 | myopathy | 1 C0004093 | weakness | 1 |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:22) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs121908552 | 25839108 | 6329 | SCN4A | umls:C0238358 | BeFree | As a result, heterozygous mutations c.2024G>A (R675Q) and c.1333G>A (V445M) of gene SCN4A were identified in the hypokalemic periodic paralysis patient and the paramyotonia congenita family respectively. | 0.251691864 | 2016 | SCN4A;LOC105371858 | 17 | 63964587 | C | T |
| rs121908557 | 25839108 | 6329 | SCN4A | umls:C0238358 | BeFree | As a result, heterozygous mutations c.2024G>A (R675Q) and c.1333G>A (V445M) of gene SCN4A were identified in the hypokalemic periodic paralysis patient and the paramyotonia congenita family respectively. | 0.251691864 | 2016 | SCN4A | 17 | 63957514 | C | T |
| rs28930068 | 17418573 | 779 | CACNA1S | umls:C0238358 | BeFree | Hypokalaemic periodic paralysis due to the CACNA1S R1239H mutation in a large African family. | 0.259302167 | 2007 | CACNA1S | 1 | 201053538 | C | T |
| rs28930069 | 18229654 | 779 | CACNA1S | umls:C0238358 | BeFree | Myopathy as the first symptom of hypokalemic periodic paralysis--case report of a girl from a Polish family with CACNA1S (R1239G) mutation. | 0.259302167 | 2007 | CACNA1S | 1 | 201053539 | G | C |
| rs80338777 | 8845715 | 779 | CACNA1S | umls:C0238358 | BeFree | In three families with hypokalemic periodic paralysis (HOPP) we have confirmed the presence of a missense mutation (arginine 528 to histidine) within the gene CACNL1A3 encoding the alpha 1 subunit of the L-type, voltage-sensitive calcium channel. | 0.259302167 | 1996 | CACNA1S | 1 | 201077915 | C | T |
| rs80338777 | 25088161 | 6329 | SCN4A | umls:C0238358 | BeFree | Cases were confirmed genetically (13 with an R528H mutation in CACNA1S, 1 an R669H mutation in SCN4A) or had a convincing clinical diagnosis of HypoPP (13 genetically undetermined) if reported prior to the availability of genetic testing. | 0.251691864 | 2014 | CACNA1S | 1 | 201077915 | C | T |
| rs80338777 | 25088161 | 779 | CACNA1S | umls:C0238358 | BeFree | Cases were confirmed genetically (13 with an R528H mutation in CACNA1S, 1 an R669H mutation in SCN4A) or had a convincing clinical diagnosis of HypoPP (13 genetically undetermined) if reported prior to the availability of genetic testing. | 0.259302167 | 2014 | CACNA1S | 1 | 201077915 | C | T |
| rs80338777 | 11034874 | 779 | CACNA1S | umls:C0238358 | BeFree | Our study identified an Arg528His CACNL1A3 mutation in patients with hypoPP, and excluded this mutation as the cause of tremor or epilepsy in this kindred. | 0.259302167 | 2000 | CACNA1S | 1 | 201077915 | C | T |
| rs80338777 | 8845715 | 146 | ADRA1D | umls:C0238358 | BeFree | In three families with hypokalemic periodic paralysis (HOPP) we have confirmed the presence of a missense mutation (arginine 528 to histidine) within the gene CACNL1A3 encoding the alpha 1 subunit of the L-type, voltage-sensitive calcium channel. | 0.002714419 | 1996 | CACNA1S | 1 | 201077915 | C | T |
| rs80338777 | 11328898 | 779 | CACNA1S | umls:C0238358 | BeFree | Arg528His mutations of CACNA1S, including de novo Arg528His mutations, were found in Korean patients with hypoPP. | 0.259302167 | 2001 | CACNA1S | 1 | 201077915 | C | T |
| rs80338777 | 17587224 | 779 | CACNA1S | umls:C0238358 | BeFree | The calcium channel gene CACNA1S showed a mutation encoding p.R528H, which has been related previously to HypoPP. | 0.259302167 | 2008 | CACNA1S | 1 | 201077915 | C | T |
| rs80338778 | 19822448 | 779 | CACNA1S | umls:C0238358 | BeFree | Severe respiratory phenotype caused by a de novo Arg528Gly mutation in the CACNA1S gene in a patient with hypokalemic periodic paralysis. | 0.259302167 | 2010 | CACNA1S | 1 | 201077916 | G | C,A |
| rs80338784 | 23187123 | 6329 | SCN4A | umls:C0238358 | BeFree | Fibers from the Ca(V)1.1 R528H mouse had a small anomalous inward current at the resting potential, similar to our observations in the Na(V)1.4 R669H HypoPP mouse model. | 0.251691864 | 2012 | SCN4A;LOC105371858 | 17 | 63959278 | C | T |
| rs80338784 | 11912116 | 6329 | SCN4A | umls:C0238358 | BeFree | In addition, several mutations (Arg669His, Arg672His, Arg672Gly and Arg672Ser) in the voltage sensor of the skeletal muscle sodium channel alpha-subunit (SCN4A gene) have been found in families with hypoPP (type II). | 0.251691864 | 2002 | SCN4A;LOC105371858 | 17 | 63959278 | C | T |
| rs80338784 | 25088161 | 779 | CACNA1S | umls:C0238358 | BeFree | Cases were confirmed genetically (13 with an R528H mutation in CACNA1S, 1 an R669H mutation in SCN4A) or had a convincing clinical diagnosis of HypoPP (13 genetically undetermined) if reported prior to the availability of genetic testing. | 0.259302167 | 2014 | SCN4A;LOC105371858 | 17 | 63959278 | C | T |
| rs80338784 | 21881211 | 6329 | SCN4A | umls:C0238358 | BeFree | A sodium channel knockin mutant (NaV1.4-R669H) mouse model of hypokalemic periodic paralysis. | 0.251691864 | 2011 | SCN4A;LOC105371858 | 17 | 63959278 | C | T |
| rs80338784 | 25088161 | 6329 | SCN4A | umls:C0238358 | BeFree | Cases were confirmed genetically (13 with an R528H mutation in CACNA1S, 1 an R669H mutation in SCN4A) or had a convincing clinical diagnosis of HypoPP (13 genetically undetermined) if reported prior to the availability of genetic testing. | 0.251691864 | 2014 | SCN4A;LOC105371858 | 17 | 63959278 | C | T |
| rs80338784 | 17591984 | 6329 | SCN4A | umls:C0238358 | BeFree | We tested the rat isoform of NaV1.4 harboring the HypoPP mutation R663H (human R669H ortholog) at the outermost arginine of S4 in domain II for a gating-pore conductance. | 0.251691864 | 2007 | SCN4A;LOC105371858 | 17 | 63959278 | C | T |
| rs80338785 | 11912116 | 6329 | SCN4A | umls:C0238358 | BeFree | In addition, several mutations (Arg669His, Arg672His, Arg672Gly and Arg672Ser) in the voltage sensor of the skeletal muscle sodium channel alpha-subunit (SCN4A gene) have been found in families with hypoPP (type II). | 0.251691864 | 2002 | SCN4A;LOC105371858 | 17 | 63959270 | G | T,C,A |
| rs80338788 | 11912116 | 6329 | SCN4A | umls:C0238358 | BeFree | In addition, several mutations (Arg669His, Arg672His, Arg672Gly and Arg672Ser) in the voltage sensor of the skeletal muscle sodium channel alpha-subunit (SCN4A gene) have been found in families with hypoPP (type II). | 0.251691864 | 2002 | SCN4A;LOC105371858 | 17 | 63959269 | C | T,A |
| rs80338788 | 15072700 | 146 | ADRA1D | umls:C0238358 | BeFree | The clinical features of TPP resemble familial hypokalemic periodic paralysis (hypoKPP), which has been linked to two mutations in the gene encoding the skeletal muscle calcium channel alpha-1 subunit (CACN1AS; Arg528His and Arg1239His) and to the sodium channel alpha-subunit (SCN4A; Arg672His). | 0.002714419 | 2004 | SCN4A;LOC105371858 | 17 | 63959269 | C | T,A |
| rs80338788 | 21043388 | 6329 | SCN4A | umls:C0238358 | BeFree | Hypokalemic periodic paralysis due to the SCN4A R672H mutation in a Turkish family. | 0.251691864 | 2010 | SCN4A;LOC105371858 | 17 | 63959269 | C | T,A |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:30) | |||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CHR | POS | SNPID | REF | ALT | ORI_SNPID | PMID | P_VALUE | P_VALUE_TEXT | OR/BETA | CI95_TEXT | GWAS_INITIAL_SAMPLE_SIZE | SUB_POPULATION | SUPER_POPULATION | GWAS_TRAIT | HPO_ID | HPO_TERM | DO_ID | DO_TERM | MESH_ID | MESH_TERM | EFO_ID | EFO_TERM | DOLITE_TERM | RISK_ALLELE | PUBLICATION_TYPE | AA | GENE_SYMBOL | TYPE | REFGENE |
| 17 | 68258208 | rs992072 | G | T | rs992072 | 22399142 | 2.11E-07 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68259446 | rs623011 | A | G | rs623011 | 22399142 | 4.00E-12 | NA | 5.47 | [3.04-9.83] | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | rs623011-A | Research Support, Non-U.S. Gov't |
| 17 | 68260070 | rs9913349 | C | T | rs9913349 | 22399142 | 3.90E-07 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68260716 | rs11077484 | G | A | rs11077484 | 22399142 | 6.79E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68264096 | rs236511 | G | C | rs236511 | 22399142 | 2.98E-07 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68264545 | rs4968887 | C | T | rs4968887 | 22399142 | 1.15E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68264797 | rs2529681 | T | G | rs2529681 | 22399142 | 2.98E-07 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68267024 | rs236500 | T | A | rs236500 | 22399142 | 8.30E-07 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68267733 | rs12453584 | G | A | rs12453584 | 22399142 | 2.25E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68269712 | rs376627483 | CAAAATACATAATTTAAGATTT | C | rs7223705 | 22399142 | 1.85E-07 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68269712 | rs7223705 | C | A | rs7223705 | 22399142 | 1.85E-07 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68270955 | rs1399185 | G | T | rs1399185 | 22399142 | 8.30E-07 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68271045 | rs1355915 | G | C | rs1355915 | 22399142 | 8.30E-07 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68272060 | rs8075271 | G | A | rs8075271 | 22399142 | 3.03E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68272078 | rs8076950 | A | C | rs8076950 | 22399142 | 3.03E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68272354 | rs17714860 | G | A | rs17714860 | 22399142 | 4.76E-05 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68273753 | rs11650230 | C | T | rs11650230 | 22399142 | 3.03E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68275724 | rs8074548 | C | T | rs8074548 | 22399142 | 2.75E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68279437 | rs2215027 | G | A | rs2215027 | 22399142 | 8.67E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68282166 | rs8068647 | T | A | rs8068647 | 22399142 | 2.25E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68286268 | rs4968890 | C | T | rs4968890 | 22399142 | 3.03E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68290082 | rs11077488 | C | T | rs11077488 | 22399142 | 1.68E-05 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68299785 | rs7222503 | G | T | rs7222503 | 22399142 | 6.35E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68303286 | rs7225313 | C | A | rs7225313 | 22399142 | 6.35E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68315648 | rs17715938 | T | C | rs17715938 | 22399142 | 5.18E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68316459 | rs16975551 | C | T | rs16975551 | 22399142 | 2.75E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68316678 | rs11653587 | G | A | rs11653587 | 22399142 | 2.75E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68325868 | rs10775360 | C | T | rs10775360 | 22399142 | 1.00E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
| 17 | 68326338 | rs312691 | T | C | rs312691 | 22863731 | 8.00E-14 | NA | 3.2 | [2.40-4.40] | 69 Chinese ancestry cases; 775 HongKong Chinese controls; 395 Taiwanese controls | Chinese(69) | Taiwanese(395) | HongKong Chinese(775) | ALL(1239) | ASN(1239) | ALL(1239) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease |
| 17 | 68337964 | rs10512574 | T | C | rs10512574 | 22399142 | 2.21E-04 | NA | NA | NA | 78 Thai ancestry cases; 74 Thai ancestry controls | Thai(152) | ALL(152) | ASN(152) | ALL(152) | Thyrotoxic hypokalemic periodic paralysis | HPOID:0003768 | HPOID:0000836 | Periodic paralysis | Hyperthyroidism | DOID:14452 | hypokalemic periodic paralysis | D020514 | Hypokalemic Periodic Paralysis | thyrotoxic periodic paralysis | Myopathy | Metabolism disease | NA | Research Support, Non-U.S. Gov't |
Mapped by lexical matching(Total Items:6) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0008256 | Adrenocortical adenoma | MP:0013383 | increased sebaceous gland adenoma incidence | greater than the expected number of a benign epithelial neoplasm with a glandular organization arising in any sebaceous gland, occurring in a specific population in a given time period |
| HP:0003752 | Episodic flaccid weakness | MP:0000747 | muscle weakness | loss of muscle strength |
| HP:0011998 | Postprandial hyperglycemia | MP:0001559 | hyperglycemia | abnormally high concentration of glucose in the blood; generally refers to a pathological state |
| HP:0006670 | Impaired myocardial contractility | MP:0006085 | myocardial necrosis | morphological changes resulting from pathological death of myocardial tissue; usually due to irreversible damage |
| HP:0003694 | Late-onset proximal muscle weakness | MP:0000748 | progressive muscle weakness | increasing loss of muscle strength over time |
| HP:0008180 | Mildly elevated creatine phosphokinase | MP:0010090 | increased circulating creatine kinase level | an elevation in the concentration in the blood of an enzyme that catalyzes the reversible transfer of creatine to phosphocreatine |
Mapped by homologous gene(Total Items:13) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0003752 | Episodic flaccid weakness | MP:0011967 | increased or absent threshold for auditory brainstem response | increase in the value at which one or more sound frequencies or broadband clicks first elicits a recordable response generated by electrical activity of neurons in the ascending auditory system, or complete lack of a recordable response at any frequency o |
| HP:0002486 | Myotonia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0003457 | EMG abnormality | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0003694 | Late-onset proximal muscle weakness | MP:0012106 | impaired exercise endurance | impaired performance during controlled physical activity |
| HP:0011998 | Postprandial hyperglycemia | MP:0011085 | postnatal lethality, complete penetrance | premature death anytime between the neonatal period and weaning age of all organisms of a given genotype in a population (Mus: P1 to approximately 3 weeks of age) |
| HP:0012240 | Increased intramyocellular lipid droplets | MP:0013405 | increased circulating lactate level | greater amount of lactate in the blood which is produced from pyruvate by lactate dehydrogenase |
| HP:0008153 | Periodic hypokalemic paresis | MP:0012551 | metabolic acidosis | decreased pH and bicarbonate concentration in tissues and/or body fluids caused when the body produces too much acid or when the kidneys are not removing enough acid from the body, as in diarrhea or in kidney disease |
| HP:0003470 | Paralysis | MP:0013659 | abnormal erythroid lineage cell morphology | any structural anomaly of an immature or mature cell in the lineage leading to and including erythrocytes |
| HP:0006670 | Impaired myocardial contractility | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0002203 | Respiratory paralysis | MP:0011414 | erythruria | passage of red colored urine |
| HP:0008256 | Adrenocortical adenoma | MP:0013602 | abnormal Leydig cell differentiation | atypical formation of or inability to produce the interstitial cells that are found adjacent to the seminiferous tubules in the testicle and produce testosterone in the presence of luteinizing hormone; in most mammals, normal Leydig cell (LC) development |
| HP:0008180 | Mildly elevated creatine phosphokinase | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0009020 | Exercise-induced muscle fatigue | MP:0011940 | decreased food intake | reduction in the total number of calories/food amount taken in over time when compared to the normal state |
| Disease ID | 170 |
|---|---|
| Disease | hypokalemic periodic paralysis |
| Case | (Waiting for update.) |