| hyperlipoproteinemia type iii | ||||
| Disease ID | 1088 |
|---|---|
| Disease | hyperlipoproteinemia type iii |
| Definition | An autosomal recessively inherited disorder characterized by the accumulation of intermediate-density lipoprotein (IDL or broad-beta-lipoprotein). IDL has a CHOLESTEROL to TRIGLYCERIDES ratio greater than that of VERY-LOW-DENSITY LIPOPROTEINS. This disorder is due to mutation of APOLIPOPROTEINS E, a receptor-binding component of VLDL and CHYLOMICRONS, resulting in their reduced clearance and high plasma levels of both cholesterol and triglycerides. |
| Synonym | apolipoprotein e deficiency broad beta dis broad beta disease broad-beta disease broad-beta hyperlipoproteinemia carbohydrate hyperlipemia induced carbohydrate induced hyperlipaemia carbohydrate induced hyperlipemia dysbetalipoproteinaemia dysbetalipoproteinemia dysbetalipoproteinemia, familial familial dysbetalipoproteinaemia familial dysbetalipoproteinemia familial hyperbetalipoproteinaemia and hyperprebetalipoproteinaemia familial hyperbetalipoproteinemia and hyperprebetalipoproteinemia familial hypercholesterolaemia with hyperlipaemia familial hypercholesterolemia with hyperlipemia familial hyperlipoproteinemia type iii familial type 3 hyperlipoproteinaemia familial type 3 hyperlipoproteinemia familial type 3 hyperlipoproteinemia (disorder) familial type iii hyperlipoproteinaemia familial type iii hyperlipoproteinemia floating beta disease fredrickson type iii hyperlipoproteinaemia fredrickson type iii hyperlipoproteinemia hyperlipidemia type iii hyperlipoproteinemia type 03 hyperlipoproteinemia type iii [disease/finding] hyperlipoproteinemia, broad beta hyperlipoproteinemia, broad-beta hyperlipoproteinemia, type iii hyperlipoproteinemias, type iii primary dysbetalipoproteinaemia primary dysbetalipoproteinemia remnant hyperlipidaemia remnant hyperlipidemia remnant hyperlipoproteinaemia remnant hyperlipoproteinemia type iii hyperlipidemia type iii hyperlipoproteinemia type iii hyperlipoproteinemias |
| Orphanet | |
| DOID | |
| UMLS | C0020479 |
| MeSH | |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:3) |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:2) |
| Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:4) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:3) |
| Locus | (Waiting for update.) |
| Disease ID | 1088 |
|---|---|
| Disease | hyperlipoproteinemia type iii |
| Integrated Phenotype | (Waiting for update.) |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:3) |
| Disease ID | 1088 |
|---|---|
| Disease | hyperlipoproteinemia type iii |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:1) C0302314 | xanthomas |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:1) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:16) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs121918393 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44908756 | C | A,T |
| rs121918394 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44908786 | A | C,G |
| rs121918396 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44908979 | G | A |
| rs121918397 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44908784 | G | A,C |
| rs140808909 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44909080 | G | A |
| rs190853081 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44909083 | G | A |
| rs199768005 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44909057 | T | A |
| rs201672011 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44907807 | G | A |
| rs267606661 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44909101 | C | G,T |
| rs267606663 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44909021 | G | A,C |
| rs387906567 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44908774 | C | T |
| rs397514253 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44908531 | A | G |
| rs397514254 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44908731 | - | GAGGTGCAGGCCATGCTCGGC |
| rs429358 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44908684 | T | C |
| rs7412 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44908822 | C | T |
| rs769455 | NA | 348 | APOE | umls:C0020479 | CLINVAR | NA | 0.391031588 | NA | APOE | 19 | 44908783 | C | T |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:0) |
|---|
| (Waiting for update.) |
Mapped by homologous gene(Total Items:0) |
|---|
| (Waiting for update.) |
| Disease ID | 1088 |
|---|---|
| Disease | hyperlipoproteinemia type iii |
| Case | (Waiting for update.) |