| hereditary hyperuricemia | ||||
| Disease ID | 648 |
|---|---|
| Disease | hereditary hyperuricemia |
| Definition | An inherited disorder transmitted as a sex-linked trait and caused by a deficiency of an enzyme of purine metabolism; HYPOXANTHINE PHOSPHORIBOSYLTRANSFERASE. Affected individuals are normal in the first year of life and then develop psychomotor retardation, extrapyramidal movement disorders, progressive spasticity, and seizures. Self-destructive behaviors such as biting of fingers and lips are seen frequently. Intellectual impairment may also occur but is typically not severe. Elevation of uric acid in the serum leads to the development of renal calculi and gouty arthritis. (Menkes, Textbook of Child Neurology, 5th ed, pp127) |
| Synonym | choreoathetosis self mutilation hyperuricemia syndrome choreoathetosis self mutilation syndrome choreoathetosis self-mutilation hyperuricemia syndrome choreoathetosis self-mutilation syndrome choreoathetosis self-mutilation syndromes complete hgprt defic dis complete hgprt deficiency complete hgprt deficiency disease complete hprt deficiencies complete hprt deficiency complete hypoxanthine guanine phosphoribosyltransferase deficiency complete hypoxanthine-guanine phosphoribosyltransferase deficiency complete hypoxanthine-guanine phosphoribosyltransferase deficiency (disorder) defic dis complete hgprt defic dis hypoxanthine phosphoribosyl transferase deficiencies, complete hprt deficiencies, hgprt deficiencies, hypoxanthine phosphoribosyltransferase deficiencies, total hprt deficiency disease, complete hgprt deficiency disease, hypoxanthine phosphoribosyl transferase deficiency disease, hypoxanthine-phosphoribosyl-transferase deficiency diseases, hypoxanthine-phosphoribosyl-transferase deficiency of guanine phosphoribosyltransferase deficiency of hypoxanthine phosphoribosyltransferase deficiency of hypoxanthine phosphoribosyltransferase (disorder) deficiency of hypoxanthine-guanine phosphoribosyltransferase deficiency of imp pyrophosphorylase deficiency, complete hprt deficiency, hgprt deficiency, hypoxanthine phosphoribosyltransferase deficiency, total hprt guanine phosphoribosyltransferase deficiencies guanine phosphoribosyltransferase deficiency hg-prt deficiency hgprt defic dis complete hgprt deficiencies hgprt deficiency hgprt deficiency disease, complete hprt - hypoxanthine-guanine phosphoribosyltransferase deficiency hprt deficiencies, complete hprt deficiencies, total hprt deficiency hprt deficiency, complete hprt deficiency, total hprt1 deficiency hyperuricemia syndrome, juvenile hyperuricemia syndrome, primary hyperuricemia syndromes, juvenile hyperuricemia syndromes, primary hyperuricemia, choreoathetosis, self-mutilation syndrome hyperuricemia, x-linked hyperuricemia, x-linked primary hyperuricemias, x-linked hyperuricemias, x-linked primary hypoxanthine guanine phosphoribosyltransferase 1 deficiency hypoxanthine guanine phosphoribosyltransferase deficiency hypoxanthine phosphoribosyl transferase defic dis hypoxanthine phosphoribosyl transferase deficiency disease hypoxanthine phosphoribosyltransferase deficiencies hypoxanthine phosphoribosyltransferase deficiency hypoxanthine-guanine phosphoribosyltransferase deficiency hypoxanthine-guanine phosphoribosyltransferase deficiency (disorder) hypoxanthine-guanine phosphoribosyltransferase deficiency (disorder) [ambiguous] hypoxanthine-guanine phosphoribosyltransferase deficiency, nos hypoxanthine-guanine-phosphoribosyltransferase deficiency hypoxanthine-guanine-phosphoribosyltransferase deficiency (& [lesch - nyhan syndrome]) hypoxanthine-guanine-phosphoribosyltransferase deficiency (& [lesch - nyhan syndrome]) (disorder) hypoxanthine-phosphoribosyl-transferase deficiency disease hypoxanthine-phosphoribosyl-transferase deficiency diseases juvenile gout, choreoathetosis, mental retardation syndrome juvenile hyperuricemia syndrome juvenile hyperuricemia syndromes lesch - nyhan syndrome lesch nyhan dis lesch nyhan disease lesch nyhan syndrome lesch-nyhan disease lesch-nyhan syndrome lesch-nyhan syndrome (disorder) lesch-nyhan syndrome [disease/finding] lns nyhan syndrome nyhans syndrome phosphoribosyltransferase deficiencies, guanine phosphoribosyltransferase deficiencies, hypoxanthine phosphoribosyltransferase deficiency, guanine phosphoribosyltransferase deficiency, hypoxanthine primary hyperuricemia syndrome primary hyperuricemia syndromes primary hyperuricemia, x-linked primary hyperuricemias, x-linked self-mutilation syndrome, choreoathetosis self-mutilation syndromes, choreoathetosis syndrome, choreoathetosis self-mutilation syndrome, juvenile hyperuricemia syndrome, primary hyperuricemia syndromes, choreoathetosis self-mutilation syndromes, juvenile hyperuricemia syndromes, primary hyperuricemia total hgprt deficiency total hprt deficiencies total hprt deficiency total hypoxanthine guanine phosphoribosyl transferase deficiency total hypoxanthine-guanine phosphoribosyl transferase deficiency x linked hyperuricemia x linked primary hyperuricemia x-linked hyperuricaemia x-linked hyperuricemia x-linked hyperuricemia (disorder) x-linked hyperuricemia (disorder) [ambiguous] x-linked hyperuricemias x-linked primary hyperuricemia x-linked primary hyperuricemias |
| Orphanet | |
| OMIM | |
| DOID | |
| ICD10 | |
| UMLS | C0023374 |
| MeSH | |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:3) |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:34) 100 | ADA | 3.093 | DISEASES 108 | ADCY2 | 2.625 | DISEASES 111 | ADCY5 | 1.554 | DISEASES 135 | ADORA2A | 3.096 | DISEASES 229 | ALDOB | 1.142 | DISEASES 270 | AMPD1 | 1.659 | DISEASES 353 | APRT | 5.434 | DISEASES 64919 | BCL11B | 1.585 | DISEASES 1491 | CTH | 1.213 | DISEASES 1812 | DRD1 | 2.183 | DISEASES 2013 | EMP2 | 1.943 | DISEASES 2628 | GATM | 2.323 | DISEASES 3363 | HTR7 | 1.798 | DISEASES 4803 | NGF | 1.516 | DISEASES 5125 | PCSK5 | 1.96 | DISEASES 10846 | PDE10A | 1.572 | DISEASES 5179 | PENK | 1.104 | DISEASES 5309 | PITX3 | 1.333 | DISEASES 4860 | PNP | 3.987 | DISEASES 5454 | POU3F2 | 1.665 | DISEASES 5631 | PRPS1 | 3.817 | DISEASES 221823 | PRPS1L1 | 2.328 | DISEASES 5634 | PRPS2 | 3.794 | DISEASES 10411 | RAPGEF3 | 1.366 | DISEASES 11069 | RAPGEF4 | 1.415 | DISEASES 6007 | RHD | 1.091 | DISEASES 116085 | SLC22A12 | 1.287 | DISEASES 3177 | SLC29A2 | 1.762 | DISEASES 6863 | TAC1 | 1.85 | DISEASES 7054 | TH | 2.097 | DISEASES 23038 | WDTC1 | 1.022 | DISEASES 7498 | XDH | 2.557 | DISEASES 7499 | XG | 2.37 | DISEASES 7503 | XIST | 1.503 | DISEASES |
| Locus | (Waiting for update.) |
| Disease ID | 648 |
|---|---|
| Disease | hereditary hyperuricemia |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:18) HP:0001252 | Hypotonia HP:0001854 | Podagra HP:0000787 | Renal calculi HP:0001257 | Spasticity HP:0004322 | Stature below 3rd percentile HP:0002179 | Opisthotonus HP:0002071 | Extrapyramidal dysfunction HP:0001347 | Hyperreflexia HP:0001889 | Megaloblastic anemia HP:0001332 | Dystonia HP:0001266 | Choreoathetosis HP:0001260 | Dysarthric speech HP:0000029 | Testicular degeneration HP:0002015 | Swallowing difficulty HP:0002013 | Emesis HP:0003149 | High urine uric acid level HP:0001270 | Motor retardation HP:0001249 | Mental retardation |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:4) HP:0001997 | Gout | 2 HP:0002149 | Hyperuricemia | 1 HP:0100716 | Autoagression | 1 HP:0004419 | Recurrent thrombosis | 1 |
| Disease ID | 648 |
|---|---|
| Disease | hereditary hyperuricemia |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Manually Genotypes:1) | |||
|---|---|---|---|
| Gene | Mutation | DOI | Article Title |
| HPRT1 | - | doi:10.1038/gim.2015.51 | Clinical performance of the CytoScan Dx Assay in diagnosing developmental delay/intellectual disability |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:21) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs137852480 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134473453 | T | C |
| rs137852481 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134475268 | C | A |
| rs137852483 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134490192 | T | A |
| rs137852486 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134498670 | T | G |
| rs137852487 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134475255 | G | A |
| rs137852488 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134475257 | G | C |
| rs137852489 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134486471 | C | A,T |
| rs137852490 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134500030 | C | G |
| rs137852491 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134473465 | G | A |
| rs137852492 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134498433 | G | T |
| rs137852493 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134498431 | C | T |
| rs137852494 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134475197 | C | G,T |
| rs137852496 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134493533 | T | A |
| rs137852497 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134498412 | C | A,T |
| rs137852503 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134493524 | G | A |
| rs137852505 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134493564 | T | G |
| rs267606863 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134498655 | G | A |
| rs368429361 | 23473102 | 3251 | HPRT1 | umls:C0023374 | BeFree | We report three novel independent mutations in the coding region of HPRT gene: exon 3: c.141delA, p.D47fs53X; exon 5: c.400G>A, p.E134K; exon 7: c.499A>G, p.R167G from three LNS affected male patients. | 0.611848905 | 2013 | HPRT1 | X | 134475187 | A | G |
| rs387906428 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134500063 | AAATACAAAGCCTAAGATGAG | - |
| rs672601245 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | NA | NA | NA | NA | NA |
| rs786200980 | NA | 3251 | HPRT1 | umls:C0023374 | CLINVAR | NA | 0.611848905 | NA | HPRT1 | X | 134475258 | - | G |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:4) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0001252 | Muscular hypotonia | MP:0004144 | hypotonia | decreased muscle tension resulting in limpness of the muscles in the resting state, not to be confused with weakness |
| HP:0002071 | Abnormality of extrapyramidal motor function | MP:0009403 | increased variability of skeletal muscle fiber size | greater range or dispersion within a distribution of skeletal muscle fiber size within a muscle compared to controls |
| HP:0001889 | Megaloblastic anemia | MP:0001577 | anemia | less than normal levels of red blood cells and/or hemoglobin within red blood cells, or volume of packed red blood cells in the bloodstream, resulting in insufficient oxygenation of tissues and organs |
| HP:0000029 | Testicular atrophy | MP:0011346 | renal tubule atrophy | acquired diminution of the size of the loops of Henle, the proximal convoluted tubule or the distal convoluted tubule associated with wasting as from death and reabsorbtion of cells, diminished cellular proliferation, decreased cellular volume, pressure, |
Mapped by homologous gene(Total Items:18) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0001252 | Muscular hypotonia | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0001266 | Choreoathetosis | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0002179 | Opisthotonus | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0001854 | Gout (feet) | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0003149 | Hyperuricosuria | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0001270 | Motor delay | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0001257 | Spasticity | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0002071 | Abnormality of extrapyramidal motor function | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0002013 | Vomiting | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0001249 | Intellectual disability | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0000787 | Nephrolithiasis | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0000029 | Testicular atrophy | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0002015 | Dysphagia | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001889 | Megaloblastic anemia | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0001347 | Hyperreflexia | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001260 | Dysarthria | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001332 | Dystonia | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0004322 | Short stature | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| Disease ID | 648 |
|---|---|
| Disease | hereditary hyperuricemia |
| Case | (Waiting for update.) |