| hereditary chronic pancreatitis | ||||
| Disease ID | 844 |
|---|---|
| Disease | hereditary chronic pancreatitis |
| Definition | A disorder characterized by recurrent episodes of pancreatitis that start at a young age. It is caused by mutations in the PRSS1 or SPINK1 genes. Patients are at a high risk of developing pancreatic carcinoma. |
| Synonym | familial chronic pancreatitis familial chronic pancreatitis (disorder) familial pancreatitis hereditary pancreatitis hereditary pancreatitis (disorder) hp hpc pancreatitis, hereditary pctt |
| Orphanet | |
| OMIM | |
| UMLS | C0238339 |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:1) |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:6) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | (Waiting for update.) |
| Locus | Symbol | Locus(Total Locus:6) |
| Disease ID | 844 |
|---|---|
| Disease | hereditary chronic pancreatitis |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:17) HP:0001738 | Exocrine pancreatic insufficiency HP:0002570 | Steatorrhea HP:0001974 | Leukocytosis HP:0005206 | Pancreatic pseudocyst HP:0002202 | Pleural effusion HP:0012379 | Abnormal enzyme/coenzyme activity HP:0001977 | Abnormal thrombosis HP:0005213 | Pancreatic calcification HP:0001733 | Pancreatic inflammation HP:0005213 | Pancreatic calcifications HP:0100027 | Recurrent pancreatitis HP:0000819 | Diabetes mellitus HP:0002027 | Abdominal pain HP:0011227 | Elevated C-reactive protein level HP:0001945 | Fever HP:0030247 | Splanchnic vein thrombosis HP:0000952 | Jaundice |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:1) |
| Disease ID | 844 |
|---|---|
| Disease | hereditary chronic pancreatitis |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:1) |
Manually Genotype(Total Manually Genotypes:1) | |||
|---|---|---|---|
| Gene | Mutation | DOI | Article Title |
| PRSS1 | p.N29I | doi:10.1038/gim.2015.123 | Expanded genetic screening panel for the Ashkenazi Jewish population |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:106) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs1042522 | 24289637 | 7157 | TP53 | umls:C0238339 | BeFree | In conclusions, p53 Arg72Pro polymorphism is a potential marker of HP infection-related HNSCC rather than a susceptibility gene polymorphism. | 0.000542884 | 2014 | TP53 | 17 | 7676154 | G | T,C |
| rs104893938 | NA | 6690 | SPINK1 | umls:C0238339 | CLINVAR | NA | 0.244885954 | NA | SPINK1 | 5 | 147831576 | A | G |
| rs104893939 | NA | 6690 | SPINK1 | umls:C0238339 | CLINVAR | NA | 0.244885954 | NA | SPINK1 | 5 | 147831537 | A | G,C |
| rs111033564 | 14695529 | 5644 | PRSS1 | umls:C0238339 | UNIPROT | To challenge this notion, here we describe the unique properties of the E79K cationic trypsinogen mutation (c.235G>A), which was identified in three European families affected by sporadic or familial pancreatitis cases. | 0.268229955 | 2004 | PRSS1 | 7 | 142751808 | G | A |
| rs111033565 | 11866271 | 5644 | PRSS1 | umls:C0238339 | BeFree | The R122H and N291 mutations of CT are the most common disease-associated mutations in HP; the N34S mutation of SPINK I is the most frequent genetic risk factor associated with IP. | 0.268229955 | 2002 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 12408512 | 6690 | SPINK1 | umls:C0238339 | BeFree | Ever since the discovery that in most patients with hereditary pancreatitis a mutation in the gene encoding for cationic trypsinogen (R122H) was found that results in a gain of trypsin function', many other mutations in the cationic trypsinogen gene, as well as in the gene encoding for pancreatic secretory trypsin inhibitor, have been found in patients with chronic pancreatitis. | 0.244885954 | 2002 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 10909845 | 5644 | PRSS1 | umls:C0238339 | BeFree | Two heterozygous missense mutations, R122H (R117H) and N29I (N21I), in the cationic trypsinogen gene have been clearly associated with HP. | 0.268229955 | 2000 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 17069643 | 5644 | PRSS1 | umls:C0238339 | BeFree | The R122H mutation of the cationic trypsinogen was found in patients with hereditary pancreatitis. | 0.268229955 | 2006 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 19287144 | 5644 | PRSS1 | umls:C0238339 | BeFree | In 1996, shortly after a locus for hereditary pancreatitis had been mapped to chromosome 7q35, an apparent gain-of-function missense mutation, p.R122H, in the cationic trypsinogen gene (PRSS1) was identified. | 0.268229955 | 2008 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 12508340 | 5644 | PRSS1 | umls:C0238339 | BeFree | The majority of patients with hereditary pancreatitis express one of two mutations (R122H or N29I) in the cationic trypsinogen gene (PRSS1 gene). | 0.268229955 | 2003 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 18702646 | 5644 | PRSS1 | umls:C0238339 | BeFree | The R122H mutation represents the most common point mutation of the cationic trypsinogen gene (PRSS1) in patients with hereditary pancreatitis (HP; Online Mendelian inheritance in man [OMIM] 167800), a rare variety of chronic pancreatitis. | 0.268229955 | 2008 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 15028953 | 5644 | PRSS1 | umls:C0238339 | BeFree | Based on these findings, we revised the criteria for the diagnosis of HP; (1) recurrent acute or chronic pancreatitis with R122H or N29I mutation of the CT gene, or (2) recurrent acute or chronic pancreatitis with a family history of 2 or more affected patients, irrespective of generation, with at least 1 of the patients having no known etiological factors, and in case of siblings only, the onset of the disease in at least 1 of the patients is under age 40 years. | 0.268229955 | 2004 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 11866271 | 6690 | SPINK1 | umls:C0238339 | BeFree | The R122H and N291 mutations of CT are the most common disease-associated mutations in HP; the N34S mutation of SPINK I is the most frequent genetic risk factor associated with IP. | 0.244885954 | 2002 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 11702203 | 5644 | PRSS1 | umls:C0238339 | BeFree | Since the identification in 1996 of a gain of function missense mutation, R122H, in the cationic trypsinogen gene (PRSS1) as a cause of hereditary pancreatitis, continued screening of this gene in both hereditary and sporadic pancreatitis has found more disease-associated missense mutations than expected. | 0.268229955 | 2001 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 16358943 | 5644 | PRSS1 | umls:C0238339 | BeFree | The most common mutations in hereditary pancreatitis are R122H, N29I and A16V but many families have been described with clinically defined hereditary pancreatitis where there is no PRSS1 mutation. | 0.268229955 | 2005 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 11874252 | 5644 | PRSS1 | umls:C0238339 | BeFree | An R122H mutation in the cationic trypsinogen gene was identified in this patient, his brother, and his mother, indicating that they have hereditary pancreatitis. | 0.268229955 | 2001 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 23474566 | 5644 | PRSS1 | umls:C0238339 | BeFree | Hereditary pancreatitis is typically caused by the PRSS1 R122H or N29I mutations resulting in high penetrance (about 80%) autosomal dominant disorder that is usually reported in North America, Northern Europe and Northeast Asia, but not South America, Africa or India. | 0.268229955 | 2013 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 11788572 | 5644 | PRSS1 | umls:C0238339 | BeFree | Hereditary pancreatitis (HP) is usually caused by mutations in the cationic trypsinogen (PRSS1) gene, especially R122H or N29I. | 0.268229955 | 2002 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 11729110 | 5644 | PRSS1 | umls:C0238339 | BeFree | Nine subjects had the N34S PSTI mutation and 1 had hereditary pancreatitis (R122H, PRSS1). | 0.268229955 | 2001 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 11932257 | 5644 | PRSS1 | umls:C0238339 | BeFree | Finally, cathepsin B- catalyzed activation of recombinant human cationic trypsinogen with hereditary pancreatitis-associated mutations N29I, N29T, or R122H were characterized. | 0.268229955 | 2002 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 12408512 | 5644 | PRSS1 | umls:C0238339 | BeFree | Ever since the discovery that in most patients with hereditary pancreatitis a mutation in the gene encoding for cationic trypsinogen (R122H) was found that results in a gain of trypsin function', many other mutations in the cationic trypsinogen gene, as well as in the gene encoding for pancreatic secretory trypsin inhibitor, have been found in patients with chronic pancreatitis. | 0.268229955 | 2002 | PRSS1 | 7 | 142751938 | G | A |
| rs111033565 | 11260229 | 5644 | PRSS1 | umls:C0238339 | BeFree | Among the known PRSS1 mutations, only the R122H was detected in a single subject and the A16V in two subjects in the cohort, strengthening that HP-associated PRSS1 mutations are rare in ICP. | 0.268229955 | 2001 | PRSS1 | 7 | 142751938 | G | A |
| rs111033566 | 10909845 | 5644 | PRSS1 | umls:C0238339 | BeFree | Two heterozygous missense mutations, R122H (R117H) and N29I (N21I), in the cationic trypsinogen gene have been clearly associated with HP. | 0.268229955 | 2000 | PRSS1 | 7 | 142750600 | A | C,T |
| rs111033566 | 11788572 | 5644 | PRSS1 | umls:C0238339 | BeFree | Hereditary pancreatitis (HP) is usually caused by mutations in the cationic trypsinogen (PRSS1) gene, especially R122H or N29I. | 0.268229955 | 2002 | PRSS1 | 7 | 142750600 | A | C,T |
| rs111033566 | 21952138 | 5644 | PRSS1 | umls:C0238339 | BeFree | We believe that interaction between the novel IVS3+172 intronic variant and p.N29I mutation in the PRSS1 gene is associated with HP in this Malaysian Chinese family. | 0.268229955 | 2011 | PRSS1 | 7 | 142750600 | A | C,T |
| rs111033566 | 16358943 | 5644 | PRSS1 | umls:C0238339 | BeFree | The most common mutations in hereditary pancreatitis are R122H, N29I and A16V but many families have been described with clinically defined hereditary pancreatitis where there is no PRSS1 mutation. | 0.268229955 | 2005 | PRSS1 | 7 | 142750600 | A | C,T |
| rs111033566 | 11932257 | 5644 | PRSS1 | umls:C0238339 | BeFree | Finally, cathepsin B- catalyzed activation of recombinant human cationic trypsinogen with hereditary pancreatitis-associated mutations N29I, N29T, or R122H were characterized. | 0.268229955 | 2002 | PRSS1 | 7 | 142750600 | A | C,T |
| rs111033566 | 23474566 | 5644 | PRSS1 | umls:C0238339 | BeFree | Hereditary pancreatitis is typically caused by the PRSS1 R122H or N29I mutations resulting in high penetrance (about 80%) autosomal dominant disorder that is usually reported in North America, Northern Europe and Northeast Asia, but not South America, Africa or India. | 0.268229955 | 2013 | PRSS1 | 7 | 142750600 | A | C,T |
| rs111033566 | 12508340 | 5644 | PRSS1 | umls:C0238339 | BeFree | The majority of patients with hereditary pancreatitis express one of two mutations (R122H or N29I) in the cationic trypsinogen gene (PRSS1 gene). | 0.268229955 | 2003 | PRSS1 | 7 | 142750600 | A | C,T |
| rs111033566 | 15028953 | 5644 | PRSS1 | umls:C0238339 | BeFree | Based on these findings, we revised the criteria for the diagnosis of HP; (1) recurrent acute or chronic pancreatitis with R122H or N29I mutation of the CT gene, or (2) recurrent acute or chronic pancreatitis with a family history of 2 or more affected patients, irrespective of generation, with at least 1 of the patients having no known etiological factors, and in case of siblings only, the onset of the disease in at least 1 of the patients is under age 40 years. | 0.268229955 | 2004 | PRSS1 | 7 | 142750600 | A | C,T |
| rs111033568 | 11719509 | 5644 | PRSS1 | umls:C0238339 | BeFree | Here we report a family with hereditary pancreatitis that carries a novel PRSS1 mutation (R122C). | 0.268229955 | 2002 | PRSS1 | 7 | 142751937 | C | T |
| rs111033568 | 19454815 | 5644 | PRSS1 | umls:C0238339 | BeFree | Hereditary pancreatitis: clinical features and inheritance characteristics of the R122C mutation in the cationic trypsinogen gene (PRSS1) in six Spanish families. | 0.268229955 | 2009 | PRSS1 | 7 | 142751937 | C | T |
| rs111966833 | NA | 6690 | SPINK1 | umls:C0238339 | CLINVAR | NA | 0.244885954 | NA | SPINK1 | 5 | 147828053 | G | A,C |
| rs113993959 | NA | 1080 | CFTR | umls:C0238339 | CLINVAR | NA | 0.121085767 | NA | CFTR | 7 | 117587778 | G | T |
| rs113993960 | NA | 1080 | CFTR | umls:C0238339 | CLINVAR | NA | 0.121085767 | NA | CFTR | 7 | 117559592 | CTT | - |
| rs11540654 | 24289637 | 7157 | TP53 | umls:C0238339 | BeFree | In conclusions, p53 Arg72Pro polymorphism is a potential marker of HP infection-related HNSCC rather than a susceptibility gene polymorphism. | 0.000542884 | 2014 | TP53 | 17 | 7676040 | C | T,G,A |
| rs11554495 | 16327287 | 3856 | KRT8 | umls:C0238339 | BeFree | We found the heterozygous G62C mutation in n = 3/80 patients (n = 2/52 patients from different families, 3.8%) with familial pancreatitis without PRSS1 mutation and in n = 3/126 patients (2.4%) with sporadic pancreatitis. | 0.000271442 | 2006 | KRT8 | 12 | 52904798 | C | A |
| rs115545701 | NA | 1080 | CFTR | umls:C0238339 | CLINVAR | NA | 0.121085767 | NA | CFTR | 7 | 117509089 | C | T |
| rs11971167 | NA | 1080 | CFTR | umls:C0238339 | CLINVAR | NA | 0.121085767 | NA | CFTR | 7 | 117642528 | G | A,T |
| rs121909293 | NA | 11330 | CTRC | umls:C0238339 | CLINVAR | NA | 0.241357209 | NA | CTRC | 1 | 15445717 | C | T |
| rs121909293 | 22942235 | 11330 | CTRC | umls:C0238339 | UNIPROT | Comprehensive functional analysis of chymotrypsin C (CTRC) variants reveals distinct loss-of-function mechanisms associated with pancreatitis risk. | 0.241357209 | 2013 | CTRC | 1 | 15445717 | C | T |
| rs121909294 | NA | 11330 | CTRC | umls:C0238339 | CLINVAR | NA | 0.241357209 | NA | CTRC | 1 | 15440524 | G | A,T |
| rs140993290 | 22942235 | 11330 | CTRC | umls:C0238339 | UNIPROT | Comprehensive functional analysis of chymotrypsin C (CTRC) variants reveals distinct loss-of-function mechanisms associated with pancreatitis risk. | 0.241357209 | 2013 | CTRC | 1 | 15445660 | G | A |
| rs141115171 | 10653140 | 5644 | PRSS1 | umls:C0238339 | BeFree | However, neither the R117H nor the N21L mutation in the cationic trypsinogen were found in the HP family with the L327R alteration in CFTR. | 0.268229955 | 2000 | CFTR | 7 | 117540210 | T | G |
| rs142560329 | 22942235 | 11330 | CTRC | umls:C0238339 | UNIPROT | Comprehensive functional analysis of chymotrypsin C (CTRC) variants reveals distinct loss-of-function mechanisms associated with pancreatitis risk. | 0.241357209 | 2013 | CTRC | 1 | 15445703 | C | T |
| rs148954387 | NA | 6690 | SPINK1 | umls:C0238339 | CLINVAR | NA | 0.244885954 | NA | SPINK1 | 5 | 147828020 | A | G |
| rs17107315 | 24210198 | 6690 | SPINK1 | umls:C0238339 | BeFree | Four patients had hereditary pancreatitis (three with confirmed N34S mutation in the SPINK1 gene), one patient had chronic pancreatitis of unknown etiology, and one patient with annular pancreas developed obstructive chronic pancreatitis. | 0.244885954 | 2013 | SPINK1 | 5 | 147828115 | T | C |
| rs17107315 | 11866271 | 5644 | PRSS1 | umls:C0238339 | BeFree | The R122H and N291 mutations of CT are the most common disease-associated mutations in HP; the N34S mutation of SPINK I is the most frequent genetic risk factor associated with IP. | 0.268229955 | 2002 | SPINK1 | 5 | 147828115 | T | C |
| rs17107315 | 11866271 | 6690 | SPINK1 | umls:C0238339 | BeFree | The R122H and N291 mutations of CT are the most common disease-associated mutations in HP; the N34S mutation of SPINK I is the most frequent genetic risk factor associated with IP. | 0.244885954 | 2002 | SPINK1 | 5 | 147828115 | T | C |
| rs17107315 | NA | 6690 | SPINK1 | umls:C0238339 | CLINVAR | NA | 0.244885954 | NA | SPINK1 | 5 | 147828115 | T | C |
| rs17107315 | 23698120 | 6690 | SPINK1 | umls:C0238339 | BeFree | Using recombinant normal sequence PSTI/tumor-associated trypsin inhibitor (TATI), a variant associated with familial pancreatitis (N34S), an active site-inactivated variant (R18/V19), and immunoneutralization and RNA interference-mediated knockdown techniques, we investigated the actions of PSTI/TATI on cell migration (wounding monolayers), collagen invasion (gel invasion assays), and proliferation (Alamar blue) on 253J, RT4, and HT1376 human bladder carcinoma cell lines. | 0.244885954 | 2013 | SPINK1 | 5 | 147828115 | T | C |
| rs17107315 | 10691414 | 6690 | SPINK1 | umls:C0238339 | UNIPROT | Mutational analysis of the human pancreatic secretory trypsin inhibitor (PSTI) gene in hereditary and sporadic chronic pancreatitis. | 0.244885954 | 2000 | SPINK1 | 5 | 147828115 | T | C |
| rs1799977 | 16963262 | 4292 | MLH1 | umls:C0238339 | BeFree | Second, the samples from Finnish hereditary prostate cancer (HPC) families were used for the screening of MLH1 mutations which produced twelve MLH1 sequence variants including two missense mutations, I219V, as in the PRCA-colon cancer patient, and V647M. | 0.000271442 | 2006 | MLH1 | 3 | 37012077 | A | C,G |
| rs1800076 | NA | 1080 | CFTR | umls:C0238339 | CLINVAR | NA | 0.121085767 | NA | CFTR | 7 | 117509093 | G | A,T |
| rs1800080 | 20950468 | 11330 | CTRC | umls:C0238339 | BeFree | Mutation screening for coding regions of PRSS1, SPINK1, CFTR and the new hereditary pancreatitis-associated chymotrypsin C (CTRC) genes showed a novel variation, c.541A > G (p.S181G), in the exon 4 of PRSS1 gene and the classical CF p.F508del mutation in the CFTR. | 0.241357209 | 2010 | CFTR | 7 | 117534330 | A | G |
| rs1800080 | 20950468 | 1080 | CFTR | umls:C0238339 | BeFree | Mutation screening for coding regions of PRSS1, SPINK1, CFTR and the new hereditary pancreatitis-associated chymotrypsin C (CTRC) genes showed a novel variation, c.541A > G (p.S181G), in the exon 4 of PRSS1 gene and the classical CF p.F508del mutation in the CFTR. | 0.121085767 | 2010 | CFTR | 7 | 117534330 | A | G |
| rs1800080 | 20950468 | 5644 | PRSS1 | umls:C0238339 | BeFree | Mutation screening for coding regions of PRSS1, SPINK1, CFTR and the new hereditary pancreatitis-associated chymotrypsin C (CTRC) genes showed a novel variation, c.541A > G (p.S181G), in the exon 4 of PRSS1 gene and the classical CF p.F508del mutation in the CFTR. | 0.268229955 | 2010 | CFTR | 7 | 117534330 | A | G |
| rs1800111 | NA | 1080 | CFTR | umls:C0238339 | CLINVAR | NA | 0.121085767 | NA | CFTR | 7 | 117610521 | G | C |
| rs193922659 | NA | 6690 | SPINK1 | umls:C0238339 | CLINVAR | NA | 0.244885954 | NA | SPINK1 | 5 | 147831551 | G | - |
| rs199422123 | 18511571 | 5644 | PRSS1 | umls:C0238339 | BeFree | A novel A121T mutation in human cationic trypsinogen associated with hereditary pancreatitis: functional data indicating a loss-of-function mutation influencing the R122 trypsin cleavage site. | 0.268229955 | 2008 | PRSS1 | 7 | 142751934 | G | A,T |
| rs199769221 | 10909845 | 5644 | PRSS1 | umls:C0238339 | BeFree | Two heterozygous missense mutations, R122H (R117H) and N29I (N21I), in the cationic trypsinogen gene have been clearly associated with HP. | 0.268229955 | 2000 | PRSS1 | 7 | 142751920 | G | A,C,T |
| rs199769221 | 10653140 | 5644 | PRSS1 | umls:C0238339 | BeFree | However, neither the R117H nor the N21L mutation in the cationic trypsinogen were found in the HP family with the L327R alteration in CFTR. | 0.268229955 | 2000 | PRSS1 | 7 | 142751920 | G | A,C,T |
| rs199769221 | 9557894 | 5644 | PRSS1 | umls:C0238339 | BeFree | Recently, an arginine-histidine (R117H) mutation within the cationic trypsinogen gene was found in 5/5 families studied with HP. | 0.268229955 | 1998 | PRSS1 | 7 | 142751920 | G | A,C,T |
| rs199769221 | 11138965 | 5644 | PRSS1 | umls:C0238339 | BeFree | Three-point mutations (R117H, N211, A16V) within the cationic trypsinogen gene have been identified in patients with hereditary pancreatitis (HP). | 0.268229955 | 2001 | PRSS1 | 7 | 142751920 | G | A,C,T |
| rs199769221 | 10208958 | 5644 | PRSS1 | umls:C0238339 | BeFree | A family, in which 11 members had chronic pancreatitis, five had diabetes, and two had pancreatic cancer, was studied, and hereditary pancreatitis was diagnosed in all patients by demonstrating the mutation in exon 3 of the cationic trypsinogen gene (R117H). | 0.268229955 | 1999 | PRSS1 | 7 | 142751920 | G | A,C,T |
| rs200678111 | 22942235 | 11330 | CTRC | umls:C0238339 | UNIPROT | Comprehensive functional analysis of chymotrypsin C (CTRC) variants reveals distinct loss-of-function mechanisms associated with pancreatitis risk. | 0.241357209 | 2013 | CTRC | 1 | 15444645 | A | G |
| rs202003805 | 16358943 | 5644 | PRSS1 | umls:C0238339 | BeFree | The most common mutations in hereditary pancreatitis are R122H, N29I and A16V but many families have been described with clinically defined hereditary pancreatitis where there is no PRSS1 mutation. | 0.268229955 | 2005 | PRSS1 | 7 | 142750561 | C | T |
| rs202003805 | 11260229 | 5644 | PRSS1 | umls:C0238339 | BeFree | Among the known PRSS1 mutations, only the R122H was detected in a single subject and the A16V in two subjects in the cohort, strengthening that HP-associated PRSS1 mutations are rare in ICP. | 0.268229955 | 2001 | PRSS1 | 7 | 142750561 | C | T |
| rs202003805 | 11138965 | 5644 | PRSS1 | umls:C0238339 | BeFree | Three-point mutations (R117H, N211, A16V) within the cationic trypsinogen gene have been identified in patients with hereditary pancreatitis (HP). | 0.268229955 | 2001 | PRSS1 | 7 | 142750561 | C | T |
| rs202058123 | 22942235 | 11330 | CTRC | umls:C0238339 | UNIPROT | Comprehensive functional analysis of chymotrypsin C (CTRC) variants reveals distinct loss-of-function mechanisms associated with pancreatitis risk. | 0.241357209 | 2013 | CTRC | 1 | 15445606 | G | A |
| rs267606982 | 15028953 | 5644 | PRSS1 | umls:C0238339 | BeFree | Based on these findings, we revised the criteria for the diagnosis of HP; (1) recurrent acute or chronic pancreatitis with R122H or N29I mutation of the CT gene, or (2) recurrent acute or chronic pancreatitis with a family history of 2 or more affected patients, irrespective of generation, with at least 1 of the patients having no known etiological factors, and in case of siblings only, the onset of the disease in at least 1 of the patients is under age 40 years. | 0.268229955 | 2004 | NA | NA | NA | NA | NA |
| rs267606982 | 12508340 | 5644 | PRSS1 | umls:C0238339 | BeFree | The majority of patients with hereditary pancreatitis express one of two mutations (R122H or N29I) in the cationic trypsinogen gene (PRSS1 gene). | 0.268229955 | 2003 | NA | NA | NA | NA | NA |
| rs267606982 | 10909845 | 5644 | PRSS1 | umls:C0238339 | BeFree | Two heterozygous missense mutations, R122H (R117H) and N29I (N21I), in the cationic trypsinogen gene have been clearly associated with HP. | 0.268229955 | 2000 | NA | NA | NA | NA | NA |
| rs267606982 | 11874252 | 5644 | PRSS1 | umls:C0238339 | BeFree | An R122H mutation in the cationic trypsinogen gene was identified in this patient, his brother, and his mother, indicating that they have hereditary pancreatitis. | 0.268229955 | 2001 | NA | NA | NA | NA | NA |
| rs267606982 | 11729110 | 5644 | PRSS1 | umls:C0238339 | BeFree | Nine subjects had the N34S PSTI mutation and 1 had hereditary pancreatitis (R122H, PRSS1). | 0.268229955 | 2001 | NA | NA | NA | NA | NA |
| rs267606982 | 11866271 | 5644 | PRSS1 | umls:C0238339 | BeFree | The R122H and N291 mutations of CT are the most common disease-associated mutations in HP; the N34S mutation of SPINK I is the most frequent genetic risk factor associated with IP. | 0.268229955 | 2002 | NA | NA | NA | NA | NA |
| rs267606982 | 11866271 | 6690 | SPINK1 | umls:C0238339 | BeFree | The R122H and N291 mutations of CT are the most common disease-associated mutations in HP; the N34S mutation of SPINK I is the most frequent genetic risk factor associated with IP. | 0.244885954 | 2002 | NA | NA | NA | NA | NA |
| rs267606982 | 12408512 | 5644 | PRSS1 | umls:C0238339 | BeFree | Ever since the discovery that in most patients with hereditary pancreatitis a mutation in the gene encoding for cationic trypsinogen (R122H) was found that results in a gain of trypsin function', many other mutations in the cationic trypsinogen gene, as well as in the gene encoding for pancreatic secretory trypsin inhibitor, have been found in patients with chronic pancreatitis. | 0.268229955 | 2002 | NA | NA | NA | NA | NA |
| rs267606982 | 11788572 | 5644 | PRSS1 | umls:C0238339 | BeFree | Hereditary pancreatitis (HP) is usually caused by mutations in the cationic trypsinogen (PRSS1) gene, especially R122H or N29I. | 0.268229955 | 2002 | NA | NA | NA | NA | NA |
| rs267606982 | 12408512 | 6690 | SPINK1 | umls:C0238339 | BeFree | Ever since the discovery that in most patients with hereditary pancreatitis a mutation in the gene encoding for cationic trypsinogen (R122H) was found that results in a gain of trypsin function', many other mutations in the cationic trypsinogen gene, as well as in the gene encoding for pancreatic secretory trypsin inhibitor, have been found in patients with chronic pancreatitis. | 0.244885954 | 2002 | NA | NA | NA | NA | NA |
| rs267606982 | 16358943 | 5644 | PRSS1 | umls:C0238339 | BeFree | The most common mutations in hereditary pancreatitis are R122H, N29I and A16V but many families have been described with clinically defined hereditary pancreatitis where there is no PRSS1 mutation. | 0.268229955 | 2005 | NA | NA | NA | NA | NA |
| rs267606982 | 11702203 | 5644 | PRSS1 | umls:C0238339 | BeFree | Since the identification in 1996 of a gain of function missense mutation, R122H, in the cationic trypsinogen gene (PRSS1) as a cause of hereditary pancreatitis, continued screening of this gene in both hereditary and sporadic pancreatitis has found more disease-associated missense mutations than expected. | 0.268229955 | 2001 | NA | NA | NA | NA | NA |
| rs267606982 | 11260229 | 5644 | PRSS1 | umls:C0238339 | BeFree | Among the known PRSS1 mutations, only the R122H was detected in a single subject and the A16V in two subjects in the cohort, strengthening that HP-associated PRSS1 mutations are rare in ICP. | 0.268229955 | 2001 | NA | NA | NA | NA | NA |
| rs267606982 | 11932257 | 5644 | PRSS1 | umls:C0238339 | BeFree | Finally, cathepsin B- catalyzed activation of recombinant human cationic trypsinogen with hereditary pancreatitis-associated mutations N29I, N29T, or R122H were characterized. | 0.268229955 | 2002 | NA | NA | NA | NA | NA |
| rs267606982 | 17069643 | 5644 | PRSS1 | umls:C0238339 | BeFree | The R122H mutation of the cationic trypsinogen was found in patients with hereditary pancreatitis. | 0.268229955 | 2006 | NA | NA | NA | NA | NA |
| rs267606982 | 23474566 | 5644 | PRSS1 | umls:C0238339 | BeFree | Hereditary pancreatitis is typically caused by the PRSS1 R122H or N29I mutations resulting in high penetrance (about 80%) autosomal dominant disorder that is usually reported in North America, Northern Europe and Northeast Asia, but not South America, Africa or India. | 0.268229955 | 2013 | NA | NA | NA | NA | NA |
| rs267606982 | 18702646 | 5644 | PRSS1 | umls:C0238339 | BeFree | The R122H mutation represents the most common point mutation of the cationic trypsinogen gene (PRSS1) in patients with hereditary pancreatitis (HP; Online Mendelian inheritance in man [OMIM] 167800), a rare variety of chronic pancreatitis. | 0.268229955 | 2008 | NA | NA | NA | NA | NA |
| rs267606982 | 19287144 | 5644 | PRSS1 | umls:C0238339 | BeFree | In 1996, shortly after a locus for hereditary pancreatitis had been mapped to chromosome 7q35, an apparent gain-of-function missense mutation, p.R122H, in the cationic trypsinogen gene (PRSS1) was identified. | 0.268229955 | 2008 | NA | NA | NA | NA | NA |
| rs34152967 | 11254448 | 60528 | ELAC2 | umls:C0238339 | BeFree | Furthermore, only the two previously reported missense changes (Ser217Leu and Ala541Thr) were identified by mutational analysis of all HPC2/ELAC exons in 93 probands with HPC. | 0.001357209 | 2001 | NA | NA | NA | NA | NA |
| rs35831931 | 16963262 | 4292 | MLH1 | umls:C0238339 | BeFree | Second, the samples from Finnish hereditary prostate cancer (HPC) families were used for the screening of MLH1 mutations which produced twelve MLH1 sequence variants including two missense mutations, I219V, as in the PRCA-colon cancer patient, and V647M. | 0.000271442 | 2006 | MLH1 | 3 | 37050528 | G | A,T |
| rs35877720 | 12974284 | 6690 | SPINK1 | umls:C0238339 | UNIPROT | Gene symbol: Spink1-Omim 167790. Disease: Hereditary pancreatitis. | 0.244885954 | 2003 | SPINK1 | 5 | 147831542 | C | G |
| rs376907511 | 20950468 | 5644 | PRSS1 | umls:C0238339 | BeFree | Mutation screening for coding regions of PRSS1, SPINK1, CFTR and the new hereditary pancreatitis-associated chymotrypsin C (CTRC) genes showed a novel variation, c.541A > G (p.S181G), in the exon 4 of PRSS1 gene and the classical CF p.F508del mutation in the CFTR. | 0.268229955 | 2010 | PRSS1 | 7 | 142752517 | A | G |
| rs376907511 | 20950468 | 1080 | CFTR | umls:C0238339 | BeFree | Mutation screening for coding regions of PRSS1, SPINK1, CFTR and the new hereditary pancreatitis-associated chymotrypsin C (CTRC) genes showed a novel variation, c.541A > G (p.S181G), in the exon 4 of PRSS1 gene and the classical CF p.F508del mutation in the CFTR. | 0.121085767 | 2010 | PRSS1 | 7 | 142752517 | A | G |
| rs376907511 | 20950468 | 11330 | CTRC | umls:C0238339 | BeFree | Mutation screening for coding regions of PRSS1, SPINK1, CFTR and the new hereditary pancreatitis-associated chymotrypsin C (CTRC) genes showed a novel variation, c.541A > G (p.S181G), in the exon 4 of PRSS1 gene and the classical CF p.F508del mutation in the CFTR. | 0.241357209 | 2010 | PRSS1 | 7 | 142752517 | A | G |
| rs387906698 | 11842279 | 5644 | PRSS1 | umls:C0238339 | BeFree | R116C mutation of cationic trypsinogen in a Turkish family with recurrent pancreatitis illustrates genetic microheterogeneity of hereditary pancreatitis. | 0.268229955 | 2001 | PRSS1 | 7 | 142751919 | C | T |
| rs387906698 | 19191323 | 5644 | PRSS1 | umls:C0238339 | BeFree | The results indicate that mutation-induced misfolding and intracellular retention of human cationic trypsinogen causes hereditary pancreatitis in carriers of the p.R116C mutation. | 0.268229955 | 2009 | PRSS1 | 7 | 142751919 | C | T |
| rs4792311 | 11254448 | 60528 | ELAC2 | umls:C0238339 | BeFree | Furthermore, only the two previously reported missense changes (Ser217Leu and Ala541Thr) were identified by mutational analysis of all HPC2/ELAC exons in 93 probands with HPC. | 0.001357209 | 2001 | ELAC2 | 17 | 13011692 | G | A |
| rs515726206 | NA | 6690 | SPINK1 | umls:C0238339 | CLINVAR | NA | 0.244885954 | NA | SPINK1 | 5 | 147828066 | A | C |
| rs515726207 | NA | 6690 | SPINK1 | umls:C0238339 | CLINVAR | NA | 0.244885954 | NA | SPINK1 | 5 | 147828056 | A | G |
| rs515726208 | NA | 6690 | SPINK1 | umls:C0238339 | CLINVAR | NA | 0.244885954 | NA | SPINK1 | 5 | 147824702 | G | A |
| rs515726209 | 22942235 | 11330 | CTRC | umls:C0238339 | UNIPROT | Comprehensive functional analysis of chymotrypsin C (CTRC) variants reveals distinct loss-of-function mechanisms associated with pancreatitis risk. | 0.241357209 | 2013 | CTRC | 1 | 15440577 | G | A |
| rs515726209 | NA | 11330 | CTRC | umls:C0238339 | CLINVAR | NA | 0.241357209 | NA | CTRC | 1 | 15440577 | G | A |
| rs515726210 | NA | 11330 | CTRC | umls:C0238339 | CLINVAR | NA | 0.241357209 | NA | CTRC | 1 | 15445695 | CAAGAAGCCGGTAGTCTACACCCG | - |
| rs63750109 | 16963262 | 4292 | MLH1 | umls:C0238339 | BeFree | Second, the samples from Finnish hereditary prostate cancer (HPC) families were used for the screening of MLH1 mutations which produced twelve MLH1 sequence variants including two missense mutations, I219V, as in the PRCA-colon cancer patient, and V647M. | 0.000271442 | 2006 | MLH1 | 3 | 37048559 | G | A |
| rs75527207 | NA | 1080 | CFTR | umls:C0238339 | CLINVAR | NA | 0.121085767 | NA | CFTR | 7 | 117587806 | G | A |
| rs78655421 | 10653140 | 5644 | PRSS1 | umls:C0238339 | BeFree | However, neither the R117H nor the N21L mutation in the cationic trypsinogen were found in the HP family with the L327R alteration in CFTR. | 0.268229955 | 2000 | CFTR | 7 | 117530975 | G | A,C,T |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:2) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0001738 | Exocrine pancreatic insufficiency | MP:0014117 | increased pancreatic beta cell apoptosis | increase in the number of pancreatic beta cells undergoing programmed cell death |
| HP:0011227 | Elevated C-reactive protein level | MP:0008721 | abnormal chemokine level | deviation from the normal levels of any of the class of pro-inflammatory cytokines that attract and activate leukocytes |
Mapped by homologous gene(Total Items:14) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0005213 | Pancreatic calcification | MP:0014233 | bile duct epithelium hyperplasia | |
| HP:0001733 | Pancreatitis | MP:0020134 | abnormal gallbladder size | an anomaly in the size of the gall bladder compared to average, the organ that serves as a storage reservoir for bile |
| HP:0001945 | Fever | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0001738 | Exocrine pancreatic insufficiency | MP:0014233 | bile duct epithelium hyperplasia | |
| HP:0002202 | Pleural effusion | MP:0014233 | bile duct epithelium hyperplasia | |
| HP:0001977 | Abnormal thrombosis | MP:0014233 | bile duct epithelium hyperplasia | |
| HP:0005206 | Pancreatic pseudocyst | MP:0014233 | bile duct epithelium hyperplasia | |
| HP:0002027 | Abdominal pain | MP:0020220 | decreased tear production | decreased production of the amount of fluid produced in the eye |
| HP:0000819 | Diabetes mellitus | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000952 | Jaundice | MP:0020215 | impaired blood coagulation | impaired ability of the blood to clot |
| HP:0001974 | Leukocytosis | MP:0020154 | impaired humoral immune response | impaired response of the immune system that mediates secreted antibodies produced in B cells |
| HP:0002570 | Steatorrhea | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0100027 | Recurrent pancreatitis | MP:0012118 | absent trophectoderm cell proliferation | |
| HP:0011227 | Elevated C-reactive protein level | MP:0008721 | abnormal chemokine level | deviation from the normal levels of any of the class of pro-inflammatory cytokines that attract and activate leukocytes |
| Disease ID | 844 |
|---|---|
| Disease | hereditary chronic pancreatitis |
| Case | (Waiting for update.) |