eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine

HOME
QUERY
- DISEASE
- GENOTYPE
NETWORK
- PHENOTYPE
- GENE
- COMMON
- DISEASE PAIR
DOWNLOAD
SUBMIT CASE
HELP&FAQ
- HELP&FAQ
- CONTACT US


	glycogen storage disease vi

Disease ID	1758
Disease	glycogen storage disease vi
Definition	A hepatic GLYCOGEN STORAGE DISEASE in which there is an apparent deficiency of hepatic phosphorylase (GLYCOGEN PHOSPHORYLASE, LIVER FORM) activity.
Synonym	disease, hers disease, hers' glycogen storage dis vi glycogen storage disease type vi glycogen storage disease type vi [disease/finding] glycogen storage disease, type vi glycogen storage disease, type vi (disorder) glycogenosis 06 glycogenosis 6 glycogenosis type vi glycogenosis vi glycogenosis, type vi gsd vi gsd6 hepatic glycogen phosphorylase deficiency hepatic glycogen phosphorylase deficiency (disorder) hepatic phosphorylase deficiency hepatophosphorylase deficiency glycogenosis hepatophosporylase deficiency glycogenosis her disease her's disease hers dis hers disease hers' disease liver phosphorylase deficiency liver phosphorylase deficiency syndrome phosphorylase deficiency glycogen-storage disease of liver type vi, glycogenosis
Orphanet	ORPHANET:369
OMIM	OMIM:232700
DOID	DOID:2754
UMLS	C0017925
MeSH	D006013
SNOMED-CT	SNOMEDCT_US_2016_09_01:29291001
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:169) C0011847 \| diabetes \| 10 C0028754 \| obesity \| 9 C0020538 \| hypertension \| 8 C0030567 \| parkinson's disease \| 5 C0003864 \| arthritis \| 5 C0948265 \| metabolic syndrome \| 5 C0030567 \| parkinson disease \| 4 C0040034 \| thrombocytopenia \| 4 C0011570 \| depression \| 3 C0031099 \| periodontitis \| 3 C0456909 \| blindness \| 3 C0442874 \| neuropathy \| 3 C0014544 \| epilepsy \| 3 C0017205 \| glucocerebrosidase deficiency \| 3 C0005940 \| bone disease \| 3 C0497327 \| dementia \| 3 C0036341 \| schizophrenia \| 3 C0003873 \| rheumatoid arthritis \| 3 C0004096 \| asthma \| 2 C0021831 \| enteropathy \| 2 C0017601 \| glaucoma \| 2 C0023418 \| leukemia \| 2 C0020541 \| portal hypertension \| 2 C0004153 \| atherosclerosis \| 2 C0021359 \| infertility \| 2 C1136085 \| monoclonal gammopathy \| 2 C0085580 \| essential hypertension \| 2 C0162429 \| malnutrition \| 2 C0282193 \| iron overload \| 2 C0236642 \| pick disease \| 2 C0020255 \| hydrocephalus \| 2 C0878544 \| cardiomyopathy \| 2 C0002871 \| anemia \| 2 C0008370 \| cholestasis \| 2 C0024530 \| malaria \| 2 C0042373 \| vascular disease \| 2 C0020676 \| hypothyroidism \| 2 C0033860 \| psoriasis \| 2 C0259749 \| autonomic neuropathy \| 2 C0041296 \| tuberculosis \| 2 C0020542 \| pulmonary hypertension \| 2 C0028064 \| niemann-pick disease \| 2 C0030286 \| pancreatic disease \| 1 C0008373 \| cholesteatoma \| 1 C0949664 \| tauopathies \| 1 C0025362 \| mental retardation \| 1 C0036220 \| kaposi's sarcoma \| 1 C0015397 \| eye disease \| 1 C0751778 \| progressive myoclonic epilepsy \| 1 C0024117 \| chronic airflow limitation \| 1 C0010068 \| coronary artery disease \| 1 C0151740 \| elevated intracranial pressure \| 1 C0027059 \| myocarditis \| 1 C1261473 \| sarcoma \| 1 C0007570 \| celiac disease \| 1 C0042900 \| vitiligo \| 1 C0010414 \| cryptococcosis \| 1 C1142166 \| brugada syndrome \| 1 C0022658 \| nephropathy \| 1 C0023449 \| acute lymphoblastic leukemia \| 1 C0007286 \| carpal tunnel syndrome \| 1 C0024141 \| systemic lupus erythematosus \| 1 C0030286 \| pancreatic diseases \| 1 C0149825 \| adenoid hypertrophy \| 1 C0024143 \| lupus nephritis \| 1 C0016436 \| folliculitis \| 1 C0042345 \| varices \| 1 C0007222 \| cardiovascular disease \| 1 C0027051 \| myocardial infarction \| 1 C0006123 \| branch retinal artery occlusion \| 1 C0027051 \| myocardial infarct \| 1 C0014867 \| esophageal varices \| 1 C0029443 \| osteomyelitis \| 1 C0020455 \| hyperimmunoglobulinemia \| 1 C0032285 \| pneumonia \| 1 C0041309 \| cutaneous tuberculosis \| 1 C0029882 \| otitis media \| 1 C0042870 \| vitamin d defic \| 1 C0018799 \| heart disease \| 1 C0004623 \| bacterial infection \| 1 C0409974 \| lupus erythematosus \| 1 C0001973 \| alcoholism \| 1 C0026769 \| multiple sclerosis \| 1 C0009806 \| constipation \| 1 C0042345 \| varicose veins \| 1 C0036202 \| sarcoidosis \| 1 C0007570 \| gluten-induced enteropathy \| 1 C0272242 \| complement deficiency \| 1 C0751878 \| cns vasculitis \| 1 C0020456 \| hyperglycemia \| 1 C0026764 \| multiple myeloma \| 1 C0020757 \| ichthyosis \| 1 C0042870 \| vitamin d deficiency \| 1 C0700594 \| radiculopathy \| 1 C0027697 \| nephritis \| 1 C0086543 \| cataract \| 1 C0008311 \| cholangitis \| 1 C0042345 \| varicose vein \| 1 C0154209 \| hyperestrogenism \| 1 C0149642 \| cervical lymphadenitis \| 1 C0018801 \| heart failure \| 1 C0037274 \| skin disease \| 1 C0026229 \| acariasis \| 1 C0025289 \| meningitis \| 1 C0079731 \| b cell lymphoma \| 1 C0043117 \| immune thrombocytopenic purpura \| 1 C0006267 \| bronchiectasis \| 1 C0085413 \| autosomal dominant polycystic kidney \| 1 C0011849 \| diabetes mellitus \| 1 C0019045 \| hemoglobinopathy \| 1 C0042075 \| urological disorders \| 1 C0242350 \| erectile dysfunction \| 1 C0008313 \| sclerosing cholangitis \| 1 C0017665 \| membranous nephropathy \| 1 C0014488 \| epicondylitis \| 1 C0027765 \| neurological disorders \| 1 C0271650 \| glucose intolerance \| 1 C0032461 \| polycythaemia \| 1 C0009451 \| communicating hydrocephalus \| 1 C0036323 \| schistosomiasis \| 1 C0010403 \| cryoglobulinemia \| 1 C0037116 \| silicosis \| 1 C0013421 \| dystonia \| 1 C0035302 \| retinal artery occlusion \| 1 C0271270 \| oculomotor apraxia \| 1 C0004936 \| mental disorders \| 1 C0022408 \| articular disease \| 1 C0008350 \| cholelithiasis \| 1 C0023448 \| lymphoblastic leukemia \| 1 C0015397 \| eye diseases \| 1 C0006142 \| breast cancer \| 1 C0034072 \| cor pulmonale \| 1 C0027947 \| neutropenia \| 1 C0003635 \| apraxia \| 1 C0006277 \| bronchitis \| 1 C0006666 \| calciphylaxis \| 1 C0600452 \| hepatopulmonary syndrome \| 1 C0476089 \| endometrial ca \| 1 C0018378 \| guillain-barre syndrome \| 1 C0003864 \| inflammatory arthritis \| 1 C0024117 \| chronic obstructive pulmonary disease (copd) \| 1 C0007789 \| cerebral palsy \| 1 C0003872 \| psoriatic arthritis \| 1 C0085278 \| antiphospholipid antibody syndrome \| 1 C0021933 \| intussusception \| 1 C0020550 \| hyperthyroidism \| 1 C0042769 \| viral infection \| 1 C0751778 \| progressive myoclonus epilepsy \| 1 C0085413 \| autosomal dominant polycystic kidney disease \| 1 C0376358 \| prostate cancer \| 1 C0014118 \| endocarditis \| 1 C0026848 \| myopathies \| 1 C0024291 \| hemophagocytic lymphohistiocytosis \| 1 C0019294 \| inguinal hernia \| 1 C0005684 \| bladder cancer \| 1 C0042384 \| vasculitis \| 1 C0476089 \| endometrial cancer \| 1 C0023895 \| liver disease \| 1 C0028754 \| adiposity \| 1 C0085078 \| lysosomal storage disorders \| 1 C0027765 \| neurological disorder \| 1 C0038363 \| aphthous ulcer \| 1 C0011991 \| diarrhoea \| 1 C1318533 \| secondary polycythaemia \| 1 C0030312 \| pancytopenia \| 1 C0393571 \| multiple system atrophy \| 1 C0024899 \| mastocytosis \| 1 C0024299 \| lymphoma \| 1 C0152025 \| polyneuropathy \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:1) 5836 \| PYGL \| CLINVAR;CTD_human;GHR;ORPHANET;UNIPROT
Inferring Gene	(Waiting for update.)
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:2) 2641 \| GCG \| 1.187 \| DISEASES 4625 \| MYH7 \| 3.113 \| DISEASES
Locus	(Waiting for update.)

Disease ID	1758
Disease	glycogen storage disease vi
Integrated Phenotype	(Waiting for update.)
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:173) HP:0001513 \| Obesity \| 11 HP:0001289 \| Confusion \| 10 HP:0012531 \| Pain \| 9 HP:0000822 \| Hypertension \| 7 HP:0001369 \| Arthritis \| 5 HP:0000716 \| Depression \| 4 HP:0000704 \| Pyorrhea \| 4 HP:0001873 \| Low platelet count \| 4 HP:0100753 \| Schizophrenia \| 3 HP:0001744 \| Splenomegaly \| 3 HP:0002099 \| Asthma \| 3 HP:0002664 \| Neoplasia \| 3 HP:0001300 \| Parkinsonism \| 3 HP:0000726 \| Dementia \| 3 HP:0001370 \| Rheumatoid arthritis \| 3 HP:0000618 \| Blindness \| 3 HP:0000855 \| Insulin resistance \| 3 HP:0002092 \| Pulmonary artery hypertension \| 2 HP:0002180 \| Neurodegeneration \| 2 HP:0001409 \| Portal hypertension \| 2 HP:0002094 \| Dyspnea \| 2 HP:0002018 \| Nausea \| 2 HP:0001396 \| Cholestasis \| 2 HP:0000238 \| Nonsyndromal hydrocephalus \| 2 HP:0002960 \| Autoimmune condition \| 2 HP:0001903 \| Anemia \| 2 HP:0001909 \| Leukemia \| 2 HP:0001433 \| Enlarged liver and spleen \| 2 HP:0000501 \| Glaucoma \| 2 HP:0006532 \| Pneumonia, recurrent episodes \| 2 HP:0010885 \| Aseptic necrosis \| 2 HP:0003765 \| Psoriasis \| 2 HP:0004395 \| Malnutrition \| 2 HP:0001336 \| Myoclonic jerks \| 2 HP:0100543 \| Cognitive deficits \| 2 HP:0100512 \| Vitamin D deficiency \| 2 HP:0002621 \| Atherosclerosis \| 2 HP:0030666 \| Retinal neovascularisation \| 2 HP:0002315 \| Headaches \| 2 HP:0001824 \| Weight loss \| 2 HP:0100790 \| Hernia \| 2 HP:0001510 \| Growth deficiency \| 2 HP:0001638 \| Cardiomyopathy \| 2 HP:0000821 \| Underactive thyroid \| 2 HP:0002242 \| Enteropathy \| 2 HP:0001399 \| Liver failure \| 2 HP:0000572 \| Visual loss \| 2 HP:0000789 \| Infertility \| 2 HP:0000518 \| Cataract \| 2 HP:0030329 \| Retinal thinning \| 1 HP:0012532 \| Chronic pain \| 1 HP:0001876 \| Low blood cell count \| 1 HP:0002186 \| Apraxia \| 1 HP:0001658 \| Myocardial infarction \| 1 HP:0003074 \| High blood glucose \| 1 HP:0012378 \| Fatigue \| 1 HP:0001118 \| Juvenile cataract \| 1 HP:0001061 \| Acne \| 1 HP:0000388 \| Otitis media \| 1 HP:0001263 \| Developmental retardation \| 1 HP:0004431 \| Complement deficiency \| 1 HP:0012819 \| Myocarditis \| 1 HP:0200058 \| Angiosarcoma \| 1 HP:0002608 \| Celiac disease \| 1 HP:0001045 \| Blotchy loss of skin color \| 1 HP:0006721 \| Acute lymphocytic leukemia \| 1 HP:0000708 \| Behavioral problems \| 1 HP:0001394 \| Hepatic cirrhosis \| 1 HP:0030833 \| Neck pain \| 1 HP:0100242 \| Sarcoma \| 1 HP:0001648 \| Cor pulmonale \| 1 HP:0002716 \| Lymph node hyperplasia \| 1 HP:0100310 \| Extradural hematoma \| 1 HP:0012578 \| Membranous glomerulonephritis \| 1 HP:0002529 \| Neuronal loss in central nervous system \| 1 HP:0002239 \| Gastrointestinal hemorrhage \| 1 HP:0001410 \| Decreased liver function \| 1 HP:0001249 \| Mental retardation \| 1 HP:0001321 \| Small cerebellum \| 1 HP:0100315 \| Lewy bodies \| 1 HP:0012387 \| Bronchitis \| 1 HP:0001875 \| Neutropenia \| 1 HP:0002633 \| Vasculitis \| 1 HP:0000519 \| Cataracts, lenticular, bilateral \| 1 HP:0000836 \| Overactive thyroid \| 1 HP:0012432 \| Chronic fatigue \| 1 HP:0012594 \| High urine albumin levels \| 1 HP:0006775 \| Multiple myeloma \| 1 HP:0001252 \| Hypotonia \| 1 HP:0002754 \| Bone infection \| 1 HP:0004905 \| Vitamin A deficiency \| 1 HP:0008064 \| Ichthyosis \| 1 HP:0004322 \| Stature below 3rd percentile \| 1 HP:0002619 \| Varicose veins \| 1 HP:0001618 \| Dysphonia \| 1 HP:0001334 \| Communicating hydrocephalus \| 1 HP:0012125 \| Prostate cancer \| 1 HP:0001677 \| Coronary artery disease \| 1 HP:0002901 \| Hypocalcemia \| 1 HP:0100014 \| Macular pucker \| 1 HP:0000159 \| Lip abnormality \| 1 HP:0001332 \| Dystonia \| 1 HP:0009916 \| Asymmetric pupil sizes \| 1 HP:0004308 \| Ventricular arrhythmia \| 1 HP:0001946 \| High levels of ketone bodies \| 1 HP:0010766 \| Ectopic calcification \| 1 HP:0002584 \| Intestinal hemorrhage \| 1 HP:0000802 \| Erectile dysfunction \| 1 HP:0002090 \| Pneumonia \| 1 HP:0001685 \| Myocardial fibrosis \| 1 HP:0002613 \| Biliary cirrhosis \| 1 HP:0000833 \| Glucose intolerance \| 1 HP:0100582 \| Nasal polyps \| 1 HP:0011675 \| Arrhythmias \| 1 HP:0003002 \| Breast carcinoma \| 1 HP:0002829 \| Arthralgias \| 1 HP:0001880 \| Eosinophilia \| 1 HP:0002659 \| Increased tendency to fractures \| 1 HP:0001635 \| Congestive heart failure \| 1 HP:0000023 \| Inguinal hernia \| 1 HP:0002953 \| Vertebral compression fractures \| 1 HP:0012418 \| Low blood oxygen level \| 1 HP:0030151 \| Cholangitis \| 1 HP:0009797 \| Cholesteatoma \| 1 HP:0000657 \| Oculomotor apraxia \| 1 HP:0000078 \| Genital abnormalities \| 1 HP:0008066 \| Skin bullae \| 1 HP:0012115 \| Liver inflammation \| 1 HP:0001262 \| Somnolence \| 1 HP:0012393 \| Allergy \| 1 HP:0008947 \| Hypotonia early \| 1 HP:0100584 \| Endocarditis \| 1 HP:0002527 \| Falls \| 1 HP:0001928 \| Abnormal blood coagulation studies \| 1 HP:0000751 \| Personality changes \| 1 HP:0002036 \| Hiatus hernia \| 1 HP:0001081 \| Gallstones \| 1 HP:0002725 \| Systemic lupus erythematosus \| 1 HP:0009725 \| Bladder neoplasm \| 1 HP:0002653 \| Bone pain \| 1 HP:0001945 \| Fever \| 1 HP:0100723 \| Gastrointestinal stroma tumor \| 1 HP:0002045 \| Abnormally low body temperature \| 1 HP:0012735 \| Coughing \| 1 HP:0002013 \| Emesis \| 1 HP:0002665 \| Lymphoma \| 1 HP:0003201 \| Rhabdomyolysis \| 1 HP:0001907 \| Thromboembolic disease \| 1 HP:0002202 \| Pleural effusion \| 1 HP:0002017 \| Nausea and vomiting \| 1 HP:0002514 \| Intracranial calcifications \| 1 HP:0003287 \| Abnormality of mitochondrial metabolism \| 1 HP:0001297 \| Cerebral vascular events \| 1 HP:0012593 \| Nephrotic range proteinuria \| 1 HP:0100778 \| Cryoglobulinemia \| 1 HP:0002376 \| Loss of developmental milestones \| 1 HP:0000819 \| Diabetes mellitus \| 1 HP:0100726 \| Kaposi's sarcoma \| 1 HP:0100495 \| Mastocytosis \| 1 HP:0000123 \| Nephritis \| 1 HP:0001287 \| Meningitis \| 1 HP:0000938 \| Decreased bone mineral density \| 1 HP:0000969 \| Dropsy \| 1 HP:0000112 \| Nephropathy \| 1 HP:0012191 \| B-cell lymphoma \| 1 HP:0100021 \| Cerebral palsy \| 1 HP:0012743 \| Central obesity \| 1 HP:0002576 \| Intussusception \| 1 HP:0006562 \| Viral hepatitis \| 1 HP:0002958 \| Immune dysregulation \| 1 HP:0100626 \| Chronic hepatic failure \| 1 HP:0002019 \| Dyschezia \| 1 HP:0001271 \| Polyneuropathy \| 1

Disease ID	1758
Disease	glycogen storage disease vi
Manually Symptom	(Waiting for update.)
Text Mined Symptom	(Waiting for update.)

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:25)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs113993972	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL;LOC105370492	14	50944366	T	G
rs113993973	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50937801	G	A
rs113993974	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50924101	C	G
rs113993975	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50921030	C	T
rs113993976	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50916718	T	C
rs113993977	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50915933	G	C
rs113993978	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50915869	G	A
rs113993979	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50915373	C	T
rs113993980	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50914748	G	A
rs113993981	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50913028	C	T,G
rs113993982	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50912155	C	T,G
rs113993983	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50911804	T	A
rs113993984	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50910055	C	T
rs113993985	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50910049	A	T
rs113993986	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50910048	G	C,A
rs113993987	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50910030	T	G
rs113993988	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50905475	A	G
rs150547274	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50911752	G	T
rs35026927	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50911799	C	G,A
rs386626619	19564637	3717	JAK2	umls:C0017925	BeFree	In a patient with 2 TET2 mutations, the analysis of 5 blood samples at different phases of her disease showed the sequential occurrence of JAK2(V617F) and TET2 mutations concomitantly to the disease evolution.	0.000271442	2009	NA	NA	NA	NA	NA
rs386626619	19564637	54790	TET2	umls:C0017925	BeFree	In a patient with 2 TET2 mutations, the analysis of 5 blood samples at different phases of her disease showed the sequential occurrence of JAK2(V617F) and TET2 mutations concomitantly to the disease evolution.	0.000271442	2009	NA	NA	NA	NA	NA
rs529502292	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL	14	50912275	-	G
rs77375493	19564637	3717	JAK2	umls:C0017925	BeFree	In a patient with 2 TET2 mutations, the analysis of 5 blood samples at different phases of her disease showed the sequential occurrence of JAK2(V617F) and TET2 mutations concomitantly to the disease evolution.	0.000271442	2009	JAK2;INSL6	9	5073770	G	A,T
rs77375493	19564637	54790	TET2	umls:C0017925	BeFree	In a patient with 2 TET2 mutations, the analysis of 5 blood samples at different phases of her disease showed the sequential occurrence of JAK2(V617F) and TET2 mutations concomitantly to the disease evolution.	0.000271442	2009	JAK2;INSL6	9	5073770	G	A,T
rs786204785	NA	5836	PYGL	umls:C0017925	CLINVAR	NA	0.480271442	NA	PYGL;LOC105370492	14	50944359	-	CTGATCTGCCGCCGCTTCTC

GWASdb Annotation(Total Genotypes:7)
Chr	Pos	SNP_Id	RefGene	EnsemblGene	ENCODE_Factor	ENCODE_TFBS	Chromosome_interaction	GTEx_eQTL	SNP_TFBS_affinity_GWAS3D	SNP_miRNA_target_affinity_PolymiRTS	SNP_splicing_effect_Skippy	SNP_splicing_effect_MutPred_Splice	SNP_ns_protein_effect_dbNSFP	SNP_syn_effect_Silva	SNP_phosphorylation_effect_PhosSNP	PhastCons_score	PhyloP_score	GERP++_RS	Segway_state	Ancestral_allele	ESP_AF	ESP_AFR	ESP_AFR	ESP_EUR	TG_ASN	TG_AMR	TG_AFR	TG_EUR	Type	Consequence	bStatistic	EncH3K27Ac	EncH3K4Me1	EncH3K4Me3	EncNucleo	OMIM	Clinvar
14	51372606	rs2027341	NM_002863,PYGL	NM_001163940,PYGL	NM_181533,ABHD12B	NM_181814,ABHD12B	NM_001206673,ABHD12B	ENST00000501589,ENSG00000247448	ENST00000532462,ENSG00000100504	ENST00000531889,ENSG00000100504	ENST00000216392,ENSG00000100504	ENST00000395752,ENSG00000131969	ENST00000337334,ENSG00000131969	ENST00000353130,ENSG00000131969	NA	NA	chr14,51370001,51380000,chr7,6620001,6630000,4,Hi-C	chr14,51370001,51380000,chr19,21500001,21510000,4,Hi-C	chr14,51370001,51380000,chr1,70120001,70130000,6,Hi-C	chr14,51370001,51380000,chr15,101500001,101510000,7,Hi-C	chr14,51370001,51380000,chr14,41330001,41340000,16,Hi-C	NA	Fhl1-DBD-primary,2.8096	Rph1-primary,2.5052	Six3_1732,1.3552	Six6_2267,1.4049	LM15,2.8134	NA	NA	NA	NA	NA	NA	0.000	0.451	1.81	R0
14	51375250	rs2356535	NM_002863,PYGL	NM_001163940,PYGL	ENST00000501589,ENSG00000247448	ENST00000532462,ENSG00000100504	ENST00000531889,ENSG00000100504	ENST00000216392,ENSG00000100504	ENST00000532107,ENSG00000100504	NA	NA	chr14,51370001,51380000,chr7,6620001,6630000,4,Hi-C	chr14,51370001,51380000,chr19,21500001,21510000,4,Hi-C	chr14,51370001,51380000,chr1,70120001,70130000,6,Hi-C	chr14,51370001,51380000,chr15,101500001,101510000,7,Hi-C	chr14,51370001,51380000,chr14,41330001,41340000,16,Hi-C	NA	LM33,1.8665	LM50,2.1479	LM89,2.6082	LM101,6.7309	LM103,3.9145	NA	NA	NA	NA	NA	NA	0.000	-0.217	-1.68	R3	T	NA	NA	NA	NA
14	51376237	rs10132049	NM_002863,PYGL	NM_001163940,PYGL	ENST00000501589,ENSG00000247448	ENST00000532462,ENSG00000100504	ENST00000531889,ENSG00000100504	ENST00000216392,ENSG00000100504	ENST00000528757,ENSG00000100504	ENST00000532107,ENSG00000100504	NA	NA	chr14,51370001,51380000,chr7,6620001,6630000,4,Hi-C	chr14,51370001,51380000,chr19,21500001,21510000,4,Hi-C	chr14,51370001,51380000,chr1,70120001,70130000,6,Hi-C	chr14,51370001,51380000,chr15,101500001,101510000,7,Hi-C	chr14,51370001,51380000,chr14,41330001,41340000,16,Hi-C	NA	LM1,2.1323	LM3,1.3113	LM93,3.3	LM113,1.7475	LM164,8.2774	NA	NA	NA	NA	NA	NA	0.000	-0.702	-4.03	F1	A	NA	NA	NA
14	51387590	rs946617	NM_002863,PYGL	NM_001163940,PYGL	ENST00000501589,ENSG00000247448	ENST00000532462,ENSG00000100504	ENST00000531889,ENSG00000100504	ENST00000216392,ENSG00000100504	TFP.CEBPB	CHMM	TFP.HDAC2	TFP.RXRA	TFP.FOXA2	TFP.EP300	NA	NA	NA	LM94,2.6274	LM153,4.549	LM165,2.1921	LM168,6.8795	LM187,2.0769	NA	NA	NA	NA	NA	NA	0.018	2.219	2.25	R2	T	NA	NA	NA	NA
14	51403531	rs7142143	NM_002863,PYGL	NM_001163940,PYGL	ENST00000532462,ENSG00000100504	ENST00000531889,ENSG00000100504	ENST00000216392,ENSG00000100504	ENST00000530336,ENSG00000100504	ENST00000532698,ENSG00000100504	NA	NA	chr14,51400001,51410000,chr8,115510001,115520000,6,Hi-C	NA	LM18,3.6216	LM21,3.0604	LM61,1.279	LM87,1.3359	LM88,2.4895	NA	NA	NA	NA	NA	NA	0.000	-0.126	0.503	L0	T	NA	NA	NA	NA	NA	NA	NA	NA
14	51407580	rs1890706	NM_002863,PYGL	NM_001163940,PYGL	ENST00000532462,ENSG00000100504	ENST00000531889,ENSG00000100504	ENST00000216392,ENSG00000100504	ENST00000530336,ENSG00000100504	ENST00000532698,ENSG00000100504	NA	NA	chr14,51400001,51410000,chr8,115510001,115520000,6,Hi-C	NA	LM100,3.5563	LM199,5.7075	LM204,1.3616	Dl_2,26.8648	ELK4,72.1104	NA	NA	NA	NA	NA	NA	0.338	0.886	2.66	GE0	T	NA	NA	NA	NA	NA	NA	NA	NA
14	51411029	rs17123244	NM_002863,PYGL	NM_001163940,PYGL	ENST00000532462,ENSG00000100504	ENST00000531889,ENSG00000100504	ENST00000216392,ENSG00000100504	ENST00000530336,ENSG00000100504	ENST00000532698,ENSG00000100504	TFP.SMARCC1	TFP.SMARCB1	TFP.ZNF263	TFP.TAF1	TFP.SIN3A	TFP.ZBTB7A	TFP.EGR1	TFP.MAX	TFP.EP300	TFP.HDAC2	TFP.MYC	TFP.RAD21	TFP.MXI1	TFP.HNF4A	TFP.E2F1	TFP.E2F6	TFP.ELF1	TFP.RXRA	TFP.HNF4G	TFP.CTCF	TFP.YY1	TFP.TBP	TFP.JUND	MCV-25	TFP.NRF1	TFP.SP1	TFP.STAT3	TFP.FOXA1

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:0)
(Waiting for update.)

Disease ID	1758
Disease	glycogen storage disease vi
Case	(Waiting for update.)