eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine

HOME
QUERY
- DISEASE
- GENOTYPE
NETWORK
- PHENOTYPE
- GENE
- COMMON
- DISEASE PAIR
DOWNLOAD
SUBMIT CASE
HELP&FAQ
- HELP&FAQ
- CONTACT US


	glycogen storage disease ii

Disease ID	312
Disease	glycogen storage disease ii
Definition	An autosomal recessively inherited glycogen storage disease caused by GLUCAN 1,4-ALPHA-GLUCOSIDASE deficiency. Large amounts of GLYCOGEN accumulate in the LYSOSOMES of skeletal muscle (MUSCLE, SKELETAL); HEART; LIVER; SPINAL CORD; and BRAIN. Three forms have been described: infantile, childhood, and adult. The infantile form is fatal in infancy and presents with hypotonia and a hypertrophic cardiomyopathy (CARDIOMYOPATHY, HYPERTROPHIC). The childhood form usually presents in the second year of life with proximal weakness and respiratory symptoms. The adult form consists of a slowly progressive proximal myopathy. (From Muscle Nerve 1995;3:S61-9; Menkes, Textbook of Child Neurology, 5th ed, pp73-4)
Synonym	2 glycogenosis acid alpha glucosidase deficiency acid alpha-glucosidase deficiencies acid alpha-glucosidase deficiency acid maltase defic dis acid maltase deficiency acid maltase deficiency disease alpha 1,4 glucosidase deficiency alpha glucosidase deficiency alpha-1,4-glucosidase deficiency alpha-glucosidase deficiencies alpha-glucosidase deficiencies, acid alpha-glucosidase deficiency alpha-glucosidase deficiency, acid amd amd - acid maltase deficiency defic dis acid maltase defic dis lysosomal alpha 1 4 glucosidase deficiencies, acid alpha-glucosidase deficiencies, gaa deficiency disease, acid maltase deficiency disease, lysosomal alpha-1,4-glucosidase deficiency of acid maltase deficiency of alpha glucosidase deficiency of alpha-glucosidase deficiency of alpha-glucosidase (disorder) deficiency of amyloglucosidase deficiency of exo-1,4-alpha-glucosidase deficiency of gamma-amylase deficiency of glucan 1,4-alpha-glucosidase deficiency of glucan 1,4-alpha-glucosidase (disorder) deficiency of glucoamylase deficiency of glucoinvertase deficiency of glucosidosucrase deficiency of lysosomal alpha-glucosidase deficiency of maltase deficiency of maltase-glucoamylase deficiency, acid alpha-glucosidase deficiency, gaa disease pompe's disease, pompe disease, pompe's gaa gaa deficiencies gaa deficiency generalised glycogenosis generalized glycogenoses generalized glycogenosis generalized glycogenosis (disorder) glycogen heart disease glycogen storage dis ii glycogen storage disease type 2 glycogen storage disease type ii glycogen storage disease type ii [disease/finding] glycogen storage disease, type ii glycogen storage disease, type ii (disorder) glycogen storage disease, type ii [ambiguous] glycogenoses, generalized glycogenosis 02 glycogenosis 2 glycogenosis type ii glycogenosis, generalized glycogenosis, type 2 glycogenosis, type ii glycogenosis: [generalised] or [pompe's disease] or [type 2] glycogenosis: [generalised] or [pompe's disease] or [type 2] (disorder) glycogenosis: [generalized] or [pompe's disease] or [type 2] gsd ii gsd2 gsd2s lysosomal alpha 1 4 glucosidase defic dis lysosomal alpha 1,4 glucosidase deficiency disease lysosomal alpha glucosidase deficiency disease 01 04 lysosomal alpha-1,4-glucosidase deficiency lysosomal alpha-1,4-glucosidase deficiency (disorder) lysosomal alpha-1,4-glucosidase deficiency disease lysosomal glucosidase deficiency maltase acid deficiency maltase deficiency pompe dis pompe disease pompe's disease pompes dis pompes disease type ii, glycogenosis type iis, glycogenosis
Orphanet	ORPHANET:365
OMIM	OMIM:232300 OMIM:606800
DOID	DOID:2752
ICD10	ICD10CM:E74.02
UMLS	C0017921
MeSH	D006009
SNOMED-CT	SNOMEDCT_US_2016_09_01:124454007;SNOMEDCT_US_2016_09_01:237967002;SNOMEDCT_US_2016_09_01:124462004;SNOMEDCT_US_2016_09_01:274864009;SNOMEDCT_US_2016_09_01:267424007
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:26) C0878544 \| cardiomyopathy \| 6 C1145670 \| respiratory failure \| 5 C0026848 \| myopathy \| 4 C0017921 \| pompe disease \| 3 C0005745 \| ptosis \| 2 C0007194 \| hypertrophic cardiomyopathy \| 2 C0023890 \| cirrhosis \| 1 C0026850 \| muscular dystrophy \| 1 C0026769 \| multiple sclerosis \| 1 C0022951 \| lactose intolerance \| 1 C0206695 \| neuroendocrine carcinoma \| 1 C0029134 \| optic neuritis \| 1 C0022104 \| irritable bowel syndrome \| 1 C0023890 \| liver cirrhosis \| 1 C0026846 \| muscle wasting \| 1 C0018916 \| hemangioma \| 1 C0010068 \| coronary artery disease \| 1 C0036439 \| scoliosis \| 1 C0035229 \| respiratory insufficiency \| 1 C0026846 \| muscle atrophy \| 1 C0031117 \| peripheral neuropathy \| 1 C0442874 \| neuropathy \| 1 C0026848 \| myopathies \| 1 C0023895 \| hepatic disease \| 1 C0686353 \| limb-girdle muscular dystrophy \| 1 C0026848 \| muscle disease \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:2) 262 \| AMD1 \| OMIM 2548 \| GAA \| CLINVAR;CTD_human;GHR;UNIPROT
Inferring Gene	Entrez_id \| Symbol \| Resource(Total Genes:2) 1636 \| ACE \| CIPHER 2548 \| GAA \| CIPHER;CTD_human
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:40) 55811 \| ADCY10 \| 2.036 \| DISEASES 270 \| AMPD1 \| 2.039 \| DISEASES 10498 \| CARM1 \| 2.192 \| DISEASES 859 \| CAV3 \| 2.29 \| DISEASES 548596 \| CKMT1A \| 1.963 \| DISEASES 1180 \| CLCN1 \| 1.908 \| DISEASES 387836 \| CLEC2A \| 1.552 \| DISEASES 7555 \| CNBP \| 1.22 \| DISEASES 4850 \| CNOT4 \| 1.927 \| DISEASES 1756 \| DMD \| 2.683 \| DISEASES 389549 \| FEZF1 \| 2.085 \| DISEASES 23193 \| GANAB \| 4.655 \| DISEASES 2595 \| GANC \| 4.979 \| DISEASES 10020 \| GNE \| 1.494 \| DISEASES 8733 \| GPAA1 \| 2.771 \| DISEASES 160897 \| GPR180 \| 2.135 \| DISEASES 2992 \| GYG1 \| 3.665 \| DISEASES 3399 \| ID3 \| 1.614 \| DISEASES 387755 \| INSC \| 2.122 \| DISEASES 3908 \| LAMA2 \| 2.227 \| DISEASES 3920 \| LAMP2 \| 3.895 \| DISEASES 3939 \| LDHA \| 1.007 \| DISEASES 9782 \| MATR3 \| 2.475 \| DISEASES 4519 \| MT-CYB \| 2.018 \| DISEASES 4534 \| MTM1 \| 1.473 \| DISEASES 4671 \| NAIP \| 1.674 \| DISEASES 378884 \| NHLRC1 \| 1.63 \| DISEASES 4926 \| NUMA1 \| 1.18 \| DISEASES 30849 \| PIK3R4 \| 2.813 \| DISEASES 56980 \| PRDM10 \| 1.013 \| DISEASES 5563 \| PRKAA2 \| 2.524 \| DISEASES 3276 \| PRMT1 \| 1.749 \| DISEASES 55170 \| PRMT6 \| 2.636 \| DISEASES 6207 \| RPS13 \| 1.745 \| DISEASES 6329 \| SCN4A \| 2.619 \| DISEASES 6342 \| SCP2 \| 2.099 \| DISEASES 6906 \| SERPINA7 \| 1.124 \| DISEASES 26503 \| SLC17A5 \| 1.429 \| DISEASES 6429 \| SRSF4 \| 2.881 \| DISEASES 7402 \| UTRN \| 1.179 \| DISEASES
Locus	(Waiting for update.)

Disease ID	312
Disease	glycogen storage disease ii
Integrated Phenotype	HPO \| Name(Total Integrated Phenotypes:20) HP:0001252 \| Hypotonia HP:0003701 \| Proximal limb muscle weakness HP:0001744 \| Splenomegaly HP:0011400 \| Abnormal CNS myelination HP:0002240 \| Enlarged liver HP:0002094 \| Dyspnea HP:0000158 \| Abnormally large tongue HP:0003236 \| Elevated creatine kinase HP:0002093 \| progressive respiratory failure HP:0001284 \| Areflexia HP:0000365 \| Hearing impairment HP:0002747 \| Respiratory distress due to muscle weakness HP:0001640 \| Increased heart size HP:0002205 \| Frequent respiratory infections HP:0001945 \| Fever HP:0001716 \| Wolff-Parkinson-White syndrome HP:0005165 \| Shortened PR interval on EKG HP:0004944 \| Cerebral artery aneurysm HP:0006597 \| Paralyzed diaphragm HP:0003725 \| Firm muscles
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:33) HP:0001638 \| Cardiomyopathy \| 6 HP:0002878 \| Respiratory failure \| 5 HP:0003198 \| Myopathic changes \| 4 HP:0001252 \| Hypotonia \| 2 HP:0002015 \| Swallowing difficulty \| 2 HP:0001324 \| Muscular weakness \| 2 HP:0012378 \| Fatigue \| 2 HP:0000508 \| Drooping upper eyelid \| 2 HP:0001639 \| Hypertrophic cardiomyopathy \| 2 HP:0003202 \| Neurogenic muscle atrophy, especially in the lower limbs \| 2 HP:0006785 \| Limb-girdle muscular dystrophy \| 1 HP:0001028 \| Strawberry mark \| 1 HP:0001663 \| Ventricular fibrillation \| 1 HP:0100653 \| Optic neuritis \| 1 HP:0003477 \| Peripheral axonal neuropathy \| 1 HP:0002747 \| Respiratory distress due to muscle weakness \| 1 HP:0002027 \| Abdominal pain \| 1 HP:0003560 \| Muscular dystrophy \| 1 HP:0001677 \| Coronary artery disease \| 1 HP:0002486 \| Myotonia \| 1 HP:0004416 \| Precocious atherosclerosis \| 1 HP:0002650 \| Scoliosis \| 1 HP:0030731 \| Carcinoma \| 1 HP:0012531 \| Pain \| 1 HP:0004789 \| Lactose intolerance \| 1 HP:0001394 \| Hepatic cirrhosis \| 1 HP:0005181 \| Premature coronary artery disease \| 1 HP:0200136 \| Oral-pharyngeal dysphagia \| 1 HP:0012411 \| Premature pubarche \| 1 HP:0001712 \| Left ventricular hypertrophy \| 1 HP:0002093 \| progressive respiratory failure \| 1 HP:0001714 \| Ventricular hypertrophy \| 1 HP:0009830 \| Peripheral neuritis \| 1

Disease ID	312
Disease	glycogen storage disease ii
Manually Symptom	(Waiting for update.)
Text Mined Symptom	UMLS \| Name \| Sentences' Count(Total Symptoms:6) C1145670 \| respiratory failure \| 5 C0878544 \| cardiomyopathy \| 4 C0015672 \| fatigue \| 2 C0026848 \| myopathy \| 1 C0007194 \| hypertrophic cardiomyopathy \| 1 C0035229 \| respiratory insufficiency \| 1

Manually Genotype(Total Manually Genotypes:1)
Gene	Mutation	DOI	Article Title
GAA	Het del exon 18	doi:10.1038/gim.2011.65	Exon-level array CGH in a large clinical cohort demonstrates increased sensitivity of diagnostic testing for Mendelian disorders

Text Mining Genotype(Total Genotypes:5)
Variant ID	CHR	POS	Gene	Samples	AF	Beta/OR (SE)/(CI)	Type	Population	Reference
rs140647181	3	99180668	COL8A1	43566	0.023/0.016	1.59	GWAS	mainly European	http://www.ncbi.nlm.nih.gov/pubmed/26691988
rs114092250	5	35494448	PRLR-SPEF2	43566	0.016/0.022	0.7	GWAS	mainly European	http://www.ncbi.nlm.nih.gov/pubmed/26691988
rs62358361	5	39327888	C9	43566	0.016/0.009	1.8	GWAS	mainly European	http://www.ncbi.nlm.nih.gov/pubmed/26691988
rs61941274	12	112132610	ACAD10	43566	0.024/0.018	1.51	GWAS	mainly European	http://www.ncbi.nlm.nih.gov/pubmed/26691988
rs147859257	19	6718146	C3	52578	0.0055	3.13 (1.99–4.91)	WGS + Imputation	Icelandic	http://www.ncbi.nlm.nih.gov/pubmed/24036950

All Snps(Total Genotypes:61)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs121907937	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110950	G	A
rs121907938	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113350	C	T
rs121907940	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80107837	T	C,G
rs121907942	7881422	2548	GAA	umls:C0017921	BeFree	The effect of a single base pair deletion (delta T525) and a C1634T missense mutation (pro545leu) on the expression of lysosomal alpha-glucosidase in patients with glycogen storage disease type II.	0.499337114	1994	GAA	17	80111023	C	T
rs121907943	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80118271	C	T
rs140826989	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110837	G	A
rs147804176	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110726	G	C,T
rs200210219	22644586	2548	GAA	umls:C0017921	UNIPROT	Update of the pompe disease mutation database with 60 novel GAA sequence variants and additional studies on the functional effect of 34 previously reported variants.	0.499337114	2012	GAA	17	80105873	G	A
rs200856561	20080426	2548	GAA	umls:C0017921	UNIPROT	Therefore, newborn screening for Pompe disease could be successfully conducted by including genotyping and lymphocyte GAA assay, even in a population with mutation heterozygosity and pseudodeficiency.	0.499337114	2010	GAA	17	80107616	C	T
rs201185475	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80104758	C	T
rs201896815	20080426	2548	GAA	umls:C0017921	UNIPROT	Therefore, newborn screening for Pompe disease could be successfully conducted by including genotyping and lymphocyte GAA assay, even in a population with mutation heterozygosity and pseudodeficiency.	0.499337114	2010	GAA	17	80107648	G	A
rs201896815	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80107648	G	A
rs28937909	18429042	2548	GAA	umls:C0017921	UNIPROT	Molecular and functional characterization of eight novel GAA mutations in Italian infants with Pompe disease.	0.499337114	2008	GAA	17	80112914	G	A,T
rs28939100	8401535	2548	GAA	umls:C0017921	UNIPROT	Two mutations affecting the transport and maturation of lysosomal alpha-glucosidase in an adult case of glycogen storage disease type II.	0.499337114	1993	NA	NA	NA	NA	NA
rs28940868	20080426	2548	GAA	umls:C0017921	UNIPROT	Therefore, newborn screening for Pompe disease could be successfully conducted by including genotyping and lymphocyte GAA assay, even in a population with mutation heterozygosity and pseudodeficiency.	0.499337114	2010	GAA	17	80112922	C	A,T
rs28940868	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112922	C	A,T
rs368438393	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112920	G	A,C
rs369532274	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80118223	C	T
rs370950728	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80105857	G	A
rs374143224	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112966	G	A
rs374470794	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112625	C	G
rs386834235	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80105111	T	-
rs386834236	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80104542	T	G
rs398123169	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110754	G	A
rs398123170	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112999	T	C,G
rs398123171	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113247	-	AGCCG
rs398123172	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113282	G	A,T
rs398123173	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80118255	C	-
rs398123174	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80104893	T	G
rs528367092	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80105771	G	A,T
rs536906561	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112929	G	A
rs536906561	9535769	2548	GAA	umls:C0017921	UNIPROT	Glycogen storage disease type II (GSDII), an autosomal recessive myopathic disorder, results from deficiency of lysosomal acid alpha-glucosidase.	0.499337114	1998	GAA	17	80112929	G	A
rs543300039	16917947	2548	GAA	umls:C0017921	UNIPROT	Mutation profile of the GAA gene in 40 Italian patients with late onset glycogen storage disease type II.	0.499337114	2006	GAA	17	80107866	G	A
rs543300039	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80107866	G	A
rs549029029	20080426	2548	GAA	umls:C0017921	UNIPROT	Therefore, newborn screening for Pompe disease could be successfully conducted by including genotyping and lymphocyte GAA assay, even in a population with mutation heterozygosity and pseudodeficiency.	0.499337114	2010	GAA	17	80112666	G	A
rs549029029	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112666	G	A
rs577915581	20080426	2548	GAA	umls:C0017921	UNIPROT	Therefore, newborn screening for Pompe disease could be successfully conducted by including genotyping and lymphocyte GAA assay, even in a population with mutation heterozygosity and pseudodeficiency.	0.499337114	2010	GAA	17	80107625	C	T
rs730880022	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80108338	G	A
rs730880372	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113255	-	A
rs757111744	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113001	C	T
rs757700700	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80105872	C	T
rs767882689	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80105111	TG	-
rs770276275	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110029	GAGA	-
rs770610356	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80108811	C	T
rs772883420	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110730	T	C
rs780321415	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80118319	C	T
rs781088002	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112650	C	-
rs786204467	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80104587	A	G
rs786204507	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80108385	G	-
rs786204517	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80108569	C	T
rs786204532	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80107630	TATATCACAGGCCTCGCCGA	C
rs786204549	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113317	C	-
rs786204561	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80118359	T	A
rs786204614	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80104929	C	T
rs786204621	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113011	ACA	-
rs786204645	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113281	C	T
rs786204646	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80108541	GG	C
rs786204661	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80104951	T	-
rs786204720	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110945	T	C
rs786204727	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112649	-	A
rs796051877	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110055	G	A

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:8)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0005165	Shortened PR interval	MP:0011953	prolonged PQ interval	increase in the length of time between the beginning of atrial depolarization and the end of atrial repolarization (or recovery), measured by the interval from the beginning of the P wave to the end of the Q wave
HP:0003701	Proximal muscle weakness	MP:0000748	progressive muscle weakness	increasing loss of muscle strength over time
HP:0002747	Respiratory insufficiency due to muscle weakness	MP:0000748	progressive muscle weakness	increasing loss of muscle strength over time
HP:0004944	Cerebral aneurysm	MP:0010661	ascending aorta aneurysm	a protruding sac formed by the dilation of the wall of the of the part of the aorta that arises from the base of the left ventricle and extends upward to the aortic arch, resulting from a weakening of the vessel wall
HP:0003236	Elevated serum creatine phosphokinase	MP:0020280	increased creatine kinase level	increased level of the enzyme that catalyzes the reversible transfer of creatine to phosphocreatine
HP:0001252	Muscular hypotonia	MP:0004144	hypotonia	decreased muscle tension resulting in limpness of the muscles in the resting state, not to be confused with weakness
HP:0002205	Recurrent respiratory infections	MP:0014182	decreased respiratory epithelial sodium ion transmembrane transport	decrease in the directed movement of sodium ions from one side of the respiratory epithelial cell membrane to the other
HP:0006597	Diaphragmatic paralysis	MP:0000755	hindlimb paralysis	loss of power of voluntary movement in the muscles of the hindlimb through injury or disease of it or its nerve supply

Mapped by homologous gene(Total Items:20)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0001252	Muscular hypotonia	MP:3000003	abnormal Ebner's gland morphology	any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0003236	Elevated serum creatine phosphokinase	MP:0020309	increased creatine kinase activity	increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+).
HP:0002093	Respiratory insufficiency	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0002094	Dyspnea	MP:0014185	cerebellum atrophy	acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal
HP:0001640	Cardiomegaly	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0001945	Fever	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0001716	Wolff-Parkinson-White syndrome	MP:0014074	increased brain glycogen level	greater than the normal concentration of a readily converted carbohydrate reserve in brain
HP:0004944	Cerebral aneurysm	MP:0014074	increased brain glycogen level	greater than the normal concentration of a readily converted carbohydrate reserve in brain
HP:0001284	Areflexia	MP:0020220	decreased tear production	decreased production of the amount of fluid produced in the eye
HP:0002747	Respiratory insufficiency due to muscle weakness	MP:0020220	decreased tear production	decreased production of the amount of fluid produced in the eye
HP:0011400	Abnormal CNS myelination	MP:0014074	increased brain glycogen level	greater than the normal concentration of a readily converted carbohydrate reserve in brain
HP:0000365	Hearing impairment	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0000158	Macroglossia	MP:0020169	increased thyroid gland weight	higher than average weight of the thyroid gland
HP:0002205	Recurrent respiratory infections	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0005165	Shortened PR interval	MP:0014074	increased brain glycogen level	greater than the normal concentration of a readily converted carbohydrate reserve in brain
HP:0006597	Diaphragmatic paralysis	MP:0014074	increased brain glycogen level	greater than the normal concentration of a readily converted carbohydrate reserve in brain
HP:0003725	Firm muscles	MP:0014074	increased brain glycogen level	greater than the normal concentration of a readily converted carbohydrate reserve in brain
HP:0002240	Hepatomegaly	MP:0020329	decreased capillary density	reduction in the number of capillaries in a given cross-sectional area of a tissue
HP:0001744	Splenomegaly	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0003701	Proximal muscle weakness	MP:0020329	decreased capillary density	reduction in the number of capillaries in a given cross-sectional area of a tissue

Disease ID	312
Disease	glycogen storage disease ii
Case	(Waiting for update.)