| epilepsy, progressive myoclonic 1a | ||||
| Disease ID | 1652 |
|---|---|
| Disease | epilepsy, progressive myoclonic 1a |
| Definition | An autosomal recessive condition characterized by recurrent myoclonic and generalized seizures, ATAXIA, slowly progressive intellectual deterioration, dysarthria, and intention tremor. Myoclonic seizures are severe and continuous, and tend to be triggered by movement, stress, and sensory stimuli. The age of onset is between 8 and 13 years, and the condition is relatively frequent in the Baltic region, especially Finland. (From Menkes, Textbook of Child Neurology, 5th ed, pp109-110) |
| Synonym | baltic myoclonic epilepsies baltic myoclonic epilepsy baltic myoclonus baltic myoclonus epilepsies baltic myoclonus epilepsy disease, unverricht disease, unverricht-lundborg diseases, unverricht diseases, unverricht-lundborg epilepsies, baltic myoclonic epilepsies, baltic myoclonus epilepsy, baltic myoclonic epilepsy, baltic myoclonus epilepsy, mediterranean myoclonic epilepsy, progressive myoclonic 1 epilepsy, progressive myoclonic type 1 epilepsy, progressive myoclonic, 1 epilepsy, progressive myoclonic, 1a epilepsy, progressive myoclonus 1 epm1 epm1a lundborg unverricht syndrome lundborg-unverricht disease lundborg-unverricht syndrome mediterranean myoclonic epilepsy myoclonic epilepsies, baltic myoclonic epilepsy of unverricht and lundborg myoclonic epilepsy, baltic myoclonic epilepsy, mediterranean myoclonus epilepsies, baltic myoclonus epilepsy, baltic myoclonus progressive epilepsy of unverricht and lundborg myoclonus, baltic pme progressive myoclonus epilepsy 1 progressive myoclonus epilepsybaltic myoclonic epilepsy syndrome, lundborg-unverricht syndrome, unverricht-lundborg uld unverricht - lundborg disease unverricht dis unverricht disease unverricht diseases unverricht lundborg disease unverricht lundborg syndrome unverricht syndrome unverricht's disease unverricht-lundborg disease unverricht-lundborg diseases unverricht-lundborg syndrome unverricht-lundborg syndrome (disorder) unverricht-lundborg syndrome [disease/finding] unverricht-lundborg-lafora disease |
| Orphanet | |
| OMIM | |
| DOID | |
| UMLS | C0751785 |
| MeSH | |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:4) C0751778 | progressive myoclonus epilepsy | 3 C0014544 | epilepsy | 2 C0014544 | epileptic seizures | 1 C0014544 | epileptic seizure | 1 |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:3) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:28) 347 | APOD | 1.937 | DISEASES 617 | BCS1L | 1.576 | DISEASES 834 | CASP1 | 1.604 | DISEASES 1137 | CHRNA4 | 1.83 | DISEASES 1201 | CLN3 | 2.718 | DISEASES 1203 | CLN5 | 2.113 | DISEASES 1508 | CTSB | 2.094 | DISEASES 1520 | CTSS | 2.831 | DISEASES 1523 | CUX1 | 2.047 | DISEASES 114327 | EFHC1 | 3.988 | DISEASES 7957 | EPM2A | 3.976 | DISEASES 2335 | FN1 | 1.221 | DISEASES 2395 | FXN | 1.023 | DISEASES 2741 | GLRA1 | 2.683 | DISEASES 8349 | HIST2H2BE | 1.084 | DISEASES 3736 | KCNA1 | 1.917 | DISEASES 3785 | KCNQ2 | 1.487 | DISEASES 3786 | KCNQ3 | 3.003 | DISEASES 51734 | MSRB1 | 1.682 | DISEASES 4566 | MT-TK | 4.338 | DISEASES 4599 | MX1 | 1.06 | DISEASES 378884 | NHLRC1 | 3.51 | DISEASES 51400 | PPME1 | 3.161 | DISEASES 56978 | PRDM8 | 3.743 | DISEASES 144165 | PRICKLE1 | 3.901 | DISEASES 57142 | RTN4 | 1.069 | DISEASES 26278 | SACS | 1.945 | DISEASES 6324 | SCN1B | 2.18 | DISEASES |
| Locus | (Waiting for update.) |
| Disease ID | 1652 |
|---|---|
| Disease | epilepsy, progressive myoclonic 1a |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:6) HP:0001251 | Ataxia HP:0002121 | Petit mal seizures HP:0001268 | Mental deterioration HP:0001260 | Dysarthric speech HP:0002069 | Generalized tonic clonic seizures HP:0001336 | Myoclonic jerks |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:5) HP:0001336 | Myoclonic jerks | 6 HP:0001250 | Seizures | 2 HP:0001272 | Cerebellar atrophy | 1 HP:0040148 | Cortical myoclonus | 1 HP:0002120 | Cerebral cortical atrophy | 1 |
| Disease ID | 1652 |
|---|---|
| Disease | epilepsy, progressive myoclonic 1a |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:1) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:15) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs121909346 | NA | 1476 | CSTB | umls:C0751785 | CLINVAR | NA | 0.570586233 | NA | CSTB | 21 | 43774287 | T | G |
| rs147484110 | NA | 1476 | CSTB | umls:C0751785 | CLINVAR | NA | 0.570586233 | NA | CSTB | 21 | 43774760 | C | G |
| rs193922905 | NA | 1476 | CSTB | umls:C0751785 | CLINVAR | NA | 0.570586233 | NA | NA | NA | NA | NA | NA |
| rs312262707 | NA | 1476 | CSTB | umls:C0751785 | CLINVAR | NA | 0.570586233 | NA | CSTB | 21 | 43774640 | CTGAGGCCCACACTCTAC | - |
| rs312262708 | NA | 1476 | CSTB | umls:C0751785 | CLINVAR | NA | 0.570586233 | NA | CSTB | 21 | 43774677 | C | T |
| rs386833438 | NA | 1476 | CSTB | umls:C0751785 | CLINVAR | NA | 0.570586233 | NA | NA | NA | NA | NA | NA |
| rs386833439 | NA | 1476 | CSTB | umls:C0751785 | CLINVAR | NA | 0.570586233 | NA | CSTB | 21 | 43774701 | G | T |
| rs386833440 | NA | 1476 | CSTB | umls:C0751785 | CLINVAR | NA | 0.570586233 | NA | CSTB | 21 | 43774658 | C | T |
| rs386833441 | NA | 1476 | CSTB | umls:C0751785 | CLINVAR | NA | 0.570586233 | NA | CSTB | 21 | 43774332 | T | C |
| rs386833443 | NA | 1476 | CSTB | umls:C0751785 | CLINVAR | NA | 0.570586233 | NA | CSTB | 21 | 43776204 | C | T |
| rs545986367 | NA | 1476 | CSTB | umls:C0751785 | CLINVAR | NA | 0.570586233 | NA | CSTB | 21 | 43774690 | G | A |
| rs74315442 | NA | 1476 | CSTB | umls:C0751785 | CLINVAR | NA | 0.570586233 | NA | CSTB | 21 | 43774297 | G | A |
| rs74315443 | NA | 1476 | CSTB | umls:C0751785 | CLINVAR | NA | 0.570586233 | NA | CSTB | 21 | 43776260 | C | G |
| rs796943858 | NA | 1476 | CSTB | umls:C0751785 | CLINVAR | NA | 0.570586233 | NA | CSTB | 21 | 43774280 | GA | - |
| rs864309482 | NA | 1476 | CSTB | umls:C0751785 | CLINVAR | NA | 0.570586233 | NA | CSTB | 21 | 43774637 | CTCCTGAGGCCCACACTCTA | TT |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:2) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0002121 | Absence seizures | MP:0009358 | environmentally induced seizures | seizure activity response due to changes in ambient habitat including room temperature, lighting, sounds, touching, and/ or moving cage |
| HP:0002069 | Generalized tonic-clonic seizures | MP:0003997 | tonic-clonic seizures | increased number or decreased threshold for the induction of a seizure characterized by initial rigidity followed by rhythmic jerking movements |
Mapped by homologous gene(Total Items:6) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0002069 | Generalized tonic-clonic seizures | MP:0020301 | short tongue | decreased length of the mobile mass of muscular tissue and surrounding epithelial tissue occupying the cavity of the mouth and forming part of the floor |
| HP:0001268 | Mental deterioration | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0002121 | Absence seizures | MP:0020301 | short tongue | decreased length of the mobile mass of muscular tissue and surrounding epithelial tissue occupying the cavity of the mouth and forming part of the floor |
| HP:0001260 | Dysarthria | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001251 | Ataxia | MP:0020301 | short tongue | decreased length of the mobile mass of muscular tissue and surrounding epithelial tissue occupying the cavity of the mouth and forming part of the floor |
| HP:0001336 | Myoclonus | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| Disease ID | 1652 |
|---|---|
| Disease | epilepsy, progressive myoclonic 1a |
| Case | (Waiting for update.) |