dravet syndrome |
Disease ID | 267 |
---|---|
Disease | dravet syndrome |
Definition | A severe form of epilepsy that presents in early childhood and is characterized by frequent, prolonged febrile or myoclonic seizures that may progress to status epilepticus and poor development of language, motor, and socialization skills. |
Synonym | dravet syndromes eiee6 epilepsy, myoclonic, infantile, severe epileptic encephalopathy, early infantile, 6 infantile severe myoclonic epilepsy myoclonic epilepsy, infantile, severe myoclonic epilepsy, severe infantile myoclonic epilepsy, severe, of infancy severe infantile myoclonic epilepsy severe myoclonic epilepsy in infancy severe myoclonic epilepsy in infancy (disorder) severe myoclonic epilepsy of infancy severe myoclonic epilepsy, infantile smei syndrome, dravet syndromes, dravet |
Orphanet | |
OMIM | |
DOID | |
UMLS | C0751122 |
SNOMED-CT | |
Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:9) C0038220 | status epilepticus | 3 C0014544 | epilepsy | 3 C0004352 | autism | 1 C0014544 | epileptic seizures | 1 C0751265 | learning disability | 1 C0014544 | epileptic seizure | 1 C0006017 | pertussis | 1 C0037317 | sleep disturbance | 1 C0751651 | mitochondrial disease | 1 |
Curated Gene | Entrez_id | Symbol | Resource(Total Genes:3) |
Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:62) 501 | ALDH7A1 | 1.322 | DISEASES 170302 | ARX | 2.346 | DISEASES 8913 | CACNA1G | 2.285 | DISEASES 782 | CACNB1 | 2.711 | DISEASES 785 | CACNB4 | 2.065 | DISEASES 6792 | CDKL5 | 2.98 | DISEASES 1106 | CHD2 | 2.635 | DISEASES 1141 | CHRNB2 | 1.637 | DISEASES 1269 | CNR2 | 1.214 | DISEASES 1544 | CYP1A2 | 1.122 | DISEASES 1557 | CYP2C19 | 3.184 | DISEASES 1741 | DLG3 | 1.58 | DISEASES 1745 | DLX1 | 1.955 | DISEASES 1805 | DPT | 1.977 | DISEASES 114327 | EFHC1 | 1.632 | DISEASES 7957 | EPM2A | 1.864 | DISEASES 2259 | FGF14 | 2.058 | DISEASES 2290 | FOXG1 | 1.013 | DISEASES 122786 | FRMD6 | 1.715 | DISEASES 2555 | GABRA2 | 1.912 | DISEASES 2563 | GABRD | 4.053 | DISEASES 2566 | GABRG2 | 5.925 | DISEASES 2617 | GARS | 1.544 | DISEASES 10243 | GPHN | 1.485 | DISEASES 3736 | KCNA1 | 1.078 | DISEASES 3785 | KCNQ2 | 4.376 | DISEASES 3786 | KCNQ3 | 3.122 | DISEASES 57582 | KCNT1 | 2.858 | DISEASES 154881 | KCTD7 | 1.915 | DISEASES 10319 | LAMC3 | 2.349 | DISEASES 9211 | LGI1 | 1.582 | DISEASES 9863 | MAGI2 | 1.892 | DISEASES 4204 | MECP2 | 1.515 | DISEASES 4356 | MPP3 | 2.184 | DISEASES 4566 | MT-TK | 1.333 | DISEASES 27247 | NFU1 | 2.155 | DISEASES 378884 | NHLRC1 | 1.213 | DISEASES 5091 | PC | 1.062 | DISEASES 57526 | PCDH19 | 5.863 | DISEASES 23236 | PLCB1 | 1.34 | DISEASES 11284 | PNKP | 2.032 | DISEASES 51400 | PPME1 | 2.322 | DISEASES 5504 | PPP1R2 | 2.826 | DISEASES 6263 | RYR3 | 1.799 | DISEASES 6324 | SCN1B | 5.889 | DISEASES 6330 | SCN4B | 2.249 | DISEASES 6332 | SCN7A | 2.679 | DISEASES 6334 | SCN8A | 3.874 | DISEASES 6335 | SCN9A | 3.288 | DISEASES 79751 | SLC25A22 | 3.535 | DISEASES 6513 | SLC2A1 | 2.41 | DISEASES 57282 | SLC4A10 | 2.47 | DISEASES 10479 | SLC9A6 | 1.701 | DISEASES 84679 | SLC9A7 | 1.954 | DISEASES 6635 | SNRPE | 4.84 | DISEASES 6709 | SPTAN1 | 1.185 | DISEASES 6812 | STXBP1 | 4.216 | DISEASES 9900 | SV2A | 1.095 | DISEASES 23270 | TSPYL4 | 3.491 | DISEASES 89910 | UBE3B | 1.427 | DISEASES 51733 | UPB1 | 2.428 | DISEASES 7453 | WARS | 3.76 | DISEASES |
Locus | Symbol | Locus(Total Locus:8) |
Disease ID | 267 |
---|---|
Disease | dravet syndrome |
Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:17) HP:0002353 | EEG abnormality HP:0001263 | Global developmental delay HP:0001250 | Seizures HP:0000708 | Behavioral abnormality HP:0007334 | Bilateral convulsive seizures HP:0001251 | Ataxia HP:0002266 | Focal clonic seizures HP:0000992 | Cutaneous photosensitivity HP:0012758 | Neurodevelopmental delay HP:0001337 | Tremor HP:0011151 | Obtundation status HP:0002384 | Focal seizures with impairment of consciousness or awareness HP:0002373 | Febrile seizures HP:0002121 | Absence seizures HP:0001252 | Muscular hypotonia HP:0002123 | Generalized myoclonic seizures HP:0002197 | Generalized seizures |
Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:13) HP:0001250 | Seizures | 18 HP:0001298 | Encephalopathy | 5 HP:0010819 | drop attacks | 3 HP:0002133 | Status epilepticus | 3 HP:0006846 | Acute encephalopathy | 2 HP:0007359 | Partial seizures | 1 HP:0002373 | Febrile convulsions | 1 HP:0002360 | Sleep disturbance | 1 HP:0000717 | Autism | 1 HP:0002180 | Neurodegeneration | 1 HP:0011170 | Myoclonic atonic seizures | 1 HP:0200134 | Epileptic encephalopathy | 1 HP:0007105 | Infantile encephalopathy | 1 |
Disease ID | 267 |
---|---|
Disease | dravet syndrome |
Manually Symptom | UMLS | Name(Total Manually Symptoms:4) |
Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:4) C0038220 | status epilepticus | 3 C0014544 | epilepsy | 3 C0751494 | convulsive seizures | 2 C0543888 | epileptic encephalopathy | 1 |
Manually Genotype(Total Text Mining Genotypes:0) |
---|
(Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
---|---|
(Waiting for update.) |
All Snps(Total Genotypes:284) | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
rs121917907 | 20729507 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Genotype-phenotype correlations in a group of 15 SCN1A-mutated Italian patients with GEFS+ spectrum (seizures plus, classical and borderline severe myoclonic epilepsy of infancy). | 0.370955127 | 2010 | SCN1A | 2 | 166073435 | A | G |
rs121917908 | 20729507 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Genotype-phenotype correlations in a group of 15 SCN1A-mutated Italian patients with GEFS+ spectrum (seizures plus, classical and borderline severe myoclonic epilepsy of infancy). | 0.370955127 | 2010 | SCN1A;LOC102724058 | 2 | 165999764 | C | T,G |
rs121917909 | 20729507 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Genotype-phenotype correlations in a group of 15 SCN1A-mutated Italian patients with GEFS+ spectrum (seizures plus, classical and borderline severe myoclonic epilepsy of infancy). | 0.370955127 | 2010 | SCN1A | 2 | 166051967 | G | A |
rs121917911 | 12821740 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 166013752 | C | G |
rs121917912 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A;LOC102724058 | 2 | 166012254 | C | T |
rs121917913 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A;LOC102724058 | 2 | 166002491 | T | C |
rs121917914 | 17561957 | 6323 | SCN1A | umls:C0751122 | UNIPROT | This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes. | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 165992387 | C | T |
rs121917915 | 17561957 | 6323 | SCN1A | umls:C0751122 | UNIPROT | This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes. | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 165994176 | C | A |
rs121917916 | 17561957 | 6323 | SCN1A | umls:C0751122 | UNIPROT | This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes. | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 165991916 | C | T |
rs121917917 | 17561957 | 6323 | SCN1A | umls:C0751122 | UNIPROT | This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes. | 0.370955127 | 2007 | SCN1A | 2 | 166037852 | C | A |
rs121917918 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166058651 | C | T |
rs121917918 | 14738421 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB). | 0.370955127 | 2004 | SCN1A | 2 | 166058651 | C | T |
rs121917919 | 17561957 | 6323 | SCN1A | umls:C0751122 | UNIPROT | This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes. | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 165994236 | A | G |
rs121917920 | 17561957 | 6323 | SCN1A | umls:C0751122 | UNIPROT | This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes. | 0.370955127 | 2007 | SCN1A | 2 | 166047731 | T | C |
rs121917921 | 17561957 | 6323 | SCN1A | umls:C0751122 | UNIPROT | This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes. | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 165991927 | G | A |
rs121917922 | 17561957 | 6323 | SCN1A | umls:C0751122 | UNIPROT | This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes. | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 165992302 | G | C,A |
rs121917922 | 18930999 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients. | 0.370955127 | 2009 | SCN1A;LOC102724058 | 2 | 165992302 | G | C,A |
rs121917923 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166047725 | G | T,A |
rs121917923 | 17561957 | 6323 | SCN1A | umls:C0751122 | UNIPROT | This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes. | 0.370955127 | 2007 | SCN1A | 2 | 166047725 | G | T,A |
rs121917924 | 17561957 | 6323 | SCN1A | umls:C0751122 | UNIPROT | This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes. | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 165998106 | C | A |
rs121917925 | 17561957 | 6323 | SCN1A | umls:C0751122 | UNIPROT | This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes. | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 166002516 | T | A |
rs121917926 | 17561957 | 6323 | SCN1A | umls:C0751122 | UNIPROT | This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes. | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 165992129 | A | G |
rs121917927 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166046969 | C | T |
rs121917927 | 12754708 | 6323 | SCN1A | umls:C0751122 | UNIPROT | De novo SCN1A mutations are a major cause of severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A | 2 | 166046969 | C | T |
rs121917928 | 17561957 | 6323 | SCN1A | umls:C0751122 | UNIPROT | This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes. | 0.370955127 | 2007 | SCN1A | 2 | 166048949 | C | A |
rs121917929 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A | 2 | 166046970 | G | T,A |
rs121917929 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166046970 | G | T,A |
rs121917933 | 12821740 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A | 2 | 166073388 | C | A |
rs121917934 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A | 2 | 166054756 | T | G |
rs121917935 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A | 2 | 166054660 | C | T |
rs121917936 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A | 2 | 166052896 | G | T |
rs121917937 | 12821740 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A | 2 | 166052866 | A | C |
rs121917937 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166052866 | A | C |
rs121917938 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166051845 | A | G |
rs121917938 | 12821740 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A | 2 | 166051845 | A | G |
rs121917939 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A | 2 | 166047648 | G | C |
rs121917940 | 12821740 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A | 2 | 166046871 | A | T |
rs121917941 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A | 2 | 166039577 | G | C |
rs121917942 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A | 2 | 166039476 | C | T |
rs121917943 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A | 2 | 166037897 | A | G |
rs121917944 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A;LOC102724058 | 2 | 166002479 | A | C |
rs121917945 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A;LOC102724058 | 2 | 165998162 | G | A |
rs121917946 | 12821740 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 165998126 | A | G |
rs121917947 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A;LOC102724058 | 2 | 165998090 | A | G |
rs121917948 | 12821740 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 165992273 | G | C |
rs121917949 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A;LOC102724058 | 2 | 165992134 | A | G,C |
rs121917950 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A;LOC102724058 | 2 | 165991990 | C | T |
rs121917951 | 17054684 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations. | 0.370955127 | 2006 | SCN1A;LOC102724058 | 2 | 165991957 | G | A |
rs121917952 | 12821740 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 165991936 | A | G |
rs121917957 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166047667 | C | T |
rs121917958 | 18413471 | 6323 | SCN1A | umls:C0751122 | UNIPROT | An additional search for SCN1A intragenic microdeletions in the remaining patients with SMEI/SMEI-borderland and no point mutations was also negative. | 0.370955127 | 2008 | SCN1A | 2 | 166047699 | A | T,G |
rs121917959 | 18413471 | 6323 | SCN1A | umls:C0751122 | UNIPROT | An additional search for SCN1A intragenic microdeletions in the remaining patients with SMEI/SMEI-borderland and no point mutations was also negative. | 0.370955127 | 2008 | SCN1A | 2 | 166058599 | C | T,G |
rs121917960 | 18413471 | 6323 | SCN1A | umls:C0751122 | UNIPROT | An additional search for SCN1A intragenic microdeletions in the remaining patients with SMEI/SMEI-borderland and no point mutations was also negative. | 0.370955127 | 2008 | SCN1A;LOC102724058 | 2 | 166002753 | C | T |
rs121917961 | 18413471 | 6323 | SCN1A | umls:C0751122 | UNIPROT | An additional search for SCN1A intragenic microdeletions in the remaining patients with SMEI/SMEI-borderland and no point mutations was also negative. | 0.370955127 | 2008 | SCN1A;LOC102724058 | 2 | 166002683 | C | G |
rs121917962 | 18413471 | 6323 | SCN1A | umls:C0751122 | UNIPROT | An additional search for SCN1A intragenic microdeletions in the remaining patients with SMEI/SMEI-borderland and no point mutations was also negative. | 0.370955127 | 2008 | SCN1A;LOC102724058 | 2 | 165998129 | T | C |
rs121917963 | 18413471 | 6323 | SCN1A | umls:C0751122 | UNIPROT | An additional search for SCN1A intragenic microdeletions in the remaining patients with SMEI/SMEI-borderland and no point mutations was also negative. | 0.370955127 | 2008 | SCN1A;LOC102724058 | 2 | 166013829 | A | G |
rs121917964 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A | 2 | 166073371 | T | C |
rs121917965 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A | 2 | 166058652 | G | A |
rs121917965 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166058652 | G | A |
rs121917966 | 16713920 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Clinical-molecular correlation showed mutations in eight of eight cases with phenotypes of SMEI, in three of four cases with borderline SMEI, but not in two cases with Lennox-Gastaut syndrome. | 0.370955127 | 2006 | SCN1A | 2 | 166046940 | A | G |
rs121917967 | 16713920 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Clinical-molecular correlation showed mutations in eight of eight cases with phenotypes of SMEI, in three of four cases with borderline SMEI, but not in two cases with Lennox-Gastaut syndrome. | 0.370955127 | 2006 | SCN1A | 2 | 166046910 | A | T |
rs121917968 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A | 2 | 166041298 | A | G |
rs121917969 | 14738421 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB). | 0.370955127 | 2004 | SCN1A | 2 | 166037891 | A | G |
rs121917970 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A | 2 | 166037889 | A | G |
rs121917971 | 14738421 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB). | 0.370955127 | 2004 | SCN1A | 2 | 166037885 | C | T,G |
rs121917971 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037885 | C | T,G |
rs121917972 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A | 2 | 166037873 | C | T |
rs121917973 | 16713920 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Clinical-molecular correlation showed mutations in eight of eight cases with phenotypes of SMEI, in three of four cases with borderline SMEI, but not in two cases with Lennox-Gastaut syndrome. | 0.370955127 | 2006 | SCN1A;LOC102724058 | 2 | 166012274 | T | G |
rs121917974 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 165999740 | C | G |
rs121917975 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 165994365 | T | C |
rs121917976 | 16713920 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Clinical-molecular correlation showed mutations in eight of eight cases with phenotypes of SMEI, in three of four cases with borderline SMEI, but not in two cases with Lennox-Gastaut syndrome. | 0.370955127 | 2006 | SCN1A;LOC102724058 | 2 | 165992341 | C | T,G |
rs121917977 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 165992156 | A | C |
rs121917978 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 165992113 | G | T,C |
rs121917979 | 19589774 | 6323 | SCN1A | umls:C0751122 | UNIPROT | De novo SCN1A mutations in Dravet syndrome and related epileptic encephalopathies are largely of paternal origin. | 0.370955127 | 2010 | SCN1A;LOC102724058 | 2 | 165992099 | A | G |
rs121917980 | 18930999 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients. | 0.370955127 | 2009 | SCN1A;LOC102724058 | 2 | 165991928 | C | T |
rs121917981 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 165991510 | A | G |
rs121917982 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A | 2 | 166073387 | C | G |
rs121917983 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A | 2 | 166054644 | G | C |
rs121917984 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166052869 | G | C,A |
rs121917984 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A | 2 | 166052869 | G | C,A |
rs121917985 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A | 2 | 166051968 | C | T |
rs121917985 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166051968 | C | T |
rs121917986 | 12083760 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy. | 0.370955127 | 2002 | SCN1A;LOC102724058 | 2 | 166002588 | C | T,G |
rs121917987 | 16713920 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Clinical-molecular correlation showed mutations in eight of eight cases with phenotypes of SMEI, in three of four cases with borderline SMEI, but not in two cases with Lennox-Gastaut syndrome. | 0.370955127 | 2006 | SCN1A;LOC102724058 | 2 | 166002570 | A | C |
rs121917989 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166046882 | A | T,G |
rs121917990 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A | 2 | 166043836 | T | C |
rs121917990 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166043836 | T | C |
rs121917993 | 17347258 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established. | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 165994212 | G | A |
rs121918622 | 10742094 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Mutations of SCN1A, encoding a neuronal sodium channel, in two families with GEFS+2. | 0.370955127 | 2000 | SCN1A;LOC102724058 | 2 | 165992332 | C | T,A |
rs121918623 | 10742094 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Mutations of SCN1A, encoding a neuronal sodium channel, in two families with GEFS+2. | 0.370955127 | 2000 | SCN1A | 2 | 166038098 | G | T,A |
rs121918623 | 18930999 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients. | 0.370955127 | 2009 | SCN1A | 2 | 166038098 | G | T,A |
rs121918624 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166052882 | G | A |
rs121918625 | 11359211 | 6323 | SCN1A | umls:C0751122 | UNIPROT | De novo mutations in the sodium-channel gene SCN1A cause severe myoclonic epilepsy of infancy. | 0.370955127 | 2001 | SCN1A;LOC102724058 | 2 | 166036521 | G | A |
rs121918625 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A;LOC102724058 | 2 | 166036521 | G | A |
rs121918629 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 165992149 | G | A |
rs121918630 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 165994167 | C | A |
rs121918733 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166058684 | A | G |
rs121918733 | 20431604 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome. | 0.370955127 | 2010 | SCN1A | 2 | 166058684 | A | G |
rs121918734 | 20431604 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome. | 0.370955127 | 2010 | SCN1A | 2 | 166058681 | A | G |
rs121918734 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166058681 | A | G |
rs121918735 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166051906 | G | T,A |
rs121918735 | 20431604 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome. | 0.370955127 | 2010 | SCN1A | 2 | 166051906 | G | T,A |
rs121918736 | 20431604 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome. | 0.370955127 | 2010 | SCN1A | 2 | 166037907 | G | A |
rs121918736 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037907 | G | A |
rs121918737 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037868 | A | C |
rs121918737 | 20431604 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome. | 0.370955127 | 2010 | SCN1A | 2 | 166037868 | A | C |
rs121918738 | 20431604 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome. | 0.370955127 | 2010 | SCN1A;LOC102724058 | 2 | 166013820 | G | T,A |
rs121918739 | 20431604 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome. | 0.370955127 | 2010 | SCN1A;LOC102724058 | 2 | 166012210 | T | G |
rs121918740 | 20431604 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome. | 0.370955127 | 2010 | SCN1A;LOC102724058 | 2 | 166012128 | A | G |
rs121918741 | 20431604 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome. | 0.370955127 | 2010 | SCN1A;LOC102724058 | 2 | 165999763 | C | T |
rs121918742 | 18930999 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients. | 0.370955127 | 2009 | SCN1A;LOC102724058 | 2 | 165994241 | C | T,G |
rs121918743 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A | 2 | 166058646 | T | C |
rs121918744 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 165992221 | G | T,A |
rs121918745 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A | 2 | 166058618 | G | A |
rs121918746 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 166013756 | A | T,G |
rs121918747 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 166036523 | T | A |
rs121918748 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 165991783 | A | G |
rs121918749 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A | 2 | 166051890 | C | A |
rs121918750 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A | 2 | 166037844 | T | C |
rs121918751 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 165991841 | A | C |
rs121918752 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 166012199 | G | C |
rs121918753 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A | 2 | 166048886 | C | T |
rs121918754 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A | 2 | 166037787 | C | T |
rs121918755 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 165992381 | G | A |
rs121918756 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 166036529 | A | G |
rs121918757 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 165991853 | A | G |
rs121918758 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A | 2 | 166039590 | T | A |
rs121918759 | 12566275 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 166036445 | T | A |
rs121918760 | 18930999 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients. | 0.370955127 | 2009 | SCN1A;LOC102724058 | 2 | 166002655 | A | T |
rs121918761 | 18930999 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients. | 0.370955127 | 2009 | SCN1A | 2 | 166058582 | A | T |
rs121918762 | 18930999 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients. | 0.370955127 | 2009 | SCN1A | 2 | 166054669 | T | A |
rs121918763 | 18930999 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients. | 0.370955127 | 2009 | SCN1A;LOC102724058 | 2 | 165991929 | G | C,A |
rs121918764 | 20522430 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Mechanisms for variable expressivity of inherited SCN1A mutations causing Dravet syndrome. | 0.370955127 | 2010 | SCN1A;LOC102724058 | 2 | 165996053 | A | G |
rs121918765 | 18930999 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients. | 0.370955127 | 2009 | SCN1A;LOC102724058 | 2 | 165992284 | A | T |
rs121918766 | 19589774 | 6323 | SCN1A | umls:C0751122 | UNIPROT | De novo SCN1A mutations in Dravet syndrome and related epileptic encephalopathies are largely of paternal origin. | 0.370955127 | 2010 | SCN1A | 2 | 166054728 | A | T |
rs121918767 | 19589774 | 6323 | SCN1A | umls:C0751122 | UNIPROT | De novo SCN1A mutations in Dravet syndrome and related epileptic encephalopathies are largely of paternal origin. | 0.370955127 | 2010 | SCN1A | 2 | 166054717 | C | T |
rs121918768 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166046931 | C | A |
rs121918768 | 19589774 | 6323 | SCN1A | umls:C0751122 | UNIPROT | De novo SCN1A mutations in Dravet syndrome and related epileptic encephalopathies are largely of paternal origin. | 0.370955127 | 2010 | SCN1A | 2 | 166046931 | C | A |
rs121918770 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166054710 | C | T,A |
rs121918770 | 12821740 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A | 2 | 166054710 | C | T,A |
rs121918771 | 12821740 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A | 2 | 166051793 | G | A |
rs121918772 | 12821740 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 165998133 | G | T |
rs121918773 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166054672 | A | G |
rs121918773 | 14738421 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB). | 0.370955127 | 2004 | SCN1A | 2 | 166054672 | A | G |
rs121918774 | 14738421 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB). | 0.370955127 | 2004 | SCN1A | 2 | 166037920 | C | G |
rs121918775 | 14738421 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB). | 0.370955127 | 2004 | SCN1A | 2 | 166037886 | G | T,A |
rs121918775 | 15944908 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Severe myoclonic epilepsy in infancy (SMEI), severe idiopathic generalized epilepsy of infancy (SIGEI) with generalized tonic clonic seizures (GTCS), and myoclonic astatic epilepsy (MAE) may show semiological overlaps. | 0.370955127 | 2005 | SCN1A | 2 | 166037886 | G | T,A |
rs121918775 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037886 | G | T,A |
rs121918776 | 14738421 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB). | 0.370955127 | 2004 | SCN1A;LOC102724058 | 2 | 166002692 | A | G |
rs121918777 | 14738421 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB). | 0.370955127 | 2004 | SCN1A;LOC102724058 | 2 | 165992194 | T | C |
rs121918778 | 14738421 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB). | 0.370955127 | 2004 | SCN1A;LOC102724058 | 2 | 165992200 | A | G |
rs121918779 | 14738421 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB). | 0.370955127 | 2004 | SCN1A;LOC102724058 | 2 | 165991933 | T | C |
rs121918780 | 15087100 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Clinical correlations of mutations in the SCN1A gene: from febrile seizures to severe myoclonic epilepsy in infancy. | 0.370955127 | 2004 | SCN1A | 2 | 166051928 | A | T |
rs121918784 | 16525050 | 6323 | SCN1A | umls:C0751122 | UNIPROT | An epilepsy mutation in the sodium channel SCN1A that decreases channel excitability. | 0.370955127 | 2006 | SCN1A | 2 | 166039437 | G | A |
rs121918785 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166039427 | C | T |
rs121918785 | 20110217 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Four novel SCN1A mutations in Turkish patients with severe myoclonic epilepsy of infancy (SMEI). | 0.370955127 | 2010 | SCN1A | 2 | 166039427 | C | T |
rs121918786 | 20110217 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Four novel SCN1A mutations in Turkish patients with severe myoclonic epilepsy of infancy (SMEI). | 0.370955127 | 2010 | SCN1A | 2 | 166037862 | C | T |
rs121918787 | 12083760 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy. | 0.370955127 | 2002 | SCN1A | 2 | 166038017 | A | C |
rs121918788 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037931 | G | A |
rs121918788 | 12083760 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy. | 0.370955127 | 2002 | SCN1A | 2 | 166037931 | G | A |
rs121918789 | 12083760 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy. | 0.370955127 | 2002 | SCN1A;LOC102724058 | 2 | 165999761 | A | G |
rs121918790 | 12083760 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy. | 0.370955127 | 2002 | SCN1A;LOC102724058 | 2 | 165998165 | T | C |
rs121918791 | 12083760 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy. | 0.370955127 | 2002 | SCN1A;LOC102724058 | 2 | 165992333 | G | A |
rs121918792 | 12083760 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy. | 0.370955127 | 2002 | SCN1A;LOC102724058 | 2 | 165992255 | C | G |
rs121918793 | 12083760 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy. | 0.370955127 | 2002 | SCN1A;LOC102724058 | 2 | 165991549 | G | A |
rs121918794 | 12083760 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy. | 0.370955127 | 2002 | SCN1A;LOC102724058 | 2 | 166012194 | A | G |
rs121918795 | 12754708 | 6323 | SCN1A | umls:C0751122 | UNIPROT | De novo SCN1A mutations are a major cause of severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A | 2 | 166037905 | G | C |
rs121918796 | 12754708 | 6323 | SCN1A | umls:C0751122 | UNIPROT | De novo SCN1A mutations are a major cause of severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A | 2 | 166037847 | A | G |
rs121918797 | 12754708 | 6323 | SCN1A | umls:C0751122 | UNIPROT | De novo SCN1A mutations are a major cause of severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 165992293 | A | G |
rs121918798 | 12754708 | 6323 | SCN1A | umls:C0751122 | UNIPROT | De novo SCN1A mutations are a major cause of severe myoclonic epilepsy of infancy. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 165992029 | C | T |
rs121918800 | 16458823 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Recurrent de novo mutations of SCN1A in severe myoclonic epilepsy of infancy. | 0.370955127 | 2006 | SCN1A;LOC102724058 | 2 | 166013757 | C | G |
rs121918803 | 14504318 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The rate of SCN1A mutations in this cohort of SMEI patients suggests that other factors may be important in SMEI. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 166009745 | C | G |
rs121918804 | 14504318 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The rate of SCN1A mutations in this cohort of SMEI patients suggests that other factors may be important in SMEI. | 0.370955127 | 2003 | SCN1A;LOC102724058 | 2 | 165991632 | C | T,G |
rs121918805 | 17507202 | 6323 | SCN1A | umls:C0751122 | UNIPROT | The SCN1A gene was screened for mutations in three unrelated Japanese families with generalized epilepsy with febrile seizure plus (GEFS+), febrile seizure with myoclonic seizures, or intractable childhood epilepsy with generalized tonic-clonic seizures (ICEGTC). | 0.370955127 | 2007 | SCN1A;LOC102724058 | 2 | 166002660 | C | T |
rs121918806 | 19589774 | 6323 | SCN1A | umls:C0751122 | UNIPROT | De novo SCN1A mutations in Dravet syndrome and related epileptic encephalopathies are largely of paternal origin. | 0.370955127 | 2010 | SCN1A;LOC102724058 | 2 | 165998166 | G | T |
rs121918808 | 18930999 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients. | 0.370955127 | 2009 | SCN1A;LOC102724058 | 2 | 165994164 | C | T |
rs121918809 | 19563458 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Novel SCN1A mutations in Indonesian patients with severe myoclonic epilepsy in infancy. | 0.370955127 | 2010 | SCN1A;LOC102724058 | 2 | 165992009 | A | C |
rs121918810 | 20392657 | 6323 | SCN1A | umls:C0751122 | UNIPROT | Hepatic coma culminating in severe brain damage in a child with a SCN1A mutation. | 0.370955127 | 2010 | SCN1A;LOC102724058 | 2 | 165992365 | A | T |
rs121918816 | 16122630 | 6323 | SCN1A | umls:C0751122 | UNIPROT | A missense mutation in SCN1A in brothers with severe myoclonic epilepsy in infancy (SMEI) inherited from a father with febrile seizures. | 0.370955127 | 2005 | SCN1A;LOC102724058 | 2 | 165992137 | C | T |
rs138877187 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166045081 | G | A,T |
rs397514459 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166039428 | G | C,A |
rs398123579 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166047769 | C | G |
rs398123580 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166047635 | A | - |
rs398123584 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166043946 | T | C,A |
rs398123585 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166043875 | G | T,A |
rs398123588 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166039436 | C | T |
rs398123588 | 24277604 | 6323 | SCN1A | umls:C0751122 | BeFree | We previously characterized two Nav1.1 mutants-R859H (GEFS+) and R865G (DS)-at room temperature and reported a mixture of biophysical gating defects that could not easily predict the phenotype presentation as either GEFS+ or DS. | 0.370955127 | 2014 | SCN1A | 2 | 166039436 | C | T |
rs727504140 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166038134 | T | C |
rs727504142 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166052847 | C | G |
rs760361423 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166058645 | C | A,T |
rs764444350 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166073501 | T | A,C |
rs767045134 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166041293 | T | A,C |
rs773407463 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166051936 | A | C,G |
rs786200989 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166039591 | - | A |
rs794726695 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166047679 | A | - |
rs794726697 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166038129 | G | A |
rs794726704 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166044045 | A | - |
rs794726708 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037843 | A | C |
rs794726711 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166058616 | G | T |
rs794726712 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166039424 | A | C |
rs794726713 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166047721 | T | C,A |
rs794726714 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037774 | AC | - |
rs794726715 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037776 | C | - |
rs794726716 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037846 | C | T |
rs794726717 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166045045 | - | G |
rs794726718 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037930 | C | T,G |
rs794726719 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166052871 | C | G |
rs794726721 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037994 | G | T |
rs794726724 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166052884 | AGAA | - |
rs794726725 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166046948 | A | T |
rs794726730 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166042334 | G | A |
rs794726732 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166047661 | A | T |
rs794726736 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166043974 | G | A |
rs794726738 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166039488 | GC | - |
rs794726742 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166041433 | C | T,A |
rs794726743 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166041385 | C | A |
rs794726746 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A;LOC102724058 | 2 | 166036492 | A | C |
rs794726747 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166042397 | T | A |
rs794726749 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166045042 | C | A |
rs794726750 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166041343 | - | GGTC |
rs794726751 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166051932 | T | - |
rs794726753 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166047651 | G | T |
rs794726755 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166051955 | G | T |
rs794726756 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A;LOC102724058 | 2 | 166036411 | TCCTT | - |
rs794726761 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166038032 | A | G |
rs794726762 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166073353 | C | T,G |
rs794726764 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166056501 | G | C |
rs794726765 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166047626 | C | A |
rs794726766 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166041343 | G | A |
rs794726767 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166047741 | CA | - |
rs794726768 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166047749 | T | C |
rs794726771 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166051914 | A | G |
rs794726772 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037775 | C | A |
rs794726773 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166045040 | T | C |
rs794726775 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166039420 | T | A |
rs794726776 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166046963 | GC | - |
rs794726777 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166046964 | - | T |
rs794726778 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166043878 | G | A |
rs794726782 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166047764 | A | G |
rs794726786 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166038107 | G | T |
rs794726787 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166038119 | T | - |
rs794726788 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166051778 | CCATTATAAT | - |
rs794726790 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166045189 | G | A |
rs794726791 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166073437 | G | - |
rs794726792 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166047682 | AAAGCCCAACTGAAGGTATC | - |
rs794726793 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166058630 | A | G |
rs794726794 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166039475 | T | C |
rs794726795 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166042289 | A | T |
rs794726796 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166058661 | CCTT | - |
rs794726797 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166048889 | G | A |
rs794726798 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166048907 | C | T |
rs794726799 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166047668 | G | A |
rs794726803 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166058569 | T | C |
rs794726805 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166039533 | A | C |
rs794726806 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166042368 | G | - |
rs794726807 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166046802 | C | A |
rs794726808 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037844 | TACAGTCCCA | - |
rs794726810 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166046846 | A | - |
rs794726811 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037942 | C | A |
rs794726812 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166051857 | - | TATAC |
rs794726813 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A;LOC102724058 | 2 | 166036460 | T | - |
rs794726815 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166038044 | A | T |
rs794726818 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166046949 | TG | - |
rs794726820 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166041327 | - | A |
rs794726823 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037819 | C | A |
rs794726824 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166048950 | C | T |
rs794726826 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166046888 | G | A |
rs794726827 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166054637 | C | T,G,A |
rs794726828 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037793 | C | T |
rs794726829 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166045263 | TCTG | - |
rs794726830 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A;LOC102724058 | 2 | 166036496 | GA | - |
rs794726831 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166058573 | T | A |
rs794726833 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166054635 | T | G |
rs794726834 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166043908 | C | A |
rs794726837 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166051705 | A | C |
rs794726838 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166043742 | G | A |
rs794726840 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166056410 | C | G |
rs794726842 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166037786 | C | T |
rs794726843 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166048890 | C | A |
rs794726844 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166047751 | T | C |
rs794726846 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166051751 | - | CA |
rs794726847 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166051857 | T | G |
rs794726848 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166073552 | C | T |
rs794726849 | NA | 6323 | SCN1A | umls:C0751122 | CLINVAR | NA | 0.370955127 | NA | SCN1A | 2 | 166056451 | T | C |
GWASdb Annotation(Total Genotypes:0) | |
---|---|
(Waiting for update.) |
GWASdb Snp Trait(Total Genotypes:0) | |
---|---|
(Waiting for update.) |
Mapped by lexical matching(Total Items:10) | ||||
---|---|---|---|---|
HP ID | HP Name | MP ID | MP Name | Annotation |
HP:0002197 | Generalized seizures | MP:0009358 | environmentally induced seizures | seizure activity response due to changes in ambient habitat including room temperature, lighting, sounds, touching, and/ or moving cage |
HP:0000992 | Cutaneous photosensitivity | MP:0001202 | skin photosensitivity | abnormally heightened reactivity of the skin to sunlight |
HP:0002121 | Absence seizures | MP:0009358 | environmentally induced seizures | seizure activity response due to changes in ambient habitat including room temperature, lighting, sounds, touching, and/ or moving cage |
HP:0002384 | Focal seizures with impairment of consciousness or awareness | MP:0004686 | decreased length of long bones | reduced end-to-end length of the several elongated bones of the extremities |
HP:0002123 | Generalized myoclonic seizures | MP:0009358 | environmentally induced seizures | seizure activity response due to changes in ambient habitat including room temperature, lighting, sounds, touching, and/ or moving cage |
HP:0001263 | Global developmental delay | MP:0002084 | abnormal developmental patterning | abnormal systematic arrangement of the developing body along an axis |
HP:0001252 | Muscular hypotonia | MP:0004144 | hypotonia | decreased muscle tension resulting in limpness of the muscles in the resting state, not to be confused with weakness |
HP:0007334 | Bilateral convulsive seizures | MP:0009358 | environmentally induced seizures | seizure activity response due to changes in ambient habitat including room temperature, lighting, sounds, touching, and/ or moving cage |
HP:0002266 | Focal clonic seizures | MP:0003996 | clonic seizures | increased number or decreased threshold for the induction of a seizure characterized by unilateral or bilateral rhythmic jerking movements of the arms and legs caused by alternating contraction and relaxation of muscle |
HP:0002373 | Febrile seizures | MP:0009358 | environmentally induced seizures | seizure activity response due to changes in ambient habitat including room temperature, lighting, sounds, touching, and/ or moving cage |
Mapped by homologous gene(Total Items:15) | ||||
---|---|---|---|---|
HP ID | HP Name | MP ID | MP Name | Annotation |
HP:0001252 | Muscular hypotonia | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
HP:0001263 | Global developmental delay | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
HP:0002123 | Generalized myoclonic seizures | MP:0020301 | short tongue | decreased length of the mobile mass of muscular tissue and surrounding epithelial tissue occupying the cavity of the mouth and forming part of the floor |
HP:0000992 | Cutaneous photosensitivity | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
HP:0001250 | Seizures | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
HP:0001337 | Tremor | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
HP:0002353 | EEG abnormality | MP:0020214 | susceptible to malignant hyperthermia | increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine |
HP:0000708 | Behavioral abnormality | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
HP:0007334 | Bilateral convulsive seizures | MP:0014142 | increased body fat mass | increased physical bulk or volume of fat in the whole body |
HP:0002266 | Focal clonic seizures | MP:0011110 | preweaning lethality, incomplete penetrance | the appearance of lower than Mendelian ratios of organisms of a given genotype due to death of some, but not all of the organisms between fertilization and weaning age (Mus: approximately 3-4 weeks of age) |
HP:0002121 | Absence seizures | MP:0020301 | short tongue | decreased length of the mobile mass of muscular tissue and surrounding epithelial tissue occupying the cavity of the mouth and forming part of the floor |
HP:0001251 | Ataxia | MP:0020301 | short tongue | decreased length of the mobile mass of muscular tissue and surrounding epithelial tissue occupying the cavity of the mouth and forming part of the floor |
HP:0002373 | Febrile seizures | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
HP:0002197 | Generalized seizures | MP:0013603 | abnormal fetal Leydig cell differentiation | atypical formation of or inability to produce the first or fetal population of Leydig cells (FLCs); in mice, FLCs arise in the testicular interstitium between E12.5 and E13.0, approximately 1 day after the appearance of Sertoli cells; Sertoli cells trigge |
HP:0002384 | Focal seizures with impairment of consciousness or awareness | MP:0013906 | absent embryonic telencephalon | absence of the paired diverticula of the embryonic telencephalon, from which the forebrain develops |
Disease ID | 267 |
---|---|
Disease | dravet syndrome |
Case | (Waiting for update.) |