| danon disease | ||||
| Disease ID | 767 |
|---|---|
| Disease | danon disease |
| Definition | A genetic metabolic disorder causing hypertrophic cardiomyopathy. Mutations of the LAMP2 gene have been reported in association with this disease. |
| Synonym | antopol disease cardiomyopathies, glycogen storage cardiomyopathy, glycogen storage danon disease (disorder) disease, antopol glycogen storage cardiomyopathies glycogen storage cardiomyopathy glycogen storage disease iib glycogen storage disease limited to the heart glycogen storage disease type 2b glycogen storage disease type iib glycogen storage disease type iib [disease/finding] gsd iib, formerly gsd2b, formerly lysosomal glycogen storage disease with normal acid maltase lysosomal glycogen storage disease without acid maltase deficiency lysosomal glycogen storage disease without acid maltase deficiency, formerly pseudoglycogenosis 2 pseudoglycogenosis 2s pseudoglycogenosis ii pseudoglycogenosis iis vacuolar cardiomyopathy and myopathy, x linked vacuolar cardiomyopathy and myopathy, x-linked x linked vacuolar cardiomyopathy and myopathy x-linked vacuolar cardiomyopathy and myopathy |
| Orphanet | |
| OMIM | |
| DOID | |
| UMLS | C0878677 |
| MeSH | |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:4) C0878544 | cardiomyopathy | 2 C0026848 | myopathy | 1 C0007193 | dilated cardiomyopathy | 1 C0035334 | cone-rod dystrophy | 1 |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:19) 1244 | ABCC2 | 1.404 | DISEASES 270 | AMPD1 | 2.432 | DISEASES 23607 | CD2AP | 3.145 | DISEASES 1497 | CTNS | 1.977 | DISEASES 1756 | DMD | 2.486 | DISEASES 10020 | GNE | 1.887 | DISEASES 2813 | GP2 | 2.077 | DISEASES 3908 | LAMA2 | 1.618 | DISEASES 3916 | LAMP1 | 3.531 | DISEASES 3920 | LAMP2 | 7.817 | DISEASES 378884 | NHLRC1 | 2.024 | DISEASES 4908 | NTF3 | 1.464 | DISEASES 30849 | PIK3R4 | 3.206 | DISEASES 1827 | RCAN1 | 1.981 | DISEASES 5962 | RDX | 1.742 | DISEASES 6103 | RPGR | 1.756 | DISEASES 6262 | RYR2 | 1.477 | DISEASES 6443 | SGCB | 1.227 | DISEASES 26503 | SLC17A5 | 2.691 | DISEASES |
| Locus | (Waiting for update.) |
| Disease ID | 767 |
|---|---|
| Disease | danon disease |
| Integrated Phenotype | (Waiting for update.) |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:8) |
| Disease ID | 767 |
|---|---|
| Disease | danon disease |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:3) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Manually Genotypes:33) | |||
|---|---|---|---|
| Gene | Mutation | DOI | Article Title |
| LAMP2 | Promoter, c.-22_30delCGCCGCCGT | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 1, c.36_42delAGGGCTC | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 1, c.1-?_64+? | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | IVS-1, c.64+1 G>A | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | IVS-1, c.64+1 G>T | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 2, c.102-103 delAG | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 2, c.138 G>A | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 2, c.179 delC | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | IVS-2, c.183+1 G>A | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 3, c.247C>T | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 3, c.294 G>A | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 3, c.327T>A | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exons 4–10, c.398-?_1233+?del | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 4, c.467 T>G | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 4, c.470 C>G | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 4, c.507 G>A | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 4, c.520 C>T | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 5, c.573 delA | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 5, c.716 delT | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | IVS-5, c.742-4_742+6 delGAAGGTTGCT | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | IVS-6, c.864+1-4 del GTGA | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | IVS-6, c.865-1 G>C | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | IVS-6, c.865-2 A>G | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | IVS-6, c.865-3 C>A | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 7, c.874-897del AACCGATTTTATCTGAAGGAAGTG | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 7, c.877 C>T | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 7, c.883-884 insT | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 7, c.928 G>A | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 8, c.961 T>C | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 8, c.1075 C>T | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 8, c. 1082 delA | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | IVS-8, c.1093+1 G>C | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
| LAMP2 | Exon 9B, c.-1137-1140 del TATA/ins GCTGGTCCCAAT | doi:10.1097/GIM.0b013e31820ad795 | Natural history of Danon disease |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:34) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs104894857 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120449006 | G | A |
| rs104894858 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120442599 | C | T |
| rs104894859 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120441862 | A | G |
| rs121908987 | 20031621 | 51422 | PRKAG2 | umls:C0878677 | BeFree | Humans with an R302Q mutation in AMPKgamma(2) (the PRKAG2 gene) develop a glycogen storage cardiomyopathy characterized by a familial form of Wolff-Parkinson-White syndrome and cardiac hypertrophy. | 0.001357209 | 2009 | PRKAG2 | 7 | 151576412 | C | T,A |
| rs137852527 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120449086 | A | T |
| rs193922649 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120449063 | T | - |
| rs397516736 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120456651 | A | T,G,C |
| rs397516738 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120455563 | A | - |
| rs397516739 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120455536 | - | T |
| rs397516740 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120455461 | C | T |
| rs397516743 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120456771 | T | C |
| rs397516751 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120446299 | ACTC | - |
| rs397516752 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120442663 | C | G |
| rs727503118 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120442650 | G | T,A |
| rs727503119 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120446304 | C | T,A |
| rs727503120 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120456650 | C | T |
| rs727504262 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120441895 | C | T |
| rs727504557 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120441824 | T | - |
| rs727504597 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120441803 | A | - |
| rs727504600 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120456713 | A | - |
| rs727504648 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120446317 | AA | - |
| rs727504742 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120441729 | C | T |
| rs730880344 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120456704 | - | AT |
| rs730880479 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120456646 | C | T |
| rs730880482 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120447845 | T | C |
| rs730880483 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120446374 | G | T |
| rs730880485 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120446303 | A | G |
| rs730880486 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120442640 | A | G |
| rs730880490 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120469104 | A | T |
| rs730880491 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120448990 | T | - |
| rs730880492 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120447993 | - | TGTTG |
| rs730880493 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120447930 | - | T |
| rs730880496 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120456770 | C | G |
| rs730880498 | NA | 3920 | LAMP2 | umls:C0878677 | CLINVAR | NA | 0.583122217 | NA | LAMP2 | X | 120441849 | A | - |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:0) |
|---|
| (Waiting for update.) |
Mapped by homologous gene(Total Items:0) |
|---|
| (Waiting for update.) |
| Disease ID | 767 |
|---|---|
| Disease | danon disease |
| Case | (Waiting for update.) |