eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| congenital intrauterine infection-like syndrome | ||||
| Disease ID | 1778 |
|---|---|
| Disease | congenital intrauterine infection-like syndrome |
| Definition | Syndrome with the presence of microcephaly and intracranial calcifications at birth accompanied by neurological delay, seizures and a clinical course similar to that seen in patients after intrauterine infection with Toxoplasma gondii, Rubella, Cytomegalovirus, Herpes simplex (so-called TORCH syndrome), or other agents, despite repeated tests revealing the absence of any known infectious agent. The clinical presentation of the reported cases is rather heterogeneous with variable manifestations including intrauterine growth retardation, hepatosplenomegaly, cerebellar hypoplasia or atrophy and congenital cataract. The cause remains unknown. Several familial cases, compatible with an autosomal recessive pattern of inheritance have been described. |
| Synonym | baraitser brett piesowicz syndrome bilateral band-like calcification with polymicrogyria congenital intrauterine infection-like syndrome (disorder) microcephaly intracranial calcification microcephaly, intracranial calcification, intellectual disability syndrome pseudo-torch syndrome |
| Orphanet | |
| OMIM | |
| DOID | |
| UMLS | C2931662 |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:5) |
| Locus | Symbol | Locus(Total Locus:1) OCLN | 5q13.2 |
| Disease ID | 1778 |
|---|---|
| Disease | congenital intrauterine infection-like syndrome |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:7) HP:0001250 | Seizures HP:0001257 | Spasticity HP:0001347 | Hyperreflexia HP:0000252 | Microcephaly HP:0100022 | Abnormality of movement HP:0002514 | Cerebral calcification HP:0002120 | Cerebral cortical atrophy |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:1) |
| Disease ID | 1778 |
|---|---|
| Disease | congenital intrauterine infection-like syndrome |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:3) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs267606926 | NA | 100506658 | OCLN | umls:C3489725 | CLINVAR | NA | 0.480542884 | NA | OCLN | 5 | 69509746 | T | C |
| rs797045840 | NA | 100506658 | OCLN | umls:C3489725 | CLINVAR | NA | 0.480542884 | NA | OCLN | 5 | 69534844 | G | A |
| rs797045841 | NA | 100506658 | OCLN | umls:C3489725 | CLINVAR | NA | 0.480542884 | NA | OCLN | 5 | 69509263 | GGACCTCTCCTCCAGGAGTGAT | - |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:2) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0100022 | Abnormality of movement | MP:0005223 | abnormal dorsal-ventral polarity of the somites | anomalous development or formation of the pattern of somites along the axis that runs from the front (ventral) to the back (dorsal) surface of the body |
| HP:0002120 | Cerebral cortical atrophy | MP:0012506 | brain atrophy | acquired diminution of the size of the brain associated with wasting as from death and reabsorbtion of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal chan |
Mapped by homologous gene(Total Items:7) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0100022 | Abnormality of movement | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0001257 | Spasticity | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0002120 | Cerebral cortical atrophy | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001250 | Seizures | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0001347 | Hyperreflexia | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0000252 | Microcephaly | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0002514 | Cerebral calcification | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| Disease ID | 1778 |
|---|---|
| Disease | congenital intrauterine infection-like syndrome |
| Case | (Waiting for update.) |