eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine

HOME
QUERY
- DISEASE
- GENOTYPE
NETWORK
- PHENOTYPE
- GENE
- COMMON
- DISEASE PAIR
DOWNLOAD
SUBMIT CASE
HELP&FAQ
- HELP&FAQ
- CONTACT US


	congenital chloride diarrhea

Disease ID	1275
Disease	congenital chloride diarrhea
Definition	Congenital chloride diarrhea (CCD, also congenital chloridorrhea or Darrow Gamble syndrome) is a genetic disorder due to an autosomal recessive mutation on chromosome 7. The mutation is in downregulated-in-adenoma (DRA), a gene that encodes a membrane protein of intestinal cells. The protein belongs to the solute carrier 26 family of membrane transport proteins.[1] More than 20 mutations in the gene are known to date. A rare disease, CCD occurs in all parts of the world but is more common in some populations with genetic founder effects,[2] most notably in Finland. - Wikipedia Reference: https://en.wikipedia.org/wiki/congenital chloride diarrhea
Synonym	chloride diarrhea, congenital, finnish type chloridorrhea, congenital congenital chloridorrhea congenital chloridorrhoea congenital secretory diarrhea, chloride type congenital secretory diarrhea, chloride type (disorder) congenital secretory diarrhoea, chloride type darrow-gamble disease defective cl-/hco-3 exchange in ileum and colon defective cl-/hco-3 exchange in ileum and/or colon defective cl^-/hco^-₃ exchange in ileum and colon defective cl^-/hco^-₃ exchange in ileum and/or colon defective cl^-^/hco^-^>3< exchange in ileum and colon defective cl^-^/hco^-^>3< exchange in ileum and/or colon diar1 diarrhea 1, secretory chloride, congenital
Orphanet	ORPHANET:53689
OMIM	OMIM:214700
DOID	DOID:0060296
UMLS	C0267662
SNOMED-CT	SNOMEDCT_US_2016_09_01:24412005
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:1) C0004775 \| bartter syndrome \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:1) 1811 \| SLC26A3 \| CLINVAR;ORPHANET;UNIPROT
Inferring Gene	(Waiting for update.)
Text Mined Gene	(Waiting for update.)
Locus	Symbol \| Locus(Total Locus:1) SLC26A3 \| 7q22.3-q31.1

Disease ID	1275
Disease	congenital chloride diarrhea
Integrated Phenotype	(Waiting for update.)
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:1) HP:0004401 \| Meconium ileus \| 1

Disease ID	1275
Disease	congenital chloride diarrhea
Manually Symptom	(Waiting for update.)
Text Mined Symptom	(Waiting for update.)

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:53)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs121913030	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107791841	T	A
rs121913031	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107772090	-	GAT
rs121913032	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107791059	C	A
rs121913033	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107779689	C	T
rs140426439	19861545	1811	SLC26A3	umls:C0267662	BeFree	The molecular diagnosis was based on the finding of a homozygous missense D652N mutation at a position in SLC26A3 (the known congenital chloride diarrhea locus) that is virtually completely conserved in orthologues and paralogues from invertebrates to humans, and clinical follow-up confirmed the diagnosis.	0.442442977	2009	SLC26A3	7	107773973	C	T
rs143839547	21394828	1811	SLC26A3	umls:C0267662	UNIPROT	Update on SLC26A3 mutations in congenital chloride diarrhea.	0.442442977	2011	SLC26A3	7	107783020	G	A
rs386833444	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107783296	C	T,G
rs386833445	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107783277	AACCATTGCGATGCCGAA	GGCATC
rs386833446	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107783077	C	G
rs386833447	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107783064	TA	-
rs386833448	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107782802	G	A
rs386833449	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107779764	C	T
rs386833450	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107779732	AA	-
rs386833451	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107779715	G	A
rs386833452	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107779713	C	-
rs386833453	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107779688	G	A
rs386833454	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107779672	T	A
rs386833455	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107778282	C	T
rs386833456	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107793856	TTCTCTTGGCCTT	-
rs386833457	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107778202	A	C
rs386833458	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107776708	T	-
rs386833459	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107776704	G	-
rs386833460	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107776694	GC	-
rs386833461	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107776667	GTTG	-
rs386833462	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107776662	T	C
rs386833463	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107776658	C	G
rs386833464	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107776640	ATA	-
rs386833465	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107776520	T	-
rs386833466	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107776503	AGA	G
rs386833467	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107776498	A	T
rs386833468	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107793835	-	G
rs386833469	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107773937	C	-
rs386833471	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107767909	C	A
rs386833472	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107767866	CC	AAATTTTGAATTTTCACTTCAAAACCGGT
rs386833473	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107767855	T	-
rs386833474	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107767839	A	C
rs386833475	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107767763	T	C
rs386833476	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107793742	-	TT
rs386833477	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107791880	A	-
rs386833478	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107791868	A	-
rs386833479	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107791854	C	T
rs386833480	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107791232	G	T,C,A
rs386833481	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107791226	G	C,A
rs386833482	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107791226	G	-
rs386833483	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107791210	C	T
rs386833484	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107791093	C	G
rs386833485	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107789689	C	T,A
rs386833486	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107789690	T	C
rs386833487	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107789649	A	C
rs386833488	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107789643	A	G
rs386833489	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107789600	T	G
rs386833490	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107786883	G	T,A
rs386833491	NA	1811	SLC26A3	umls:C0267662	CLINVAR	NA	0.442442977	NA	SLC26A3	7	107786845	ACC	-

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:0)
(Waiting for update.)

Disease ID	1275
Disease	congenital chloride diarrhea
Case	(Waiting for update.)