| citrullinemia type ii | ||||
| Disease ID | 1452 |
|---|---|
| Disease | citrullinemia type ii |
| Definition | A severe subtype of citrin deficiency characterized clinically by adult onset, recurrent episodes of hyperammonemia and associated neuropsychiatric symptoms such as nocturnal delirium, confusion, restlessness, disorientation, drowsiness, memory loss, abnormal behavior, seizures and coma. |
| Synonym | adult onset citrin deficiency adult onset type 2 citrullinaemia adult onset type 2 citrullinemia adult-onset citrullinemia type 2 citrin deficiency citrullinaemia type ii citrullinemia type ii (disorder) citrullinemia, type ii, adult-onset ctln2 |
| Orphanet | |
| OMIM | |
| UMLS | C1863844 |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:8) C0008372 | intrahepatic cholestasis | 2 C0008370 | cholestasis | 2 C0019151 | hepatic encephalopathy | 2 C0005411 | congenital biliary atresia | 1 C0033975 | psychosis | 1 C0019158 | hepatitis | 1 C0019204 | hepatocellular carcinoma | 1 C0005411 | biliary atresia | 1 |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Text Mined Gene | (Waiting for update.) |
| Locus | Symbol | Locus(Total Locus:1) SLC25A13 | 7q21.3 |
| Disease ID | 1452 |
|---|---|
| Disease | citrullinemia type ii |
| Integrated Phenotype | (Waiting for update.) |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:13) HP:0001406 | Intrahepatic cholestasis | 2 HP:0001396 | Cholestasis | 2 HP:0001298 | Encephalopathy | 2 HP:0002480 | Hepatic encephalopathy | 2 HP:0030731 | Carcinoma | 1 HP:0000709 | Psychosis | 1 HP:0005912 | Biliary duct atresia | 1 HP:0001987 | Hyperammonemia | 1 HP:0200123 | Chronic liver inflammation | 1 HP:0012378 | Fatigue | 1 HP:0012115 | Liver inflammation | 1 HP:0002039 | Anorexia | 1 HP:0001402 | Hepatocellular carcinoma | 1 |
| Disease ID | 1452 |
|---|---|
| Disease | citrullinemia type ii |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:2) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:7) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs121908532 | NA | 10165 | SLC25A13 | umls:C1863844 | CLINVAR | NA | 0.368610195 | NA | SLC25A13 | 7 | 96121733 | C | T |
| rs80338719 | NA | 10165 | SLC25A13 | umls:C1863844 | CLINVAR | NA | 0.368610195 | NA | SLC25A13 | 7 | 96191189 | G | T,A |
| rs80338720 | NA | 10165 | SLC25A13 | umls:C1863844 | CLINVAR | NA | 0.368610195 | NA | SLC25A13 | 7 | 96189373 | ATAC | - |
| rs80338722 | NA | 10165 | SLC25A13 | umls:C1863844 | CLINVAR | NA | 0.368610195 | NA | SLC25A13 | 7 | 96184276 | C | T |
| rs80338723 | NA | 10165 | SLC25A13 | umls:C1863844 | CLINVAR | NA | 0.368610195 | NA | SLC25A13 | 7 | 96170044 | C | T,G,A |
| rs80338725 | NA | 10165 | SLC25A13 | umls:C1863844 | CLINVAR | NA | 0.368610195 | NA | SLC25A13 | 7 | 96121928 | - | CCCGGGCAGCCACCTGTAATCTC |
| rs80338726 | NA | 10165 | SLC25A13 | umls:C1863844 | CLINVAR | NA | 0.368610195 | NA | SLC25A13 | 7 | 96121696 | - | T |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:0) |
|---|
| (Waiting for update.) |
Mapped by homologous gene(Total Items:0) |
|---|
| (Waiting for update.) |
| Disease ID | 1452 |
|---|---|
| Disease | citrullinemia type ii |
| Case | (Waiting for update.) |