| cartilage-hair hypoplasia | ||||
| Disease ID | 425 |
|---|---|
| Disease | cartilage-hair hypoplasia |
| Definition | A rare autosomal recessive inherited disorder caused by mutation in the gene for RNAase RMRP. It is characterized by short-limb dwarfism, presence of fine sparse hair, and T-and B-cell immunodeficiency. |
| Synonym | cartilage hair hypoplasia cartilage hair syndrome cartilage-hair hypoplasia syndrome chh mckusick metaphyseal chondrodysplasia syndrome metaphyseal chondrodysplasia, mckusick type metaphyseal chondrodysplasia, mckusick type (disorder) metaphyseal chondrodysplasia, recessive type |
| Orphanet | |
| OMIM | |
| DOID | |
| UMLS | C0220748 |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:2) |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:29) 176 | ACAN | 1.101 | DISEASES 100 | ADA | 2.435 | DISEASES 23545 | ATP6V0A2 | 2.448 | DISEASES 959 | CD40LG | 1.292 | DISEASES 8556 | CDC14A | 3.257 | DISEASES 23405 | DICER1 | 1.341 | DISEASES 1785 | DNM2 | 1.29 | DISEASES 1910 | EDNRB | 1.922 | DISEASES 2272 | FHIT | 1.295 | DISEASES 2512 | FTL | 2.174 | DISEASES 2876 | GPX1 | 1.42 | DISEASES 3486 | IGFBP3 | 1.575 | DISEASES 3551 | IKBKB | 1.252 | DISEASES 3590 | IL11RA | 4.354 | DISEASES 3559 | IL2RA | 1.182 | DISEASES 3561 | IL2RG | 1.778 | DISEASES 3718 | JAK3 | 1.57 | DISEASES 3897 | L1CAM | 2.277 | DISEASES 318 | NUDT2 | 4.202 | DISEASES 4942 | OAT | 1.567 | DISEASES 8643 | PTCH2 | 2.584 | DISEASES 5979 | RET | 1.376 | DISEASES 6023 | RMRP | 7.985 | DISEASES 6223 | RPS19 | 2.826 | DISEASES 91543 | RSAD2 | 2.869 | DISEASES 388015 | RTL1 | 3.172 | DISEASES 6663 | SOX10 | 1.683 | DISEASES 7019 | TFAM | 1.732 | DISEASES 7227 | TRPS1 | 2.661 | DISEASES |
| Locus | Symbol | Locus(Total Locus:1) RMRP | 9p13.3 |
| Disease ID | 425 |
|---|---|
| Disease | cartilage-hair hypoplasia |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:104) HP:0008921 | Dwarfism, neonatal short-limbed HP:0000248 | Brachycephaly HP:0004810 | Congenital hypoplastic anemia HP:0010306 | Short thorax HP:0008450 | Narrow vertebral interpedicular distance HP:0004279 | Hypoplastic hands HP:0005871 | Metaphyseal chondrodysplasia HP:0000774 | Narrow chest HP:0100569 | Abnormal vertebral ossification HP:0001903 | Anemia HP:0002024 | Malabsorption HP:0002353 | EEG abnormality HP:0003312 | Abnormal form of the vertebral bodies HP:0011849 | Abnormal bone ossification HP:0002093 | Respiratory insufficiency HP:0002665 | Lymphoma HP:0003272 | Abnormality of the hip bone HP:0001972 | Macrocytic anemia HP:0001508 | Failure to thrive HP:0000431 | Wide nasal bridge HP:0007703 | Abnormality of retinal pigmentation HP:0005616 | Accelerated skeletal maturation HP:0001638 | Cardiomyopathy HP:0000174 | Abnormality of the palate HP:0001252 | Muscular hypotonia HP:0006589 | Flaring of lower rib cage HP:0005360 | Susceptibility to chickenpox HP:0008873 | Disproportionate short-limb short stature HP:0001888 | Lymphocytopenia HP:0100543 | Cognitive impairment HP:0000545 | Myopia HP:0005930 | Abnormality of epiphysis morphology HP:0002032 | Esophageal atresia HP:0100255 | Metaphyseal dysplasia HP:0002652 | Skeletal dysplasia HP:0005374 | Cellular immunodeficiency HP:0002938 | Exaggerated lumbar lordosis HP:0002024 | Intestinal malabsorption HP:0004279 | Short palm HP:0003220 | Abnormality of chromosome stability HP:0000286 | Epicanthus HP:0003016 | Wide metaphyses HP:0010301 | Spinal dysraphism HP:0003027 | Mesomelia HP:0002240 | Hepatomegaly HP:0200055 | Small hand HP:0001382 | Hyperextensible joints HP:0002750 | Delayed skeletal maturation HP:0008155 | Mucopolysacchariduria HP:0000368 | Low-set, posteriorly rotated ears HP:0000212 | Gingival overgrowth HP:0001671 | Abnormality of the cardiac septa HP:0000944 | Abnormality of the metaphyses HP:0002983 | Micromelia HP:0008905 | Rhizomelia HP:0007464 | Sparse facial hair HP:0002777 | Tracheal stenosis HP:0000535 | Sparse eyebrow HP:0000592 | Blue sclerae HP:0004625 | Biconvex vertebral bodies HP:0002251 | Aganglionic megacolon HP:0003347 | Impaired lymphocyte transformation with phytohemagglutinin HP:0005019 | Diaphyseal thickening HP:0005280 | Depressed nasal bridge HP:0100729 | Large face HP:0008069 | Neoplasm of the skin HP:0002644 | Abnormality of pelvic girdle bone morphology HP:0002982 | Tibial bowing HP:0003307 | Hyperlordosis HP:0008499 | High-grade hypermetropia HP:0005692 | Joint hyperflexibility HP:0004313 | Decreased antibody level in blood HP:0008056 | Aplasia/Hypoplasia affecting the eye HP:0000535 | Thin, sparse eyebrows HP:0010318 | Aplasia/Hypoplasia of the abdominal wall musculature HP:0001377 | Limited elbow extension HP:0002213 | Thin hair shaft HP:0000457 | Depressed nasal ridge HP:0002650 | Scoliosis HP:0002286 | Fair hair HP:0002251 | Hirschsprung megacolon HP:0009832 | Abnormality of the distal phalanx of finger HP:0000505 | Visual impairment HP:0000444 | Convex nasal ridge HP:0000463 | Anteverted nares HP:0001732 | Abnormality of the pancreas HP:0011220 | Prominent forehead HP:0000768 | Pectus carinatum HP:0000940 | Abnormal diaphysis morphology HP:0000470 | Short neck HP:0006487 | Bowing of the long bones HP:0000486 | Strabismus HP:0000960 | Sacral dimple HP:0000772 | Abnormality of the ribs HP:0001315 | Reduced tendon reflexes HP:0001377 | Restricted elbow extension HP:0002901 | Hypocalcemia HP:0008070 | Sparse hair HP:0001875 | Neutropenia HP:0012722 | Heart block HP:0000653 | Hypotrichosis of eyelashes HP:0002644 | Abnormal shape of pelvic girdle bone HP:0000400 | Macrotia HP:0003021 | Metaphyseal cupping |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:6) |
| Disease ID | 425 |
|---|---|
| Disease | cartilage-hair hypoplasia |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:8) |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:1) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:8) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs199476103 | NA | 6023 | RMRP | umls:C0220748 | CLINVAR | NA | 0.37302921 | NA | RMRP;CCDC107 | 9 | 35657948 | T | C |
| rs727502774 | NA | 6023 | RMRP | umls:C0220748 | CLINVAR | NA | 0.37302921 | NA | RMRP;CCDC107 | 9 | 35657756 | C | A |
| rs727502775 | NA | 6023 | RMRP | umls:C0220748 | CLINVAR | NA | 0.37302921 | NA | RMRP;CCDC107 | 9 | 35658030 | - | TCACAGAGTA |
| rs727502776 | NA | 6023 | RMRP | umls:C0220748 | CLINVAR | NA | 0.37302921 | NA | RMRP;CCDC107 | 9 | 35658027 | - | GCTTCACAGAGTAGT |
| rs727502777 | NA | 6023 | RMRP | umls:C0220748 | CLINVAR | NA | 0.37302921 | NA | RMRP;CCDC107 | 9 | 35658023 | - | CTCAGG,CTCAGCTTCACAGAGTA |
| rs727502778 | NA | 6023 | RMRP | umls:C0220748 | CLINVAR | NA | 0.37302921 | NA | RMRP;CCDC107 | 9 | 35658020 | - | GTCCTCAGCTTCACAGAGTAGTAT,GTCCTCAGCTTCACAGA |
| rs786204684 | NA | 6023 | RMRP | umls:C0220748 | CLINVAR | NA | 0.37302921 | NA | RMRP;CCDC107 | 9 | 35657955 | G | A |
| rs796065036 | NA | 6023 | RMRP | umls:C0220748 | CLINVAR | NA | 0.37302921 | NA | RMRP;CCDC107 | 9 | 35657823 | - | A |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:37) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0000431 | Wide nasal bridge | MP:0006292 | abnormal nasal placode morphology | any structural anomaly in the paired ectodermal placodes that come to lie in the bottom of the olfactory pits as the pits are deepened by the growth of the surrounding medial and lateral nasal processes; the nasal placode gives rise to the olfactory epith |
| HP:0000457 | Depressed nasal ridge | MP:0004872 | absent nasal septum | absence of the structure that separates the two nasal cavities |
| HP:0005930 | Abnormality of epiphysis morphology | MP:0013621 | decreased internal diameter of femur | reduced cross-sectional distance that extends from one lateral edge of the femur long bone marrow cavity, through its center and to the opposite lateral edge of the bone marrow cavity through the mid point of the femur |
| HP:0003272 | Abnormality of the hip bone | MP:0009536 | abnormal interstitial cell of Cajal morphology | any structural anomaly in the type of cell found in the gastrointestinal tract and serving as a pacemaker that triggers gut contraction; ICCs mediate inputs from the enteric nervous system to smooth muscle cells and are thought to be the cells from which |
| HP:0001972 | Macrocytic anemia | MP:0001577 | anemia | less than normal levels of red blood cells and/or hemoglobin within red blood cells, or volume of packed red blood cells in the bloodstream, resulting in insufficient oxygenation of tissues and organs |
| HP:0000772 | Abnormality of the ribs | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0001508 | Failure to thrive | MP:0013294 | prenatal lethality prior to heart atrial septation | death prior to the completion of heart atrial septation (Mus: E14.5-15.5) |
| HP:0000774 | Narrow chest | MP:0004134 | abnormal chest morphology | any structural anomaly of the part of the body between the neck and the abdomen |
| HP:0005280 | Depressed nasal bridge | MP:0013582 | abnormal lateral nasal gland morphology | any structural anomaly of the lateral nasal glands (the largest nasal secretory glands in rodents) which surround the maxillary sinus located in the lateral wall adjacent to each nasal passage and are characterized by cytologic features similar to those d |
| HP:0002032 | Esophageal atresia | MP:0009510 | cecal atresia | congenital blockage or absence of the lumen of the cecum |
| HP:0002251 | Aganglionic megacolon | MP:0002926 | aganglionic megacolon | extreme dilation of the colon due to defects in innervation from the ganglia, or absence of the ganglia of the myenteric plexus |
| HP:0008873 | Disproportionate short-limb short stature | MP:0004672 | short ribs | reduced length of the bones forming the bony wall of the chest |
| HP:0008921 | Neonatal short-limb short stature | MP:0004830 | short incisors | reduced length of the set of long teeth that are the most anterior and prominent in the jaw |
| HP:0008070 | Sparse hair | MP:0010202 | focal dorsal hair loss | focal hair loss on the dorsal area of a rodent resulting in dorsal skin visible in a patch where hair loss occurs |
| HP:0006487 | Bowing of the long bones | MP:0013621 | decreased internal diameter of femur | reduced cross-sectional distance that extends from one lateral edge of the femur long bone marrow cavity, through its center and to the opposite lateral edge of the bone marrow cavity through the mid point of the femur |
| HP:0000174 | Abnormality of the palate | MP:0010701 | fusion of atlas and odontoid process | the large protuberance that projects upward from the cervical axis (C2), around which the cervical atlas normally rotates, is instead fused to elements of the atlas; the odontoid process may or may not remain attached to the axis |
| HP:0001732 | Abnormality of the pancreas | MP:0014230 | dilated crypts of Lieberkuhn | |
| HP:0002644 | Abnormality of pelvic girdle bone morphology | MP:0013620 | increased internal diameter of femur | increased cross-sectional distance that extends from one lateral edge of the femur long bone marrow cavity, through its center and to the opposite lateral edge of the bone marrow cavity through the mid point of the femur |
| HP:0001252 | Muscular hypotonia | MP:0004144 | hypotonia | decreased muscle tension resulting in limpness of the muscles in the resting state, not to be confused with weakness |
| HP:0003312 | Abnormal form of the vertebral bodies | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0008056 | Aplasia/Hypoplasia affecting the eye | MP:0005224 | abnormal left-right axis symmetry of the somites | anomaly in the formation or development of the somites in relation to the left and right sides of the body |
| HP:0004313 | Decreased antibody level in blood | MP:0011460 | decreased urine chloride ion level | abnormally low amounts of chloride ion in the urine |
| HP:0007703 | Abnormality of retinal pigmentation | MP:0011665 | d-loop transposition of the great arteries | complete transposition of the great arteries; the d- refers to the dextroposition of the bulboventricular loop (ie, the position of the right ventricle, which is on the right side); in addition, the aorta also tends to be on the right and anterior, and th |
| HP:0003220 | Abnormality of chromosome stability | MP:0006241 | abnormal placement of pupils | abnormal location of the pupil so that it is not in the center of the iris |
| HP:0001671 | Abnormality of the cardiac septa | MP:0012167 | abnormal epigenetic regulation of gene expression | any anomaly in the process that modulates the frequency, rate or extent of gene expression, in which the process is mitotically or meiotically heritable, or is stably self-propagated in the cytoplasm of a resting cell, and does not entail a change in DNA |
| HP:0100569 | Abnormal vertebral ossification | MP:0004623 | thoracic vertebral fusion | the union of one or more thoracic vertebrae into a single structure |
| HP:0008069 | Neoplasm of the skin | MP:0011205 | excessive folding of visceral yolk sac | the appearance of wrinkles or folds on the surface of the visceral yolk sac |
| HP:0004810 | Congenital hypoplastic anemia | MP:0001577 | anemia | less than normal levels of red blood cells and/or hemoglobin within red blood cells, or volume of packed red blood cells in the bloodstream, resulting in insufficient oxygenation of tissues and organs |
| HP:0002750 | Delayed skeletal maturation | MP:0003379 | absent sexual maturation | failure to initiate pubertal changes that result in achievement of full sexual capacity |
| HP:0000470 | Short neck | MP:0012720 | elongated neck | increased length of the neck |
| HP:0002213 | Fine hair | MP:0010685 | abnormal hair follicle inner root sheath morphology | any structural anomaly of the multilayered tube composed of terminally differentiated hair follicle keratinocytes that is surrounded by the outer root sheath; the layers of the inner root sheath include the companion layer, Henle's layer, Huxley's layer a |
| HP:0005616 | Accelerated skeletal maturation | MP:0003378 | early sexual maturation | pubertal changes occur at an earlier than normal age |
| HP:0000944 | Abnormality of the metaphyses | MP:0013621 | decreased internal diameter of femur | reduced cross-sectional distance that extends from one lateral edge of the femur long bone marrow cavity, through its center and to the opposite lateral edge of the bone marrow cavity through the mid point of the femur |
| HP:0000444 | Convex nasal ridge | MP:0004471 | short nasal bone | reduced length of either of two rectangular bone plates forming the bridge of the nose |
| HP:0010318 | Aplasia/Hypoplasia of the abdominal wall musculature | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0002286 | Fair hair | MP:0010685 | abnormal hair follicle inner root sheath morphology | any structural anomaly of the multilayered tube composed of terminally differentiated hair follicle keratinocytes that is surrounded by the outer root sheath; the layers of the inner root sheath include the companion layer, Henle's layer, Huxley's layer a |
| HP:0009832 | Abnormality of the distal phalanx of finger | MP:0009886 | failure of palatal shelf elevation | the palatal shelves fail to move from a vertical position in the orofacial cavity to a horizontal apposition above the developing tongue |
Mapped by homologous gene(Total Items:92) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0001377 | Limited elbow extension | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0010306 | Short thorax | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0200055 | Small hand | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0000653 | Sparse eyelashes | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0005616 | Accelerated skeletal maturation | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0003307 | Hyperlordosis | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0002240 | Hepatomegaly | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0005871 | Metaphyseal chondrodysplasia | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0000772 | Abnormality of the ribs | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001508 | Failure to thrive | MP:0020234 | decreased basal metabolism | decrease in heat production of an organism at the lowest level of cell chemistry in an inactive, awake, and fasting state |
| HP:0002286 | Fair hair | MP:0013282 | urinary bladder exstrophy | a herniation of the urinary bladder through an anterior abdominal wall defect; refers to congenital absence of a portion of the lower anterior abdominal wall and the anterior urinary bladder wall, with eversion of the posterior bladder wall through the de |
| HP:0008056 | Aplasia/Hypoplasia affecting the eye | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000457 | Depressed nasal ridge | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002032 | Esophageal atresia | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0010301 | Spinal dysraphism | MP:0013241 | embryo tissue necrosis | morphological changes resulting from pathological death of some or all embryo tissue; usually due to irreversible damage |
| HP:0011220 | Prominent forehead | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0100255 | Metaphyseal dysplasia | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0000400 | Macrotia | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0008070 | Sparse hair | MP:0014179 | abnormal blood-retinal barrier function | anomaly in the function of the part of the blood-ocular barrier that consists of cells that are joined tightly together to prevent certain substances from entering the tissue of the retina; the BRB consists of non-fenestrated capillaries of the retinal ci |
| HP:0002982 | Tibial bowing | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0005692 | Joint hyperflexibility | MP:0012125 | decreased bronchoconstrictive response | reduction in the expected bronchoconstrictive response to provocation challenge with lipopolysaccharide, bradykinin, histamine or other antigen/allergen or agent, often measured by plethysmography |
| HP:0002644 | Abnormality of pelvic girdle bone morphology | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0007703 | Abnormality of retinal pigmentation | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000944 | Abnormality of the metaphyses | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002777 | Tracheal stenosis | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0008905 | Rhizomelia | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000486 | Strabismus | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0003347 | Impaired lymphocyte transformation with phytohemagglutinin | MP:0020186 | altered susceptibility to bacterial infection | a change in the likelihood that an organism will develop ill effects from a bacterial infection or from components of or toxins produced by bacteria |
| HP:0002213 | Fine hair | MP:0013897 | decreased eyelid cilium number | reduction in the number of the hairs that grow at the edge of the upper or lower eyelid |
| HP:0000174 | Abnormality of the palate | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000940 | Abnormal diaphysis morphology | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000248 | Brachycephaly | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0005280 | Depressed nasal bridge | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002901 | Hypocalcemia | MP:0014169 | decreased brown adipose tissue mass | decreased physical bulk or volume of brown adipose tissue |
| HP:0006487 | Bowing of the long bones | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000768 | Pectus carinatum | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0003021 | Metaphyseal cupping | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000470 | Short neck | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002983 | Micromelia | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0003220 | Abnormality of chromosome stability | MP:0014164 | abnormal ciliary process morphology | any structural anomaly of any of the pigmented processes that radiate from the ciliary muscle and give attachments to ligaments supporting the lens of the eye; these processes increase in thickness as they advance from the orbiculus ciliaris to the exter |
| HP:0002665 | Lymphoma | MP:0020154 | impaired humoral immune response | impaired response of the immune system that mediates secreted antibodies produced in B cells |
| HP:0000286 | Epicanthus | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0001972 | Macrocytic anemia | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0000368 | Low-set, posteriorly rotated ears | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0008450 | Narrow vertebral interpedicular distance | MP:0014166 | ectopic cranial bone | the appearance of an extra bone structure at an atypical location in or near the cranium |
| HP:0001888 | Lymphopenia | MP:0020154 | impaired humoral immune response | impaired response of the immune system that mediates secreted antibodies produced in B cells |
| HP:0000545 | Myopia | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002750 | Delayed skeletal maturation | MP:0020169 | increased thyroid gland weight | higher than average weight of the thyroid gland |
| HP:0003272 | Abnormality of the hip bone | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0005930 | Abnormality of epiphysis morphology | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002353 | EEG abnormality | MP:0020214 | susceptible to malignant hyperthermia | increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine |
| HP:0003027 | Mesomelia | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0001638 | Cardiomyopathy | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0008873 | Disproportionate short-limb short stature | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000592 | Blue sclerae | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0008921 | Neonatal short-limb short stature | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0100543 | Cognitive impairment | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0009832 | Abnormality of the distal phalanx of finger | MP:0011108 | embryonic lethality during organogenesis, incomplete penetrance | the appearance of lower than Mendelian ratios of organisms of a given genotype due to death of some, but not all of the organisms between embryo turning and the completion of organogenesis (Mus: E9-9.5 to less than E14) |
| HP:0002251 | Aganglionic megacolon | MP:0020220 | decreased tear production | decreased production of the amount of fluid produced in the eye |
| HP:0001382 | Joint hypermobility | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0001875 | Neutropenia | MP:0020215 | impaired blood coagulation | impaired ability of the blood to clot |
| HP:0001671 | Abnormality of the cardiac septa | MP:0013901 | absent female preputial gland | absence of the paired, lobulated, modified sebaceous glands located on the side of the clitoris in female rodents; in contrast to the preputial glands in male rodents, clitoral glands are a minor source of olfactory stimuli contributing to sexual attracti |
| HP:0004313 | Decreased antibody level in blood | MP:0020154 | impaired humoral immune response | impaired response of the immune system that mediates secreted antibodies produced in B cells |
| HP:0008069 | Neoplasm of the skin | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0000505 | Visual impairment | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0100569 | Abnormal vertebral ossification | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000431 | Wide nasal bridge | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0003016 | Metaphyseal widening | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001315 | Reduced tendon reflexes | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001252 | Muscular hypotonia | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0002650 | Scoliosis | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0000774 | Narrow chest | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000212 | Gingival overgrowth | MP:0014179 | abnormal blood-retinal barrier function | anomaly in the function of the part of the blood-ocular barrier that consists of cells that are joined tightly together to prevent certain substances from entering the tissue of the retina; the BRB consists of non-fenestrated capillaries of the retinal ci |
| HP:0000463 | Anteverted nares | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0000535 | Sparse eyebrow | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| HP:0002024 | Malabsorption | MP:0020220 | decreased tear production | decreased production of the amount of fluid produced in the eye |
| HP:0001903 | Anemia | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0002093 | Respiratory insufficiency | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002938 | Lumbar hyperlordosis | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000444 | Convex nasal ridge | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0005374 | Cellular immunodeficiency | MP:0020154 | impaired humoral immune response | impaired response of the immune system that mediates secreted antibodies produced in B cells |
| HP:0000960 | Sacral dimple | MP:0013787 | photophobia | abnormal aversion or avoidance behavior in response to light; photophobia is symptom of abnormal intolerance to visual perception of light; as a medical symptom, photophobia is not a morbid fear or phobia, but an experience of discomfort or pain to the e |
| HP:0004279 | Short palm | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0008155 | Mucopolysacchariduria | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| HP:0008499 | High-grade hypermetropia | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0010318 | Aplasia/Hypoplasia of the abdominal wall musculature | MP:0020169 | increased thyroid gland weight | higher than average weight of the thyroid gland |
| HP:0002652 | Skeletal dysplasia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0003312 | Abnormal form of the vertebral bodies | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0001732 | Abnormality of the pancreas | MP:0014233 | bile duct epithelium hyperplasia | |
| HP:0100729 | Large face | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0005019 | Diaphyseal thickening | MP:0013178 | tail necrosis | morphological changes resulting from pathological death of tail tissue; usually due to irreversible damage |
| HP:0004810 | Congenital hypoplastic anemia | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| Disease ID | 425 |
|---|---|
| Disease | cartilage-hair hypoplasia |
| Case | (Waiting for update.) |