eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| carnitine palmitoyltransferase ii deficiency | ||||
| Disease ID | 358 |
|---|---|
| Disease | carnitine palmitoyltransferase ii deficiency |
| Definition | A rare, autosomal recessive inherited disorder of long-chain fatty-acid oxidation caused by mutations in the CPT2 gene. The disease includes three main types: a lethal neonatal form, a severe infantile hepatocardiomuscular form, and a myopathic form. |
| Synonym | carnitine palmitoyl transferase 2 deficiency carnitine palmitoyltransferase 2 deficiency carnitine palmitoyltransferase deficiency type 2 carnitine palmitoyltransferase ii deficiency (disorder) cpt ii deficiency cpt-ii cpt2 - carnitine palmitoyltransferase ii deficiency cpt2 deficiency cptii - carnitine palmitoyltransferase deficiency type ii muscle form of carnitine palmitoyltransferase deficiency |
| Orphanet | |
| DOID | |
| UMLS | C0342790 |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:1) |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:46) 51099 | ABHD5 | 2.04 | DISEASES 30 | ACAA1 | 2.376 | DISEASES 32 | ACACB | 2.201 | DISEASES 37 | ACADVL | 5.089 | DISEASES 2182 | ACSL4 | 2.4 | DISEASES 270 | AMPD1 | 2.108 | DISEASES 488 | ATP2A2 | 1.357 | DISEASES 114781 | BTBD9 | 2.616 | DISEASES 80347 | COASY | 2.486 | DISEASES 1280 | COL2A1 | 1.174 | DISEASES 1376 | CPT2 | 7.355 | DISEASES 54677 | CROT | 3.045 | DISEASES 1431 | CS | 3.371 | DISEASES 56259 | CTNNBL1 | 1.446 | DISEASES 1565 | CYP2D6 | 1.586 | DISEASES 8694 | DGAT1 | 1.75 | DISEASES 1740 | DLG2 | 2.443 | DISEASES 2110 | ETFDH | 4.433 | DISEASES 2170 | FABP3 | 1.09 | DISEASES 114907 | FBXO32 | 1.408 | DISEASES 2632 | GBE1 | 2.786 | DISEASES 338328 | GPIHBP1 | 2.51 | DISEASES 3033 | HADH | 2.706 | DISEASES 3030 | HADHA | 2.97 | DISEASES 3032 | HADHB | 3.826 | DISEASES 3155 | HMGCL | 2.466 | DISEASES 3157 | HMGCS1 | 2.798 | DISEASES 10525 | HYOU1 | 2.099 | DISEASES 4151 | MB | 1.399 | DISEASES 4538 | MT-ND4 | 1.857 | DISEASES 4566 | MT-TK | 1.041 | DISEASES 10062 | NR1H3 | 1.864 | DISEASES 57104 | PNPLA2 | 2.849 | DISEASES 57142 | RTN4 | 2.443 | DISEASES 6261 | RYR1 | 2.357 | DISEASES 6319 | SCD | 2.064 | DISEASES 404552 | SCGB1D4 | 1.78 | DISEASES 788 | SLC25A20 | 5.054 | DISEASES 6514 | SLC2A2 | 1.899 | DISEASES 57537 | SORCS2 | 3.064 | DISEASES 8878 | SQSTM1 | 1.15 | DISEASES 6720 | SREBF1 | 1.535 | DISEASES 6996 | TDG | 2.185 | DISEASES 7150 | TOP1 | 2.275 | DISEASES 8940 | TOP3B | 3.272 | DISEASES 7352 | UCP3 | 1.352 | DISEASES |
| Locus | (Waiting for update.) |
| Disease ID | 358 |
|---|---|
| Disease | carnitine palmitoyltransferase ii deficiency |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:20) HP:0001250 | Seizures HP:0002910 | Elevated hepatic transaminases HP:0003326 | Myalgia HP:0000003 | Multicystic kidney dysplasia HP:0001645 | Sudden cardiac death HP:0001324 | Muscle weakness HP:0000077 | Abnormality of the kidney HP:0001259 | Coma HP:0011675 | Arrhythmia HP:0012071 | Abnormality of acetylcarnitine metabolism HP:0001943 | Hypoglycemia HP:0002514 | Cerebral calcification HP:0003198 | Myopathy HP:0004372 | Reduced consciousness/confusion HP:0010964 | Abnormality of long-chain fatty-acid metabolism HP:0002240 | Hepatomegaly HP:0012639 | Abnormality of nervous system morphology HP:0002383 | Encephalitis HP:0001638 | Cardiomyopathy HP:0000083 | Renal insufficiency |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:1) |
| Disease ID | 358 |
|---|---|
| Disease | carnitine palmitoyltransferase ii deficiency |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:1) C0022660 | acute renal failure |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Manually Genotypes:1) | |||
|---|---|---|---|
| Gene | Mutation | DOI | Article Title |
| CPT2 | c.1238_1239delAG (Q413fs) in both | doi:10.1038/gim.2016.8 | Expanded carrier screening in an infertile population: how often is clinical decision making affected? |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:21) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs121918528 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53210033 | A | G |
| rs1799821 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53210776 | G | A |
| rs186044004 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53213264 | G | A |
| rs2229291 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53210729 | T | G |
| rs28936375 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53197092 | C | A |
| rs28936673 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53213501 | A | C |
| rs28936674 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53210194 | G | A |
| rs397509431 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53210912 | AG | - |
| rs515726173 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53210208 | GAACCCTGCAAAAAGTGACACTATC | T |
| rs515726174 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53210315 | T | C |
| rs515726175 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53210657 | A | G |
| rs515726176 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53210819 | G | A,C |
| rs515726177 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53210126 | G | A |
| rs515726178 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53213355 | C | - |
| rs515726179 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53213541 | GAAGGCCTTAGAA | - |
| rs74315293 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53213509 | C | T |
| rs74315294 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53202427 | C | T |
| rs74315295 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53210822 | T | A |
| rs74315296 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53211181 | C | T |
| rs74315297 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53211016 | T | C |
| rs74315298 | NA | 1376 | CPT2 | umls:C0342790 | CLINVAR | NA | 0.122985861 | NA | CPT2 | 1 | 53210354 | C | T |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:6) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0000003 | Multicystic kidney dysplasia | MP:0011376 | abnormal kidney corticomedullary boundary morphology | any structural anomaly of the region demarcating the renal medulla from the surrounding cortex; end-stage renal failure may be associated with loss of the normal corticomedullary boundary |
| HP:0002910 | Elevated hepatic transaminases | MP:0002628 | hepatic steatosis | an accumulation of fat deposits in the liver |
| HP:0000083 | Renal insufficiency | MP:0003335 | exocrine pancreatic insufficiency | inadequate synthesis and/or secretion of digestive enzymes by the exocrine portion of the pancreas, usually due to loss of acinar tissue from idiopathic atrophy or acute or chronic inflammation, causing maldigestion and malabsorption of nutrients |
| HP:0001324 | Muscle weakness | MP:0000746 | weakness | state of being infirm or less strong than normal |
| HP:0001645 | Sudden cardiac death | MP:0012557 | decreased calcium uptake by cardiac muscle | decreased directed movement of calcium ions into cardiac muscle; decreased or disrupted uptake may give rise to energetic deficit and oxidative stress. leading to cardiac disease |
| HP:0000077 | Abnormality of the kidney | MP:0011665 | d-loop transposition of the great arteries | complete transposition of the great arteries; the d- refers to the dextroposition of the bulboventricular loop (ie, the position of the right ventricle, which is on the right side); in addition, the aorta also tends to be on the right and anterior, and th |
Mapped by homologous gene(Total Items:17) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0000003 | Multicystic kidney dysplasia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0003198 | Myopathy | MP:0020280 | increased creatine kinase level | increased level of the enzyme that catalyzes the reversible transfer of creatine to phosphocreatine |
| HP:0002910 | Elevated hepatic transaminases | MP:0020234 | decreased basal metabolism | decrease in heat production of an organism at the lowest level of cell chemistry in an inactive, awake, and fasting state |
| HP:0001943 | Hypoglycemia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0011675 | Arrhythmia | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0002383 | Encephalitis | MP:0020215 | impaired blood coagulation | impaired ability of the blood to clot |
| HP:0000083 | Renal insufficiency | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0001250 | Seizures | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0001259 | Coma | MP:0020216 | decreased circulating complement protein level | less than normal levels of the serum proteins that act sequentially to allow for the direct killing of microbes, the disposal of immune complexes, and the regulation of other immune processes |
| HP:0001645 | Sudden cardiac death | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001638 | Cardiomyopathy | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0000077 | Abnormality of the kidney | MP:0013294 | prenatal lethality prior to heart atrial septation | death prior to the completion of heart atrial septation (Mus: E14.5-15.5) |
| HP:0003326 | Myalgia | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0002240 | Hepatomegaly | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001324 | Muscle weakness | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0002514 | Cerebral calcification | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0004372 | Reduced consciousness/confusion | MP:0013405 | increased circulating lactate level | greater amount of lactate in the blood which is produced from pyruvate by lactate dehydrogenase |
| Disease ID | 358 |
|---|---|
| Disease | carnitine palmitoyltransferase ii deficiency |
| Case | (Waiting for update.) |