| cardiomyopathy | ||||
| Disease ID | 562 |
|---|---|
| Disease | cardiomyopathy |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:44) C2712322 | tachycardia C2364051 | fatigue C2108112 | ventricular fibrillation C1963185 | obesity C1963101 | encephalopathy C1839611 | n syndrome C1281998 | refractory heart failure C1135196 | diastolic heart failure C0917713 | becker's muscular dystrophy C0856169 | endothelial dysfunction C0852949 | arteriopathy C0849925 | ventricular failure C0751651 | mitochondrial disease C0750197 | sustained ventricular tachycardia C0581883 | deafness C0524851 | neurodegenerative disorder C0426768 | o sign C0410180 | rigid spine syndrome C0340375 | subaortic stenosis C0340331 | post-infarction ventricular septal defect C0340279 | ventricular hypertrophy C0264716 | chronic heart failure C0242231 | coronary artery stenoses C0238421 | selenium deficiency C0232197 | fibrillation C0155707 | multifascicular block C0087086 | thrombi C0042769 | virus infection C0041408 | turner's syndrome C0027868 | neuromuscular diseases C0027059 | myocardial inflammation C0026266 | mitral regurgitation C0026266 | mitral insufficiency C0023212 | left ventricular failure C0020305 | fetal hydrops C0018802 | congestive heart failure C0018802 | congestive cardiac failure C0018801 | heart failure C0018801 | cardiac insufficiency C0018801 | cardiac failure C0015624 | nephropathic cystinosis C0008031 | chest pain C0007570 | celiac disease C0002965 | unstable angina |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:30) C0018801 | heart failure | 218 C0039231 | tachycardia | 42 C0018802 | congestive heart failure | 42 C0026266 | mitral regurgitation | 24 C0232197 | fibrillation | 23 C0018801 | cardiac failure | 17 C0264716 | chronic heart failure | 15 C1839611 | n syndrome | 13 C0426768 | o sign | 9 C0340279 | ventricular hypertrophy | 9 C0007570 | celiac disease | 9 C0042510 | ventricular fibrillation | 8 C0028754 | obesity | 8 C0087086 | thrombi | 5 C0042769 | virus infection | 4 C0018802 | congestive cardiac failure | 4 C0008031 | chest pain | 4 C0849925 | ventricular failure | 3 C0750197 | sustained ventricular tachycardia | 3 C0023212 | left ventricular failure | 2 C0238421 | selenium deficiency | 2 C0524851 | neurodegenerative disorder | 2 C0027059 | myocardial inflammation | 2 C0011053 | deafness | 1 C0026266 | mitral insufficiency | 1 C1135196 | diastolic heart failure | 1 C0751651 | mitochondrial disease | 1 C0027051 | myocardial infarct | 1 C0018801 | cardiac insufficiency | 1 C0085584 | encephalopathy | 1 |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:197) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs104893823 | 18820258 | 7134 | TNNC1 | umls:C0878544 | BeFree | Challenging current paradigms related to cardiomyopathies. Are changes in the Ca2+ sensitivity of myofilaments containing cardiac troponin C mutations (G159D and L29Q) good predictors of the phenotypic outcomes? | 0.004895885 | 2008 | TNNC1 | 3 | 52451285 | C | T |
| rs104894201 | 23770744 | 1674 | DES | umls:C0878544 | BeFree | Sildenafil treatment significantly increased myocardial PKG activity and significantly reduced myocardial accumulation of CryAB(R120G), ubiquitin conjugates, and aberrant protein aggregates in mice with CryAB(R120G)-based desmin-related cardiomyopathy. | 0.011324614 | 2013 | CRYAB | 11 | 111908934 | T | C |
| rs104894201 | 12837281 | 1410 | CRYAB | umls:C0878544 | BeFree | Nuclear speckle localisation of the small heat shock protein alpha B-crystallin and its inhibition by the R120G cardiomyopathy-linked mutation. | 0.004895885 | 2003 | CRYAB | 11 | 111908934 | T | C |
| rs104894201 | 23770744 | 1410 | CRYAB | umls:C0878544 | BeFree | Sildenafil treatment significantly increased myocardial PKG activity and significantly reduced myocardial accumulation of CryAB(R120G), ubiquitin conjugates, and aberrant protein aggregates in mice with CryAB(R120G)-based desmin-related cardiomyopathy. | 0.004895885 | 2013 | CRYAB | 11 | 111908934 | T | C |
| rs104894502 | 22155441 | 1769 | DNAH8 | umls:C0878544 | BeFree | To understand how the HCM-causing Asp175Asn and Glu180Gly mutations in α-tropomyosin affect on actin-myosin interaction during the ATPase cycle, we labeled the SH1 helix of myosin subfragment-1 and the actin subdomain-1 with the fluorescent probe N-iodoacetyl-N'-(5-sulfo-1-naphtylo)ethylenediamine. | 0.001900093 | 2012 | TPM1 | 15 | 63060915 | A | G,T |
| rs104894502 | 22155441 | 7168 | TPM1 | umls:C0878544 | BeFree | To understand how the HCM-causing Asp175Asn and Glu180Gly mutations in α-tropomyosin affect on actin-myosin interaction during the ATPase cycle, we labeled the SH1 helix of myosin subfragment-1 and the actin subdomain-1 with the fluorescent probe N-iodoacetyl-N'-(5-sulfo-1-naphtylo)ethylenediamine. | 0.127252986 | 2012 | TPM1 | 15 | 63060915 | A | G,T |
| rs104894503 | 14734051 | 7168 | TPM1 | umls:C0878544 | BeFree | In conclusion, in HCM attributable to the Asp175Asn mutation in the alpha-tropomyosin gene, life-threatening arrhythmias were induced in one third of the patients. | 0.127252986 | 2004 | TPM1 | 15 | 63060899 | G | A |
| rs104894503 | 12511681 | 7168 | TPM1 | umls:C0878544 | BeFree | Rest-stress first-pass MR imaging with gadopentetate dimeglumine was performed in 17 patients with HCM and the Asp175Asn substitution in the alpha-tropomyosin gene and in five control subjects. | 0.127252986 | 2003 | TPM1 | 15 | 63060899 | G | A |
| rs104894503 | 21274714 | 7168 | TPM1 | umls:C0878544 | BeFree | 95 unselected subjects with mild-to-moderate hypertension, 24 patients with HCM attributable to the D175N mutation of the α-tropomyosin gene and 17 control subjects were studied by cine CMRI. | 0.127252986 | 2011 | TPM1 | 15 | 63060899 | G | A |
| rs104894503 | 22155441 | 1769 | DNAH8 | umls:C0878544 | BeFree | To understand how the HCM-causing Asp175Asn and Glu180Gly mutations in α-tropomyosin affect on actin-myosin interaction during the ATPase cycle, we labeled the SH1 helix of myosin subfragment-1 and the actin subdomain-1 with the fluorescent probe N-iodoacetyl-N'-(5-sulfo-1-naphtylo)ethylenediamine. | 0.001900093 | 2012 | TPM1 | 15 | 63060899 | G | A |
| rs104894503 | 16014439 | 7168 | TPM1 | umls:C0878544 | BeFree | The extent of myocardial contractile impairment is strongly and independently related to LV mass and maximal wall thickness in patients with HCM attributable to the Asp175Asn mutation in TPM1. | 0.127252986 | 2005 | TPM1 | 15 | 63060899 | G | A |
| rs104894503 | 22462493 | 5554 | PRH1 | umls:C0878544 | BeFree | The TPM1-D175N and MYBPC3-Q1061X mutations account for a substantial part of all HCM cases in the Finnish population, indicating that routine genetic screening of these mutations is warranted in Finnish patients with HCM. | 0.005157396 | 2013 | TPM1 | 15 | 63060899 | G | A |
| rs104894503 | 22155441 | 7168 | TPM1 | umls:C0878544 | BeFree | To understand how the HCM-causing Asp175Asn and Glu180Gly mutations in α-tropomyosin affect on actin-myosin interaction during the ATPase cycle, we labeled the SH1 helix of myosin subfragment-1 and the actin subdomain-1 with the fluorescent probe N-iodoacetyl-N'-(5-sulfo-1-naphtylo)ethylenediamine. | 0.127252986 | 2012 | TPM1 | 15 | 63060899 | G | A |
| rs104894503 | 17556170 | 7168 | TPM1 | umls:C0878544 | BeFree | In HCM attributable to the Asp175Asn mutation in the alpha-tropomyosin gene, myocardial oxidative metabolism and FFA metabolism are increased and inversely related to LV hypertrophy at both the whole heart and regional level. | 0.127252986 | 2007 | TPM1 | 15 | 63060899 | G | A |
| rs104894503 | 22462493 | 7168 | TPM1 | umls:C0878544 | BeFree | The TPM1-D175N and MYBPC3-Q1061X mutations account for a substantial part of all HCM cases in the Finnish population, indicating that routine genetic screening of these mutations is warranted in Finnish patients with HCM. | 0.127252986 | 2013 | TPM1 | 15 | 63060899 | G | A |
| rs104894504 | 11136687 | 7168 | TPM1 | umls:C0878544 | BeFree | Sequencing and restriction digestion analysis demonstrated a TPM1 mutation V95A that cosegregated with HCM. | 0.127252986 | 2001 | TPM1 | 15 | 63057028 | T | C |
| rs104894724 | 9241277 | 7137 | TNNI3 | umls:C0878544 | BeFree | Family studies showed that an Arg145Gly mutation was linked to HCM and a Lys206Gln mutation had occurred de novo, thus strongly suggesting that cTnI is the seventh HCM gene. | 0.254058896 | 1997 | TNNI3 | 19 | 55154146 | G | C,A |
| rs104894725 | 9241277 | 7137 | TNNI3 | umls:C0878544 | BeFree | Family studies showed that an Arg145Gly mutation was linked to HCM and a Lys206Gln mutation had occurred de novo, thus strongly suggesting that cTnI is the seventh HCM gene. | 0.254058896 | 1997 | TNNI3 | 19 | 55151851 | T | G,C |
| rs104894858 | NA | 3920 | LAMP2 | umls:C0878544 | CLINVAR | NA | 0.125167327 | NA | LAMP2 | X | 120442599 | C | T |
| rs1056892 | 22124095 | 874 | CBR3 | umls:C0878544 | BeFree | Homozygosis for G allele in CBR3 contributes to increased cardiomyopathy risk associated with low- to moderate-dose anthracyclines, such that there seems to be no safe dose for patients homozygous for the CBR3 V244M G allele. | 0.000271442 | 2012 | CBR3;CBR3-AS1 | 21 | 36146408 | G | A |
| rs11541796 | 17453626 | 7276 | TTR | umls:C0878544 | BeFree | A new transthyretin variant (Glu61Gly) associated with cardiomyopathy. | 0.011672 | 2007 | TTR | 18 | 31593011 | A | G |
| rs121434525 | NA | 88 | ACTN2 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | ACTN2 | 1 | 236686699 | A | G |
| rs121908108 | NA | 85366 | MYLK2 | umls:C0878544 | CLINVAR | NA | 0.12 | NA | MYLK2 | 20 | 31820357 | C | A |
| rs121909298 | 23695275 | 6444 | SGCD | umls:C0878544 | BeFree | S151A δ-sarcoglycan mutation causes a mild phenotype of cardiomyopathy in mice. | 0.121900093 | 2013 | SGCD | 5 | 156595000 | T | G |
| rs121912557 | 18348273 | 4646 | MYO6 | umls:C0878544 | BeFree | Two missense mutations in MYO6 (p.C442Y and p.H246R) have been characterized in families of Italian and American Caucasian extraction with autosomal dominant hearing loss, respectively, and the latter was associated with cardiomyopathy in some patients. | 0.000542884 | 2008 | MYO6 | 6 | 75857198 | G | A |
| rs121912560 | 18348273 | 4646 | MYO6 | umls:C0878544 | BeFree | Two missense mutations in MYO6 (p.C442Y and p.H246R) have been characterized in families of Italian and American Caucasian extraction with autosomal dominant hearing loss, respectively, and the latter was associated with cardiomyopathy in some patients. | 0.000542884 | 2008 | MYO6 | 6 | 75841299 | A | G |
| rs121912683 | 18809618 | 292 | SLC25A5 | umls:C0878544 | BeFree | More interestingly, the aac2(A137D) allele mimicking ant1(A123D) in mitochondrial myopathy and cardiomyopathy exhibits similar dominant phenotypes. | 0.000271442 | 2008 | SLC25A4 | 4 | 185145020 | C | A |
| rs121912683 | 18809618 | 10 | NAT2 | umls:C0878544 | BeFree | More interestingly, the aac2(A137D) allele mimicking ant1(A123D) in mitochondrial myopathy and cardiomyopathy exhibits similar dominant phenotypes. | 0.000271442 | 2008 | SLC25A4 | 4 | 185145020 | C | A |
| rs121912683 | 18809618 | 291 | SLC25A4 | umls:C0878544 | BeFree | More interestingly, the aac2(A137D) allele mimicking ant1(A123D) in mitochondrial myopathy and cardiomyopathy exhibits similar dominant phenotypes. | 0.001085767 | 2008 | SLC25A4 | 4 | 185145020 | C | A |
| rs121913006 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31519867 | G | A |
| rs121913007 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31524792 | G | A |
| rs121913008 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31519858 | G | A |
| rs121913013 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31519887 | G | A |
| rs121913624 | 15386449 | 4625 | MYH7 | umls:C0878544 | BeFree | The R403L mutation in the MYH7 gene had been previously identified in this family, characterized by a malignant form of HCM. | 0.162886611 | 2004 | MYH7 | 14 | 23429278 | C | T,A |
| rs121913631 | 21642240 | 4625 | MYH7 | umls:C0878544 | BeFree | A deletion variant (p.L232-R238del) was present in 3 unrelated HCM probands, but it did not segregate with HCM in a family who also had a MYH7 mutation (p.L907V). | 0.162886611 | 2011 | MYH7 | 14 | 23424107 | G | C |
| rs121913637 | 19645038 | 4625 | MYH7 | umls:C0878544 | BeFree | The novel double mutation of Ala26Val plus Arg719Trp in MYH7 identified in a Chinese family highlights the remarkable genetic heterogeneity of HCM, which provides important information for genetic counseling, accurate diagnosis, prognostic evaluation, and appropriate clinical management. | 0.162886611 | 2009 | MYH7 | 14 | 23425971 | G | A |
| rs121913637 | 23816408 | 4625 | MYH7 | umls:C0878544 | BeFree | In a small cohort of HCM patients (n=8), we searched for mutations in the two most common genes responsible for HCM and found four missense mutations in the MYH7 gene encoding cardiac β-myosin heavy chain (R204H, M493V, R719W, and R870H) and three mutations in the myosin-binding protein C3 gene (MYBPC3) including one missense (A848V) and two frameshift mutations (c.3713delTG and c.702ins26bp). | 0.162886611 | 2013 | MYH7 | 14 | 23425971 | G | A |
| rs121917776 | 20502710 | 7414 | VCL | umls:C0878544 | BeFree | Finally, the cardiomyopathy associated DeltaLeu954 and Arg975Trp metavinculin mutants reside on the replaced extended coil and the H1' alpha-helix, respectively. | 0.121085767 | 2010 | VCL | 10 | 74112086 | C | T |
| rs121918093 | 25291558 | 7276 | TTR | umls:C0878544 | BeFree | The Wagshurst study: p.Val40Ile transthyretin gene variant causes late-onset cardiomyopathy. | 0.011672 | 2015 | TTR | 18 | 31592944 | G | A |
| rs121918457 | 22585553 | 6654 | SOS1 | umls:C0878544 | BeFree | Here we present a patient with severe, progressive neonatal HCM, elevated urinary catecholamine metabolites, and dysmorphic features in whom we identified a known LEOPARD syndrome-associated PTPN11 mutation (c.1403 C > T; p.T468M) and a novel, potentially pathogenic missense SOS1 variant (c.1018 C > T; p.P340S) replacing a rigid nonpolar imino acid with a polar amino acid at a highly conserved position. | 0.000542884 | 2012 | PTPN11 | 12 | 112488466 | C | T |
| rs12582717 | 24324551 | 10599 | SLCO1B1 | umls:C0878544 | BeFree | The two mostly highly associated SNPs for cardiomyopathy (rs4149018 and rs12582717; P-values <10(-6)) are located on Chromosome 12p12.2 in the SLCO1B1 gene, a solute carrier family member. | 0.000271442 | 2013 | SLCO1B1 | 12 | 21143872 | C | G |
| rs137852764 | NA | 8048 | CSRP3 | umls:C0878544 | CLINVAR | NA | 0.122714419 | NA | CSRP3 | 11 | 19188211 | T | C |
| rs137852765 | NA | 8048 | CSRP3 | umls:C0878544 | CLINVAR | NA | 0.122714419 | NA | CSRP3 | 11 | 19188281 | T | G |
| rs137853197 | NA | 91624 | NEXN | umls:C0878544 | CLINVAR | NA | 0.120814326 | NA | NEXN | 1 | 77942756 | A | G |
| rs138049878 | 21799269 | 4625 | MYH7 | umls:C0878544 | BeFree | Twenty-six patients had single heterozygosity (20 in MYBPC3, 4 in MYH7, 1 in TNNT2, 1 in TNNI3), whereas 2 proband patients with familial HCM had double heterozygosity: 1 with P106fs in MYBPC3 and R869C in MYH7 and 1 with R945fs in MYBPC3 and E1049D in MYH7. | 0.162886611 | 2011 | MYH7 | 14 | 23424840 | G | A |
| rs138049878 | 21799269 | 7137 | TNNI3 | umls:C0878544 | BeFree | Twenty-six patients had single heterozygosity (20 in MYBPC3, 4 in MYH7, 1 in TNNT2, 1 in TNNI3), whereas 2 proband patients with familial HCM had double heterozygosity: 1 with P106fs in MYBPC3 and R869C in MYH7 and 1 with R945fs in MYBPC3 and E1049D in MYH7. | 0.254058896 | 2011 | MYH7 | 14 | 23424840 | G | A |
| rs138049878 | 21799269 | 4607 | MYBPC3 | umls:C0878544 | BeFree | Twenty-six patients had single heterozygosity (20 in MYBPC3, 4 in MYH7, 1 in TNNT2, 1 in TNNI3), whereas 2 proband patients with familial HCM had double heterozygosity: 1 with P106fs in MYBPC3 and R869C in MYH7 and 1 with R945fs in MYBPC3 and E1049D in MYH7. | 0.161052531 | 2011 | MYH7 | 14 | 23424840 | G | A |
| rs138218523 | NA | 8048 | CSRP3 | umls:C0878544 | CLINVAR | NA | 0.122714419 | NA | CSRP3 | 11 | 19186331 | C | T |
| rs140126678 | 22987565 | 51778 | MYOZ2 | umls:C0878544 | BeFree | We generated multiple lines of transgenic mice expressing either Flag-tagged wild-type (WT) (MYOZ2(WT)) or mutant MYOZ2(S48P) and MYOZ2(I246M), identified in families with HCM, in the heart. | 0.003181358 | 2013 | MYOZ2 | 4 | 119186143 | A | G |
| rs140148105 | NA | 84665 | MYPN | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | MYPN | 10 | 68121497 | A | G |
| rs140740776 | NA | 57158 | JPH2 | umls:C0878544 | CLINVAR | NA | 0.125819831 | NA | JPH2 | 20 | 44116162 | C | G,T |
| rs141083503 | 10606622 | 4624 | MYH6 | umls:C0878544 | BeFree | We have developed a transgenic rabbit model for HCM caused by a common point mutation in the beta-myosin heavy chain (MyHC) gene, R400Q. | 0.003181358 | 1999 | MYH6 | 14 | 23402496 | C | T |
| rs144799937 | NA | 1824 | DSC2 | umls:C0878544 | CLINVAR | NA | 0.123181358 | NA | DSC2 | 18 | 31092151 | C | T |
| rs145387010 | NA | 27063 | ANKRD1 | umls:C0878544 | CLINVAR | NA | 0.120542884 | NA | ANKRD1 | 10 | 90918950 | G | A |
| rs145476705 | NA | 1824 | DSC2 | umls:C0878544 | CLINVAR | NA | 0.123181358 | NA | DSC2 | 18 | 31087781 | A | G,T |
| rs146336815 | NA | 84665 | MYPN | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | MYPN | 10 | 68122283 | A | G |
| rs148515772 | NA | 2010 | EMD | umls:C0878544 | CLINVAR | NA | 0.124895885 | NA | EMD | X | 154380902 | G | A |
| rs149433837 | NA | 88 | ACTN2 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | ACTN2 | 1 | 236757492 | C | A,T |
| rs149887823 | NA | 84665 | MYPN | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | MYPN | 10 | 68189064 | C | G,T |
| rs151266052 | 22972948 | 6390 | SDHB | umls:C0878544 | BeFree | Here, we report the clinical and molecular investigations of two patients with histochemical and biochemical evidence of a severe, isolated complex II deficiency due to novel SDH gene mutations; the first patient presented with cardiomyopathy and leukodystrophy due to compound heterozygous p.Thr508Ile and p.Ser509Leu SDHA mutations, while the second patient presented with hypotonia and leukodystrophy with elevated brain succinate demonstrated by MR spectroscopy due to a novel, homozygous p.Asp48Val SDHB mutation. | 0.000542884 | 2012 | SDHA | 5 | 240448 | C | T |
| rs151266052 | 22972948 | 6389 | SDHA | umls:C0878544 | BeFree | Here, we report the clinical and molecular investigations of two patients with histochemical and biochemical evidence of a severe, isolated complex II deficiency due to novel SDH gene mutations; the first patient presented with cardiomyopathy and leukodystrophy due to compound heterozygous p.Thr508Ile and p.Ser509Leu SDHA mutations, while the second patient presented with hypotonia and leukodystrophy with elevated brain succinate demonstrated by MR spectroscopy due to a novel, homozygous p.Asp48Val SDHB mutation. | 0.000271442 | 2012 | SDHA | 5 | 240448 | C | T |
| rs1799945 | 10024915 | 3077 | HFE | umls:C0878544 | BeFree | Two siblings in a pedigree without cardiomyopathy were wild-type at the HFE C282Y locus; although the brother harboured a single copy of the 187C-->G (H63D) allele, segregation analysis showed that in neither sibling was the iron-storage disease linked to MHC Class I markers on chromosome 6p. | 0.003181358 | 1998 | HFE | 6 | 26090951 | C | G |
| rs1799998 | 17318792 | 1585 | CYP11B2 | umls:C0878544 | BeFree | Thus, the association between the CYP11B2 C-344T polymorphism and hypertrophy in HCM most likely relates to the T allele-related increases in circulating aldosterone. | 0.010282454 | 2006 | CYP11B2;LOC105375793 | 8 | 142918184 | A | G |
| rs1800562 | 10024915 | 3077 | HFE | umls:C0878544 | BeFree | Two siblings in a pedigree without cardiomyopathy were wild-type at the HFE C282Y locus; although the brother harboured a single copy of the 187C-->G (H63D) allele, segregation analysis showed that in neither sibling was the iron-storage disease linked to MHC Class I markers on chromosome 6p. | 0.003181358 | 1998 | HFE | 6 | 26092913 | G | A |
| rs185821167 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31524749 | G | A |
| rs186964570 | 19645038 | 4625 | MYH7 | umls:C0878544 | BeFree | The novel double mutation of Ala26Val plus Arg719Trp in MYH7 identified in a Chinese family highlights the remarkable genetic heterogeneity of HCM, which provides important information for genetic counseling, accurate diagnosis, prognostic evaluation, and appropriate clinical management. | 0.162886611 | 2009 | MYH7 | 14 | 23433656 | G | A |
| rs189115557 | 10737981 | 2720 | GLB1 | umls:C0878544 | BeFree | Interestingly, all patients with cardiac involvement were homozygous for one of these mutations: R59H, Y591C, Y591N, or IVS14-2A>G. In contrast, all other patients were compound heterozygous for one of the following mutations: R201H, R482H, G579D, IVS8+2T>C. Although we could not directly correlate the presence of cardiac abnormalities with specific genetic lesions, the mutations identified in patients with cardiomyopathy fell in the GLB1 cDNA region common to the lysosomal enzyme and the Hbeta-Gal-related protein, also known as the elastin binding protein (EBP). | 0.000542884 | 2000 | GLB1 | 3 | 33058220 | C | T |
| rs189115557 | 10737981 | 2006 | ELN | umls:C0878544 | BeFree | Interestingly, all patients with cardiac involvement were homozygous for one of these mutations: R59H, Y591C, Y591N, or IVS14-2A>G. In contrast, all other patients were compound heterozygous for one of the following mutations: R201H, R482H, G579D, IVS8+2T>C. Although we could not directly correlate the presence of cardiac abnormalities with specific genetic lesions, the mutations identified in patients with cardiomyopathy fell in the GLB1 cDNA region common to the lysosomal enzyme and the Hbeta-Gal-related protein, also known as the elastin binding protein (EBP). | 0.000814326 | 2000 | GLB1 | 3 | 33058220 | C | T |
| rs190222208 | 22585553 | 6654 | SOS1 | umls:C0878544 | BeFree | Here we present a patient with severe, progressive neonatal HCM, elevated urinary catecholamine metabolites, and dysmorphic features in whom we identified a known LEOPARD syndrome-associated PTPN11 mutation (c.1403 C > T; p.T468M) and a novel, potentially pathogenic missense SOS1 variant (c.1018 C > T; p.P340S) replacing a rigid nonpolar imino acid with a polar amino acid at a highly conserved position. | 0.000542884 | 2012 | SOS1 | 2 | 39035268 | G | A |
| rs193298428 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31536259 | A | C |
| rs193922389 | NA | 4625 | MYH7 | umls:C0878544 | CLINVAR | NA | 0.162886611 | NA | MYH7;MIR208B | 14 | 23419555 | T | G |
| rs193922626 | NA | 6262 | RYR2 | umls:C0878544 | CLINVAR | NA | 0.123181358 | NA | RYR2 | 1 | 237590901 | G | A,C |
| rs193922667 | NA | 8048 | CSRP3 | umls:C0878544 | CLINVAR | NA | 0.122714419 | NA | CSRP3 | 11 | 19186265 | C | T |
| rs193922668 | NA | 1832 | DSP | umls:C0878544 | CLINVAR | NA | 0.132158802 | NA | DSP | 6 | 7568554 | ATT | - |
| rs193922671 | NA | 1832 | DSP | umls:C0878544 | CLINVAR | NA | 0.132158802 | NA | DSP | 6 | 7585226 | C | G |
| rs193922680 | 17611253 | 70 | ACTC1 | umls:C0878544 | BeFree | Clinical, echocardiographic, and genetic screening by restriction fragment length polymorphism of the ACTC E101K mutation in 247 families with HCM, DCM, or LVNC. | 0.009087065 | 2007 | ACTC1;LOC101928174 | 15 | 34793398 | C | T |
| rs193922683 | NA | 10060 | ABCC9 | umls:C0878544 | CLINVAR | NA | 0.12 | NA | ABCC9 | 12 | 21852457 | G | A |
| rs193922693 | NA | 7840 | ALMS1 | umls:C0878544 | CLINVAR | NA | 0.120542884 | NA | ALMS1 | 2 | 73448392 | A | G |
| rs193922697 | NA | 51422 | PRKAG2 | umls:C0878544 | CLINVAR | NA | 0.127077352 | NA | PRKAG2 | 7 | 151576438 | G | T,A |
| rs193922708 | NA | 1824 | DSC2 | umls:C0878544 | CLINVAR | NA | 0.123181358 | NA | DSC2 | 18 | 31086683 | G | A |
| rs193922712 | NA | 85366 | MYLK2 | umls:C0878544 | CLINVAR | NA | 0.12 | NA | MYLK2 | 20 | 31821560 | A | G |
| rs199473157 | NA | 6331 | SCN5A | umls:C0878544 | CLINVAR | NA | 0.123181358 | NA | SCN5A | 3 | 38587522 | C | T |
| rs199476314 | 12778034 | 7168 | TPM1 | umls:C0878544 | BeFree | We report the echocardiographic findings of a family with HCM and a newly reported mutation in the gene (TPM1) encoding alpha-tropomyosin.Methods and results An 8-year-old girl had sudden cardiac death, and was found to have HCM and a novel L185R-TPM1 mutation on postmortem examination. | 0.127252986 | 2003 | TPM1 | 15 | 63060930 | T | G |
| rs199476316 | NA | 7168 | TPM1 | umls:C0878544 | CLINVAR | NA | 0.127252986 | NA | TPM1 | 15 | 63062219 | C | T |
| rs199476398 | 22987565 | 51778 | MYOZ2 | umls:C0878544 | BeFree | We generated multiple lines of transgenic mice expressing either Flag-tagged wild-type (WT) (MYOZ2(WT)) or mutant MYOZ2(S48P) and MYOZ2(I246M), identified in families with HCM, in the heart. | 0.003181358 | 2013 | MYOZ2 | 4 | 119150937 | T | C |
| rs199476416 | NA | 84665 | MYPN | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | MYPN;LOC105378341 | 10 | 68206903 | G | A,C |
| rs199920384 | NA | 88 | ACTN2 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | ACTN2 | 1 | 236762612 | A | G |
| rs200422162 | 22462493 | 7168 | TPM1 | umls:C0878544 | BeFree | The TPM1-D175N and MYBPC3-Q1061X mutations account for a substantial part of all HCM cases in the Finnish population, indicating that routine genetic screening of these mutations is warranted in Finnish patients with HCM. | 0.127252986 | 2013 | PRH1;TAS2R43;PRH1-PRR4;PRH1-TAS2R14 | 12 | 11091704 | T | C |
| rs200422162 | 22462493 | 5554 | PRH1 | umls:C0878544 | BeFree | The TPM1-D175N and MYBPC3-Q1061X mutations account for a substantial part of all HCM cases in the Finnish population, indicating that routine genetic screening of these mutations is warranted in Finnish patients with HCM. | 0.005157396 | 2013 | PRH1;TAS2R43;PRH1-PRR4;PRH1-TAS2R14 | 12 | 11091704 | T | C |
| rs200631005 | NA | 88 | ACTN2 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | ACTN2 | 1 | 236751561 | A | C,G |
| rs200804638 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31541198 | C | T |
| rs201564919 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31541225 | G | A |
| rs201716668 | 10737981 | 2720 | GLB1 | umls:C0878544 | BeFree | Interestingly, all patients with cardiac involvement were homozygous for one of these mutations: R59H, Y591C, Y591N, or IVS14-2A>G. In contrast, all other patients were compound heterozygous for one of the following mutations: R201H, R482H, G579D, IVS8+2T>C. Although we could not directly correlate the presence of cardiac abnormalities with specific genetic lesions, the mutations identified in patients with cardiomyopathy fell in the GLB1 cDNA region common to the lysosomal enzyme and the Hbeta-Gal-related protein, also known as the elastin binding protein (EBP). | 0.000542884 | 2000 | ELN | 7 | 74063213 | G | A |
| rs201716668 | 10737981 | 2006 | ELN | umls:C0878544 | BeFree | Interestingly, all patients with cardiac involvement were homozygous for one of these mutations: R59H, Y591C, Y591N, or IVS14-2A>G. In contrast, all other patients were compound heterozygous for one of the following mutations: R201H, R482H, G579D, IVS8+2T>C. Although we could not directly correlate the presence of cardiac abnormalities with specific genetic lesions, the mutations identified in patients with cardiomyopathy fell in the GLB1 cDNA region common to the lysosomal enzyme and the Hbeta-Gal-related protein, also known as the elastin binding protein (EBP). | 0.000814326 | 2000 | ELN | 7 | 74063213 | G | A |
| rs202101384 | 22972948 | 6390 | SDHB | umls:C0878544 | BeFree | Here, we report the clinical and molecular investigations of two patients with histochemical and biochemical evidence of a severe, isolated complex II deficiency due to novel SDH gene mutations; the first patient presented with cardiomyopathy and leukodystrophy due to compound heterozygous p.Thr508Ile and p.Ser509Leu SDHA mutations, while the second patient presented with hypotonia and leukodystrophy with elevated brain succinate demonstrated by MR spectroscopy due to a novel, homozygous p.Asp48Val SDHB mutation. | 0.000542884 | 2012 | SDHB | 1 | 17044818 | T | A |
| rs202101384 | 22972948 | 6389 | SDHA | umls:C0878544 | BeFree | Here, we report the clinical and molecular investigations of two patients with histochemical and biochemical evidence of a severe, isolated complex II deficiency due to novel SDH gene mutations; the first patient presented with cardiomyopathy and leukodystrophy due to compound heterozygous p.Thr508Ile and p.Ser509Leu SDHA mutations, while the second patient presented with hypotonia and leukodystrophy with elevated brain succinate demonstrated by MR spectroscopy due to a novel, homozygous p.Asp48Val SDHB mutation. | 0.000271442 | 2012 | SDHB | 1 | 17044818 | T | A |
| rs202141173 | 23816408 | 4625 | MYH7 | umls:C0878544 | BeFree | In a small cohort of HCM patients (n=8), we searched for mutations in the two most common genes responsible for HCM and found four missense mutations in the MYH7 gene encoding cardiac β-myosin heavy chain (R204H, M493V, R719W, and R870H) and three mutations in the myosin-binding protein C3 gene (MYBPC3) including one missense (A848V) and two frameshift mutations (c.3713delTG and c.702ins26bp). | 0.162886611 | 2013 | MYH7 | 14 | 23424842 | C | T |
| rs2230234 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31524751 | A | G,T |
| rs267607001 | NA | 282996 | RBM20 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | RBM20 | 10 | 110812298 | G | A |
| rs267607002 | NA | 282996 | RBM20 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | RBM20 | 10 | 110812303 | C | A,T |
| rs267607003 | NA | 282996 | RBM20 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | RBM20 | 10 | 110812310 | C | T |
| rs267607004 | NA | 282996 | RBM20 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | RBM20 | 10 | 110812304 | G | A |
| rs267607123 | 18820258 | 7134 | TNNC1 | umls:C0878544 | BeFree | Challenging current paradigms related to cardiomyopathies. Are changes in the Ca2+ sensitivity of myofilaments containing cardiac troponin C mutations (G159D and L29Q) good predictors of the phenotypic outcomes? | 0.004895885 | 2008 | TNNC1 | 3 | 52452222 | A | T |
| rs267607128 | 22086914 | 7137 | TNNI3 | umls:C0878544 | BeFree | Altogether, the combined effects of the R21C mutation appear to contribute toward the development of HCM and suggest that another physiological role for the phosphorylation of Ser(23)/Ser(24) in cTnI is to prevent cardiac hypertrophy. | 0.254058896 | 2012 | TNNI3 | 19 | 55157097 | G | A |
| rs267607486 | 19005210 | 1674 | DES | umls:C0878544 | BeFree | Here, we examined a desmin mutation, E245D, that is located within the coil IB (nebulin-binding) region of desmin and that has been reported to cause human cardiomyopathy and skeletal muscle atrophy. | 0.011324614 | 2009 | DES | 2 | 219420346 | G | C |
| rs267607486 | 19005210 | 4703 | NEB | umls:C0878544 | BeFree | Here, we examined a desmin mutation, E245D, that is located within the coil IB (nebulin-binding) region of desmin and that has been reported to cause human cardiomyopathy and skeletal muscle atrophy. | 0.000271442 | 2009 | DES | 2 | 219420346 | G | C |
| rs267607490 | 20423733 | 5318 | PKP2 | umls:C0878544 | BeFree | Moreover, we demonstrated that the DES mutation p.R454W affects the localization of desmoplakin and plakophilin-2 at the intercalated disk, suggesting a link between desmosomal cardiomyopathies (mainly affecting the right ventricle) and cardiomyopathies caused by DES mutations. | 0.010725648 | 2010 | DES | 2 | 219425734 | C | T |
| rs267607490 | 20423733 | 1832 | DSP | umls:C0878544 | BeFree | Moreover, we demonstrated that the DES mutation p.R454W affects the localization of desmoplakin and plakophilin-2 at the intercalated disk, suggesting a link between desmosomal cardiomyopathies (mainly affecting the right ventricle) and cardiomyopathies caused by DES mutations. | 0.132158802 | 2010 | DES | 2 | 219425734 | C | T |
| rs267607577 | NA | 4000 | LMNA | umls:C0878544 | CLINVAR | NA | 0.139964603 | NA | LMNA | 1 | 156136363 | - | GCAC |
| rs36211715 | 23816408 | 4625 | MYH7 | umls:C0878544 | BeFree | In a small cohort of HCM patients (n=8), we searched for mutations in the two most common genes responsible for HCM and found four missense mutations in the MYH7 gene encoding cardiac β-myosin heavy chain (R204H, M493V, R719W, and R870H) and three mutations in the myosin-binding protein C3 gene (MYBPC3) including one missense (A848V) and two frameshift mutations (c.3713delTG and c.702ins26bp). | 0.162886611 | 2013 | MYH7 | 14 | 23424839 | C | T |
| rs370840449 | NA | 2010 | EMD | umls:C0878544 | CLINVAR | NA | 0.124895885 | NA | EMD | X | 154380807 | G | A |
| rs373542380 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31521111 | G | A,T |
| rs375679311 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31536256 | A | G |
| rs377272752 | NA | 1824 | DSC2 | umls:C0878544 | CLINVAR | NA | 0.123181358 | NA | DSC2 | 18 | 31069032 | TCC | - |
| rs387906958 | 21931170 | 51103 | NDUFAF1 | umls:C0878544 | BeFree | Sequence analysis of NDUFAF1 revealed compound heterozygous missense mutations (c.631C>T;p.Arg211Cys and c.733G>A;p.Gly245Arg) in one patient with fatal infantile HCM. | 0.000271442 | 2011 | NDUFAF1 | 15 | 41394987 | G | A |
| rs387907267 | 19858127 | 4607 | MYBPC3 | umls:C0878544 | BeFree | We have identified an infant with fatal cardiomyopathy due to a homozygous mutation, p.R943X, in MYBPC3. | 0.161052531 | 2010 | MYBPC3 | 11 | 47335120 | G | A |
| rs387907339 | 21920752 | 1410 | CRYAB | umls:C0878544 | BeFree | We report a novel CRYAB mutation, D109H, associated with posterior polar cataract, myofibrillar myopathy and cardiomyopathy in a two-generation family with five affected individuals. | 0.004895885 | 2012 | CRYAB | 11 | 111908967 | C | G |
| rs397514038 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31541191 | A | G |
| rs397514042 | NA | 1824 | DSC2 | umls:C0878544 | CLINVAR | NA | 0.123181358 | NA | DSC2 | 18 | 31087815 | T | C |
| rs397514541 | 22972948 | 6390 | SDHB | umls:C0878544 | BeFree | Here, we report the clinical and molecular investigations of two patients with histochemical and biochemical evidence of a severe, isolated complex II deficiency due to novel SDH gene mutations; the first patient presented with cardiomyopathy and leukodystrophy due to compound heterozygous p.Thr508Ile and p.Ser509Leu SDHA mutations, while the second patient presented with hypotonia and leukodystrophy with elevated brain succinate demonstrated by MR spectroscopy due to a novel, homozygous p.Asp48Val SDHB mutation. | 0.000542884 | 2012 | SDHA | 5 | 240451 | C | T |
| rs397514541 | 22972948 | 6389 | SDHA | umls:C0878544 | BeFree | Here, we report the clinical and molecular investigations of two patients with histochemical and biochemical evidence of a severe, isolated complex II deficiency due to novel SDH gene mutations; the first patient presented with cardiomyopathy and leukodystrophy due to compound heterozygous p.Thr508Ile and p.Ser509Leu SDHA mutations, while the second patient presented with hypotonia and leukodystrophy with elevated brain succinate demonstrated by MR spectroscopy due to a novel, homozygous p.Asp48Val SDHB mutation. | 0.000271442 | 2012 | SDHA | 5 | 240451 | C | T |
| rs397515871 | 22336178 | 2717 | GLA | umls:C0878544 | BeFree | We present an illustrative case: a 10-year-old girl with isolated HCM who, on testing with a HCM multi-gene panel, was found to carry a maternally inherited p.W24R variant in GLA. | 0.001085767 | 2012 | GLA;HNRNPH2;RPL36A-HNRNPH2 | X | 101407834 | A | T |
| rs397516089 | NA | 4625 | MYH7 | umls:C0878544 | CLINVAR | NA | 0.162886611 | NA | MYH7 | 14 | 23429807 | C | T,G |
| rs397516248 | 25576864 | 4625 | MYH7 | umls:C0878544 | BeFree | We describe three members of a family with an autosomal dominant mutation in the distal rod of MYH7 [c.5401G> A (p.Glu1801Lys)] displaying a complex phenotype characterized by Laing Distal Myopathy like phenotype, left ventricular non compaction cardiomyopathy and Fiber Type Disproportion picture at muscle biopsy. | 0.162886611 | 2014 | MYH7;MHRT | 14 | 23415153 | C | T |
| rs397516260 | 23816408 | 4625 | MYH7 | umls:C0878544 | BeFree | In a small cohort of HCM patients (n=8), we searched for mutations in the two most common genes responsible for HCM and found four missense mutations in the MYH7 gene encoding cardiac β-myosin heavy chain (R204H, M493V, R719W, and R870H) and three mutations in the myosin-binding protein C3 gene (MYBPC3) including one missense (A848V) and two frameshift mutations (c.3713delTG and c.702ins26bp). | 0.162886611 | 2013 | MYH7 | 14 | 23431789 | C | T,A |
| rs397516702 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31519873 | G | T |
| rs397516703 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31538872 | TG | - |
| rs397516709 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31521245 | T | C |
| rs397516740 | NA | 3920 | LAMP2 | umls:C0878544 | CLINVAR | NA | 0.125167327 | NA | LAMP2 | X | 120455461 | C | T |
| rs397516751 | NA | 3920 | LAMP2 | umls:C0878544 | CLINVAR | NA | 0.125167327 | NA | LAMP2 | X | 120446299 | ACTC | - |
| rs397517237 | NA | 7414 | VCL | umls:C0878544 | CLINVAR | NA | 0.121085767 | NA | VCL | 10 | 74112025 | GTT | - |
| rs397517244 | NA | 7414 | VCL | umls:C0878544 | CLINVAR | NA | 0.121085767 | NA | VCL | 10 | 74072792 | C | T |
| rs397517406 | NA | 1824 | DSC2 | umls:C0878544 | CLINVAR | NA | 0.123181358 | NA | DSC2 | 18 | 31086672 | G | C |
| rs397517858 | NA | 91624 | NEXN | umls:C0878544 | CLINVAR | NA | 0.120814326 | NA | NEXN | 1 | 77918218 | A | G |
| rs4149018 | 24324551 | 10599 | SLCO1B1 | umls:C0878544 | BeFree | The two mostly highly associated SNPs for cardiomyopathy (rs4149018 and rs12582717; P-values <10(-6)) are located on Chromosome 12p12.2 in the SLCO1B1 gene, a solute carrier family member. | 0.000271442 | 2013 | SLCO1B1 | 12 | 21138627 | T | G |
| rs554853074 | NA | 57158 | JPH2 | umls:C0878544 | CLINVAR | NA | 0.125819831 | NA | JPH2 | 20 | 44160215 | G | C |
| rs59270054 | 16630578 | 4000 | LMNA | umls:C0878544 | BeFree | Mutation Glu82Lys in lamin A/C gene is associated with cardiomyopathy and conduction defect. | 0.139964603 | 2006 | LMNA | 1 | 156115162 | G | A |
| rs71534278 | NA | 84665 | MYPN | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | MYPN;LOC105378341 | 10 | 68199417 | C | A,T |
| rs71534280 | NA | 84665 | MYPN | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | MYPN;LOC105378341 | 10 | 68201918 | G | A |
| rs72552291 | NA | 23171 | GPD1L | umls:C0878544 | CLINVAR | NA | 0.12 | NA | GPD1L | 3 | 32159096 | C | T |
| rs72552293 | NA | 23171 | GPD1L | umls:C0878544 | CLINVAR | NA | 0.12 | NA | GPD1L | 3 | 32140231 | A | G |
| rs72552294 | NA | 23171 | GPD1L | umls:C0878544 | CLINVAR | NA | 0.12 | NA | GPD1L | 3 | 32159074 | C | T |
| rs72555371 | 10737981 | 2720 | GLB1 | umls:C0878544 | BeFree | Interestingly, all patients with cardiac involvement were homozygous for one of these mutations: R59H, Y591C, Y591N, or IVS14-2A>G. In contrast, all other patients were compound heterozygous for one of the following mutations: R201H, R482H, G579D, IVS8+2T>C. Although we could not directly correlate the presence of cardiac abnormalities with specific genetic lesions, the mutations identified in patients with cardiomyopathy fell in the GLB1 cDNA region common to the lysosomal enzyme and the Hbeta-Gal-related protein, also known as the elastin binding protein (EBP). | 0.000542884 | 2000 | GLB1 | 3 | 32997307 | T | C |
| rs72555371 | 10737981 | 2006 | ELN | umls:C0878544 | BeFree | Interestingly, all patients with cardiac involvement were homozygous for one of these mutations: R59H, Y591C, Y591N, or IVS14-2A>G. In contrast, all other patients were compound heterozygous for one of the following mutations: R201H, R482H, G579D, IVS8+2T>C. Although we could not directly correlate the presence of cardiac abnormalities with specific genetic lesions, the mutations identified in patients with cardiomyopathy fell in the GLB1 cDNA region common to the lysosomal enzyme and the Hbeta-Gal-related protein, also known as the elastin binding protein (EBP). | 0.000814326 | 2000 | GLB1 | 3 | 32997307 | T | C |
| rs72555373 | 10737981 | 2006 | ELN | umls:C0878544 | BeFree | Interestingly, all patients with cardiac involvement were homozygous for one of these mutations: R59H, Y591C, Y591N, or IVS14-2A>G. In contrast, all other patients were compound heterozygous for one of the following mutations: R201H, R482H, G579D, IVS8+2T>C. Although we could not directly correlate the presence of cardiac abnormalities with specific genetic lesions, the mutations identified in patients with cardiomyopathy fell in the GLB1 cDNA region common to the lysosomal enzyme and the Hbeta-Gal-related protein, also known as the elastin binding protein (EBP). | 0.000814326 | 2000 | GLB1 | 3 | 32997308 | A | T,G |
| rs72555373 | 10737981 | 2720 | GLB1 | umls:C0878544 | BeFree | Interestingly, all patients with cardiac involvement were homozygous for one of these mutations: R59H, Y591C, Y591N, or IVS14-2A>G. In contrast, all other patients were compound heterozygous for one of the following mutations: R201H, R482H, G579D, IVS8+2T>C. Although we could not directly correlate the presence of cardiac abnormalities with specific genetic lesions, the mutations identified in patients with cardiomyopathy fell in the GLB1 cDNA region common to the lysosomal enzyme and the Hbeta-Gal-related protein, also known as the elastin binding protein (EBP). | 0.000542884 | 2000 | GLB1 | 3 | 32997308 | A | T,G |
| rs72555391 | 10737981 | 2006 | ELN | umls:C0878544 | BeFree | Interestingly, all patients with cardiac involvement were homozygous for one of these mutations: R59H, Y591C, Y591N, or IVS14-2A>G. In contrast, all other patients were compound heterozygous for one of the following mutations: R201H, R482H, G579D, IVS8+2T>C. Although we could not directly correlate the presence of cardiac abnormalities with specific genetic lesions, the mutations identified in patients with cardiomyopathy fell in the GLB1 cDNA region common to the lysosomal enzyme and the Hbeta-Gal-related protein, also known as the elastin binding protein (EBP). | 0.000814326 | 2000 | GLB1 | 3 | 33016743 | C | T |
| rs72555391 | 10737981 | 2720 | GLB1 | umls:C0878544 | BeFree | Interestingly, all patients with cardiac involvement were homozygous for one of these mutations: R59H, Y591C, Y591N, or IVS14-2A>G. In contrast, all other patients were compound heterozygous for one of the following mutations: R201H, R482H, G579D, IVS8+2T>C. Although we could not directly correlate the presence of cardiac abnormalities with specific genetic lesions, the mutations identified in patients with cardiomyopathy fell in the GLB1 cDNA region common to the lysosomal enzyme and the Hbeta-Gal-related protein, also known as the elastin binding protein (EBP). | 0.000542884 | 2000 | GLB1 | 3 | 33016743 | C | T |
| rs72555392 | 10737981 | 2720 | GLB1 | umls:C0878544 | BeFree | Interestingly, all patients with cardiac involvement were homozygous for one of these mutations: R59H, Y591C, Y591N, or IVS14-2A>G. In contrast, all other patients were compound heterozygous for one of the following mutations: R201H, R482H, G579D, IVS8+2T>C. Although we could not directly correlate the presence of cardiac abnormalities with specific genetic lesions, the mutations identified in patients with cardiomyopathy fell in the GLB1 cDNA region common to the lysosomal enzyme and the Hbeta-Gal-related protein, also known as the elastin binding protein (EBP). | 0.000542884 | 2000 | GLB1 | 3 | 33072613 | C | T |
| rs72555392 | 10737981 | 2006 | ELN | umls:C0878544 | BeFree | Interestingly, all patients with cardiac involvement were homozygous for one of these mutations: R59H, Y591C, Y591N, or IVS14-2A>G. In contrast, all other patients were compound heterozygous for one of the following mutations: R201H, R482H, G579D, IVS8+2T>C. Although we could not directly correlate the presence of cardiac abnormalities with specific genetic lesions, the mutations identified in patients with cardiomyopathy fell in the GLB1 cDNA region common to the lysosomal enzyme and the Hbeta-Gal-related protein, also known as the elastin binding protein (EBP). | 0.000814326 | 2000 | GLB1 | 3 | 33072613 | C | T |
| rs727503119 | NA | 3920 | LAMP2 | umls:C0878544 | CLINVAR | NA | 0.125167327 | NA | LAMP2 | X | 120446304 | C | T,A |
| rs727504872 | NA | 7137 | TNNI3 | umls:C0878544 | CLINVAR | NA | 0.254058896 | NA | TNNI3 | 19 | 55156279 | C | - |
| rs727505310 | NA | 282996 | RBM20 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | RBM20 | 10 | 110812355 | C | T |
| rs730880479 | NA | 3920 | LAMP2 | umls:C0878544 | CLINVAR | NA | 0.125167327 | NA | LAMP2 | X | 120456646 | C | T |
| rs730880482 | NA | 3920 | LAMP2 | umls:C0878544 | CLINVAR | NA | 0.125167327 | NA | LAMP2 | X | 120447845 | T | C |
| rs730880483 | NA | 3920 | LAMP2 | umls:C0878544 | CLINVAR | NA | 0.125167327 | NA | LAMP2 | X | 120446374 | G | T |
| rs730880485 | NA | 3920 | LAMP2 | umls:C0878544 | CLINVAR | NA | 0.125167327 | NA | LAMP2 | X | 120446303 | A | G |
| rs730880486 | NA | 3920 | LAMP2 | umls:C0878544 | CLINVAR | NA | 0.125167327 | NA | LAMP2 | X | 120442640 | A | G |
| rs730880490 | NA | 3920 | LAMP2 | umls:C0878544 | CLINVAR | NA | 0.125167327 | NA | LAMP2 | X | 120469104 | A | T |
| rs730880491 | NA | 3920 | LAMP2 | umls:C0878544 | CLINVAR | NA | 0.125167327 | NA | LAMP2 | X | 120448990 | T | - |
| rs730880492 | NA | 3920 | LAMP2 | umls:C0878544 | CLINVAR | NA | 0.125167327 | NA | LAMP2 | X | 120447993 | - | TGTTG |
| rs730880493 | NA | 3920 | LAMP2 | umls:C0878544 | CLINVAR | NA | 0.125167327 | NA | LAMP2 | X | 120447930 | - | T |
| rs730880496 | NA | 3920 | LAMP2 | umls:C0878544 | CLINVAR | NA | 0.125167327 | NA | LAMP2 | X | 120456770 | C | G |
| rs730880498 | NA | 3920 | LAMP2 | umls:C0878544 | CLINVAR | NA | 0.125167327 | NA | LAMP2 | X | 120441849 | A | - |
| rs751012696 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31524763 | G | A |
| rs752432726 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31524754 | A | G |
| rs756709134 | NA | 91624 | NEXN | umls:C0878544 | CLINVAR | NA | 0.120814326 | NA | NEXN | 1 | 77942606 | C | T |
| rs758950880 | NA | 1824 | DSC2 | umls:C0878544 | CLINVAR | NA | 0.123181358 | NA | DSC2 | 18 | 31068145 | T | C |
| rs763078071 | NA | 88 | ACTN2 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | ACTN2 | 1 | 236762512 | C | G |
| rs772909106 | NA | 88 | ACTN2 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | ACTN2 | 1 | 236754026 | G | A |
| rs774863785 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31531167 | G | A |
| rs778127887 | NA | 79188 | TMEM43 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | TMEM43 | 3 | 14141613 | C | T |
| rs779637525 | NA | 85366 | MYLK2 | umls:C0878544 | CLINVAR | NA | 0.12 | NA | MYLK2 | 20 | 31826918 | G | T |
| rs780970079 | NA | 1824 | DSC2 | umls:C0878544 | CLINVAR | NA | 0.123181358 | NA | DSC2 | 18 | 31068135 | - | CTTC |
| rs794728072 | NA | 1824 | DSC2 | umls:C0878544 | CLINVAR | NA | 0.123181358 | NA | DSC2 | 18 | 31071604 | C | - |
| rs794728073 | NA | 1824 | DSC2 | umls:C0878544 | CLINVAR | NA | 0.123181358 | NA | DSC2 | 18 | 31068915 | A | - |
| rs794728075 | NA | 1824 | DSC2 | umls:C0878544 | CLINVAR | NA | 0.123181358 | NA | DSC2 | 18 | 31082378 | G | C |
| rs794728076 | NA | 1824 | DSC2 | umls:C0878544 | CLINVAR | NA | 0.123181358 | NA | DSC2 | 18 | 31080340 | C | T |
| rs794728077 | NA | 1824 | DSC2 | umls:C0878544 | CLINVAR | NA | 0.123181358 | NA | DSC2 | 18 | 31068173 | C | AA |
| rs794728083 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31524526 | C | T |
| rs794728086 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31538849 | C | T |
| rs794728091 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31521184 | - | T |
| rs794728092 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31522160 | GTATC | - |
| rs794728093 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31524703 | CTTGAAGGGATG | - |
| rs794728094 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31530987 | G | - |
| rs794728100 | NA | 1829 | DSG2 | umls:C0878544 | CLINVAR | NA | 0.125091382 | NA | DSG2 | 18 | 31519807 | TA | ATTCTATTGTTGTGCTATTGTTAT |
| rs794728960 | NA | 88 | ACTN2 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | ACTN2 | 1 | 236719005 | G | A |
| rs794728966 | NA | 88 | ACTN2 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | ACTN2 | 1 | 236762460 | G | A |
| rs794728975 | NA | 27063 | ANKRD1 | umls:C0878544 | CLINVAR | NA | 0.120542884 | NA | ANKRD1 | 10 | 90912966 | G | A |
| rs794729010 | NA | 2010 | EMD | umls:C0878544 | CLINVAR | NA | 0.124895885 | NA | EMD | X | 154379795 | G | T |
| rs794729075 | NA | 84665 | MYPN | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | MYPN | 10 | 68197426 | C | A |
| rs794729086 | NA | 91624 | NEXN | umls:C0878544 | CLINVAR | NA | 0.120814326 | NA | NEXN | 1 | 77942736 | C | G |
| rs794729087 | NA | 91624 | NEXN | umls:C0878544 | CLINVAR | NA | 0.120814326 | NA | NEXN | 1 | 77942801 | G | A |
| rs794729143 | NA | 282996 | RBM20 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | RBM20 | 10 | 110781765 | C | T |
| rs794729145 | NA | 282996 | RBM20 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | RBM20 | 10 | 110797587 | T | C |
| rs794729148 | NA | 282996 | RBM20 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | RBM20 | 10 | 110810449 | C | T |
| rs794729149 | NA | 282996 | RBM20 | umls:C0878544 | CLINVAR | NA | 0.120271442 | NA | RBM20 | 10 | 110812307 | G | A |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:0) |
|---|
| (Waiting for update.) |
Mapped by homologous gene(Total Items:0) |
|---|
| (Waiting for update.) |
| Disease ID | 562 |
|---|---|
| Disease | cardiomyopathy |
| Case | (Waiting for update.) |