eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| blepharophimosis, ptosis, and epicanthus inversus | ||||
| Disease ID | 806 |
|---|---|
| Disease | blepharophimosis, ptosis, and epicanthus inversus |
| Definition | An ophthalmic disorder characterized by blepharophimosis, ptosis, epicanthus inversus, and telecanthus that can appear associated with or without premature ovarian failure. The disorder is congenital. Additional features include lacrimal duct anomalies, broad nasal bridge, low-set ears, and a short philtrum. Occurs either sporadically (de novo) or, for the eyelid phenotype, is inherited in an autosomal dominant manner with complete penetrance. |
| Synonym | blepharophimosis epicanthus inversus ptosis syndrome blepharophimosis epicanthus inversus ptosis syndrome (disorder) blepharophimosis syndrome blepharophimosis syndrome (disorder) blepharophimosis, ptosis, and epicanthus inversus (disorder) blepharophimosis, ptosis, and epicanthus inversus syndrome blepharophimosis, ptosis, and epicanthus inversus type i blepharophimosis, ptosis, and epicanthus inversus, type i bpes bpes syndrome conjunctival eyelid tetra syndrome familial blepharophimosis syndrome |
| OMIM | |
| DOID | |
| UMLS | C0220663 |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:9) C0085215 | premature ovarian failure | 4 C0796075 | axenfeld-rieger syndrome | 2 C0008925 | cleft palate | 1 C0034012 | delayed puberty | 1 C0020619 | hypogonadism | 1 C0021359 | infertility | 1 C0021364 | male infertility | 1 C0032460 | polycystic ovarian disease | 1 C0002418 | amblyopia | 1 |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:19) 23394 | ADNP | 2.373 | DISEASES 2334 | AFF2 | 1.758 | DISEASES 545 | ATR | 2.344 | DISEASES 841 | CASP8 | 1.103 | DISEASES 1123 | CHN1 | 1.797 | DISEASES 11218 | DDX20 | 2.624 | DISEASES 1730 | DIAPH2 | 2.68 | DISEASES 2274 | FHL2 | 1.535 | DISEASES 2303 | FOXC2 | 1.846 | DISEASES 2304 | FOXE1 | 1.563 | DISEASES 668 | FOXL2 | 8.315 | DISEASES 4158 | MC2R | 1.989 | DISEASES 79648 | MCPH1 | 2.202 | DISEASES 2516 | NR5A1 | 2.973 | DISEASES 5096 | PCCB | 2.374 | DISEASES 140464 | PISRT1 | 5.168 | DISEASES 6622 | SNCA | 1.71 | DISEASES 6736 | SRY | 2.181 | DISEASES 84107 | ZIC4 | 4.421 | DISEASES |
| Locus | (Waiting for update.) |
| Disease ID | 806 |
|---|---|
| Disease | blepharophimosis, ptosis, and epicanthus inversus |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:19) HP:0000639 | Nystagmus HP:0000486 | Squint eyes HP:0000141 | Abnormal absence of menstruation HP:0000506 | Telecanthus HP:0008209 | Premature ovarian failure HP:0001595 | Hair abnormality HP:0000482 | Microcornea HP:0000581 | Blepharophimosis HP:0000218 | Increased palatal height HP:0005280 | Flat, nasal bridge HP:0000568 | Abnormally small globe of eye HP:0008222 | Female infertility HP:0000378 | Cupped ear HP:0000431 | Broad nasal root HP:0000508 | Drooping upper eyelid HP:0000540 | Hypermetropia HP:0000837 | Elevated gonadotropins HP:0000769 | Abnormality of the breast HP:0000537 | Epicanthus inversus |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:16) HP:0008209 | Premature ovarian failure | 5 HP:0001263 | Developmental retardation | 2 HP:0000175 | Palatoschisis | 1 HP:0000815 | Primary hypogonadism | 1 HP:0000135 | Hypogonadism | 1 HP:0000646 | Wandering eyes | 1 HP:0000789 | Infertility | 1 HP:0000579 | Nasolacrimal duct obstruction | 1 HP:0000823 | Pubertal delay | 1 HP:0000522 | Absent lacrimal fluids | 1 HP:0000486 | Squint eyes | 1 HP:0008222 | Female infertility | 1 HP:0000537 | Epicanthus inversus | 1 HP:0003251 | Male infertility | 1 HP:0000506 | Telecanthus | 1 HP:0001631 | Atria septal defect | 1 |
| Disease ID | 806 |
|---|---|
| Disease | blepharophimosis, ptosis, and epicanthus inversus |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Manually Genotypes:1) | |||
|---|---|---|---|
| Gene | Mutation | DOI | Article Title |
| FOXL2 | - | doi:10.1038/gim.2015.51 | Clinical performance of the CytoScan Dx Assay in diagnosing developmental delay/intellectual disability |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:14) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs104893739 | NA | 668 | FOXL2 | umls:C0220663 | CLINVAR | NA | 0.448067311 | NA | FOXL2;FOXL2NB | 3 | 138946137 | G | A |
| rs104893741 | NA | 668 | FOXL2 | umls:C0220663 | CLINVAR | NA | 0.448067311 | NA | FOXL2;FOXL2NB | 3 | 138946068 | G | A |
| rs121908359 | NA | 668 | FOXL2 | umls:C0220663 | CLINVAR | NA | 0.448067311 | NA | FOXL2;FOXL2NB | 3 | 138946163 | C | T |
| rs28937884 | 12630957 | 668 | FOXL2 | umls:C0220663 | UNIPROT | The analysis of the FOXL2 gene (3q23) in a series of two families and two sporadic cases affected with Blepharophimosis-Ptosis-Epicanthus Inversus Syndrome (BPES) is presented. | 0.448067311 | 2003 | FOXL2;FOXL2NB | 3 | 138946472 | A | C |
| rs672601357 | NA | 668 | FOXL2 | umls:C0220663 | CLINVAR | NA | 0.448067311 | NA | FOXL2;FOXL2NB | 3 | 138946550 | GAGTACGGGGGCTTCTGCGCCGGGTCCGGCTT | AGCGC |
| rs672601358 | NA | 668 | FOXL2 | umls:C0220663 | CLINVAR | NA | 0.448067311 | NA | FOXL2;FOXL2NB;LINC01391 | 3 | 138945739 | - | GCTGGGCTGGCAGGGCTGA |
| rs672601359 | NA | 668 | FOXL2 | umls:C0220663 | CLINVAR | NA | 0.448067311 | NA | FOXL2;FOXL2NB;LINC01391 | 3 | 138945863 | - | GAGGCGGGGGTGCGGCC |
| rs797044527 | NA | 668 | FOXL2 | umls:C0220663 | CLINVAR | NA | 0.448067311 | NA | FOXL2;FOXL2NB | 3 | 138946073 | G | A |
| rs797044528 | NA | 668 | FOXL2 | umls:C0220663 | CLINVAR | NA | 0.448067311 | NA | FOXL2;FOXL2NB;LINC01391 | 3 | 138945918 | - | G |
| rs797044529 | NA | 668 | FOXL2 | umls:C0220663 | CLINVAR | NA | 0.448067311 | NA | FOXL2;FOXL2NB;LINC01391 | 3 | 138945865 | - | GGCGGGGGTGCGGCCGG |
| rs797044530 | NA | 668 | FOXL2 | umls:C0220663 | CLINVAR | NA | 0.448067311 | NA | FOXL2;FOXL2NB;LINC01391 | 3 | 138945857 | - | GCGGCGGAGGCGGGGGTGCGGCC |
| rs797044531 | NA | 668 | FOXL2 | umls:C0220663 | CLINVAR | NA | 0.448067311 | NA | FOXL2;FOXL2NB;LINC01391 | 3 | 138945869 | G | - |
| rs797044532 | NA | 668 | FOXL2 | umls:C0220663 | CLINVAR | NA | 0.448067311 | NA | FOXL2;FOXL2NB;LINC01391 | 3 | 138945851 | - | GGGGGTGCGGCGGAGGC |
| rs797044533 | NA | 668 | FOXL2 | umls:C0220663 | CLINVAR | NA | 0.448067311 | NA | FOXL2;FOXL2NB;LINC01391 | 3 | 138945852 | GGGGGTGCGGCGGAGGC | - |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:9) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0000769 | Abnormality of the breast | MP:0004251 | failure of heart looping | failure of the primitive heart tube to loop asymmetrically during early development |
| HP:0000431 | Wide nasal bridge | MP:0006292 | abnormal nasal placode morphology | any structural anomaly in the paired ectodermal placodes that come to lie in the bottom of the olfactory pits as the pits are deepened by the growth of the surrounding medial and lateral nasal processes; the nasal placode gives rise to the olfactory epith |
| HP:0000837 | Increased circulating gonadotropin level | MP:0011533 | increased urine major urinary protein level | increased amount in the urine of a family of alpha2-microglobulin-related liver secretory proteins that comprise a major protein component of mouse urine |
| HP:0000378 | Cupped ear | MP:0006286 | inner ear hypoplasia | underdevelopment or reduced size of inner ear structures, usually due to decreased cell number |
| HP:0000218 | High palate | MP:0011615 | submucous cleft palate | a cleft of the palate with cardinal signs including a bifid uvula, a V-shaped notch at the back of the hard palate, and/or a translucent line in the midline of the soft palate and a short palate |
| HP:0008222 | Female infertility | MP:0001926 | female infertility | inability of female to produce live offspring |
| HP:0005280 | Depressed nasal bridge | MP:0013582 | abnormal lateral nasal gland morphology | any structural anomaly of the lateral nasal glands (the largest nasal secretory glands in rodents) which surround the maxillary sinus located in the lateral wall adjacent to each nasal passage and are characterized by cytologic features similar to those d |
| HP:0001595 | Abnormality of the hair | MP:0008261 | arrest of male meiosis | cessation of the progression of the process of nuclear division that results in sperm with one half the normal chromosome number of the original cell |
| HP:0008209 | Premature ovarian failure | MP:0011125 | decreased primary ovarian follicle number | fewer than normal numbers of the ovarian follicle prior to the appearance of an antrum, normally marked by developmental changes in the primary oocyte and follicular cells so that the latter form one or more layers of cuboidal or columnar cells; the folli |
Mapped by homologous gene(Total Items:19) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0000540 | Hypermetropia | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0000837 | Increased circulating gonadotropin level | MP:0014193 | decreased epididymal cell proliferation | decrease in the expansion rate of any epididymal cell population by cell division |
| HP:0000482 | Microcornea | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000568 | Microphthalmia | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000581 | Blepharophimosis | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001595 | Abnormality of the hair | MP:0014127 | increased thymoma incidence | greater than the expected number of a malignant neoplasm originating from the epithelial cells of the thymus, occurring in a specific population in a given time period; thymoma is an uncommon tumor linked with myasthenia gravis and other autoimmune diseas |
| HP:0000508 | Ptosis | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000769 | Abnormality of the breast | MP:0013395 | eyelid hypoplasia | underdevelopment or reduced size of the skin folds covering the front of the eyeball, usually due to a decreased cell number |
| HP:0008209 | Premature ovarian failure | MP:0013659 | abnormal erythroid lineage cell morphology | any structural anomaly of an immature or mature cell in the lineage leading to and including erythrocytes |
| HP:0000537 | Epicanthus inversus | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000486 | Strabismus | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0005280 | Depressed nasal bridge | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000431 | Wide nasal bridge | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000378 | Cupped ear | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0000141 | Amenorrhea | MP:0013395 | eyelid hypoplasia | underdevelopment or reduced size of the skin folds covering the front of the eyeball, usually due to a decreased cell number |
| HP:0000506 | Telecanthus | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0000639 | Nystagmus | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0008222 | Female infertility | MP:0013395 | eyelid hypoplasia | underdevelopment or reduced size of the skin folds covering the front of the eyeball, usually due to a decreased cell number |
| HP:0000218 | High palate | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| Disease ID | 806 |
|---|---|
| Disease | blepharophimosis, ptosis, and epicanthus inversus |
| Case | (Waiting for update.) |