beta-thalassemia |
Disease ID | 120 |
---|---|
Disease | beta-thalassemia |
Definition | A disorder characterized by reduced synthesis of the beta chains of hemoglobin. There is retardation of hemoglobin A synthesis in the heterozygous form (thalassemia minor), which is asymptomatic, while in the homozygous form (thalassemia major, Cooley's anemia, Mediterranean anemia, erythroblastic anemia), which can result in severe complications and even death, hemoglobin A synthesis is absent. |
Synonym | beta thalassaemia beta thalassaemia syndrome beta thalassemia beta thalassemia (disorder) beta thalassemia syndrome beta thalassemia, nos beta thalassemias beta type microcytemia beta type microcytemias beta type thalassemia beta type thalassemias beta-thalassaemia beta-thalassemia [disease/finding] microcytemia, beta type microcytemias, beta type thalassaemia beta thalassemia beta thalassemia, beta thalassemia, beta type thalassemias, beta thalassemias, beta type type microcytemia, beta type microcytemias, beta type thalassemia, beta type thalassemias, beta |
Orphanet | |
OMIM | |
DOID | |
ICD10 | |
UMLS | C0005283 |
MeSH | |
SNOMED-CT | |
Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:28) C0282193 | iron overload | 15 C0019158 | hepatitis | 4 C0019196 | hepatitis c | 3 C0020538 | hypertension | 3 C0002871 | anemia | 3 C0007570 | celiac disease | 2 C0006277 | bronchitis | 2 C0020542 | pulmonary hypertension | 2 C0019196 | hepatitis c infection | 2 C0162316 | iron deficiency anemia | 2 C0030486 | paraplegia | 1 C0547030 | visual disturbance | 1 C0948265 | metabolic syndrome | 1 C0398623 | hypercoagulability | 1 C0019114 | hemosiderosis | 1 C0020619 | hypogonadism | 1 C0039730 | thalassaemia | 1 C0014130 | endocrinopathy | 1 C0002312 | alpha thalassaemia | 1 C0155773 | portal vein thrombosis | 1 C0018801 | heart failure | 1 C0011570 | depression | 1 C1619734 | pulmonary arterial hypertension | 1 C0040053 | thrombosis | 1 C0392525 | nephrolithiasis | 1 C0020532 | hypersplenism | 1 C0085293 | hepatitis e | 1 C0003467 | anxiety | 1 |
Curated Gene | Entrez_id | Symbol | Resource(Total Genes:10) |
Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:22) 3043 | HBB | CIPHER;CTD_human 2147 | F2 | CIPHER 2153 | F5 | CIPHER 3039 | HBA1 | CIPHER 3047 | HBG1 | CIPHER 3048 | HBG2 | CIPHER 10767 | HBS1L | CIPHER 4524 | MTHFR | CIPHER 4842 | NOS1 | CIPHER 4843 | NOS2 | CIPHER 10544 | PROCR | CIPHER 7124 | TNF | CIPHER 7421 | VDR | CIPHER 790 | CAD | CTD_human 3040 | HBA2 | CTD_human 3934 | LCN2 | CTD_human 57817 | HAMP | CTD_human 1723 | DHODH | CTD_human 7036 | TFR2 | CTD_human 2056 | EPO | CTD_human 7037 | TFRC | CTD_human 7372 | UMPS | CTD_human |
Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:98) 84890 | ADO | 2.252 | DISEASES 204 | AK2 | 1.054 | DISEASES 212 | ALAS2 | 1.891 | DISEASES 310 | ANXA7 | 1.626 | DISEASES 10564 | ARFGEF2 | 1.478 | DISEASES 567 | B2M | 1.399 | DISEASES 53335 | BCL11A | 5.816 | DISEASES 617 | BCS1L | 4.346 | DISEASES 977 | CD151 | 1.196 | DISEASES 930 | CD19 | 1.153 | DISEASES 951 | CD37 | 3.161 | DISEASES 959 | CD40LG | 1.505 | DISEASES 921 | CD5 | 1.934 | DISEASES 966 | CD59 | 1.099 | DISEASES 923 | CD6 | 2.595 | DISEASES 146059 | CDAN1 | 1.801 | DISEASES 26097 | CHTOP | 2.148 | DISEASES 22796 | COG2 | 1.28 | DISEASES 1439 | CSF2RB | 2.054 | DISEASES 1460 | CSNK2B | 1.117 | DISEASES 51071 | DERA | 1.247 | DISEASES 1803 | DPP4 | 2.042 | DISEASES 9718 | ECE2 | 1.191 | DISEASES 284361 | EMC10 | 1.946 | DISEASES 953 | ENTPD1 | 4.404 | DISEASES 2035 | EPB41 | 2.762 | DISEASES 2159 | F10 | 1.147 | DISEASES 2152 | F3 | 1.32 | DISEASES 2204 | FCAR | 1.634 | DISEASES 2214 | FCGR3A | 1.812 | DISEASES 2316 | FLNA | 1.438 | DISEASES 2290 | FOXG1 | 1.051 | DISEASES 2309 | FOXO3 | 1.191 | DISEASES 2526 | FUT4 | 2.304 | DISEASES 2623 | GATA1 | 3.817 | DISEASES 57704 | GBA2 | 1.938 | DISEASES 2993 | GYPA | 2.797 | DISEASES 3039 | HBA1 | 4.379 | DISEASES 3043 | HBB | 8.314 | DISEASES 3045 | HBD | 6.571 | DISEASES 3047 | HBG1 | 6.478 | DISEASES 3048 | HBG2 | 5.369 | DISEASES 3042 | HBM | 1.7 | DISEASES 10767 | HBS1L | 5.275 | DISEASES 3077 | HFE | 3.996 | DISEASES 148738 | HFE2 | 2.711 | DISEASES 3105 | HLA-A | 1.282 | DISEASES 3115 | HLA-DPB1 | 1.324 | DISEASES 3117 | HLA-DQA1 | 1.313 | DISEASES 8091 | HMGA2 | 1.478 | DISEASES 4670 | HNRNPM | 1.296 | DISEASES 3240 | HP | 1.677 | DISEASES 80789 | INTS5 | 3.516 | DISEASES 27152 | INTU | 3.126 | DISEASES 3717 | JAK2 | 1.831 | DISEASES 25959 | KANK2 | 2.314 | DISEASES 3767 | KCNJ11 | 2.641 | DISEASES 284252 | KCTD1 | 1.928 | DISEASES 55132 | LARP1B | 2.885 | DISEASES 8825 | LIN7A | 1.09 | DISEASES 987 | LRBA | 1.685 | DISEASES 23499 | MACF1 | 1.191 | DISEASES 196410 | METTL7B | 1.094 | DISEASES 8972 | MGAM | 1.552 | DISEASES 10724 | MGEA5 | 1.258 | DISEASES 4285 | MIPEP | 3.482 | DISEASES 4602 | MYB | 1.173 | DISEASES 8131 | NPRL3 | 2.761 | DISEASES 7101 | NR2E1 | 1.342 | DISEASES 93034 | NT5C1B | 1.049 | DISEASES 5956 | OPN1LW | 2.225 | DISEASES 79345 | OR51B2 | 3.221 | DISEASES 390058 | OR51B6 | 3.221 | DISEASES 283111 | OR51V1 | 2.56 | DISEASES 23538 | OR52A1 | 2.856 | DISEASES 5094 | PCBP2 | 1.041 | DISEASES 5236 | PGM1 | 1.635 | DISEASES 55276 | PGM2 | 1.865 | DISEASES 56342 | PPAN | 1.66 | DISEASES 56980 | PRDM10 | 1.853 | DISEASES 5592 | PRKG1 | 1.621 | DISEASES 84991 | RBM17 | 1.887 | DISEASES 6007 | RHD | 1.427 | DISEASES 462 | SERPINC1 | 2.42 | DISEASES 4891 | SLC11A2 | 1.091 | DISEASES 83650 | SLC35G5 | 3.324 | DISEASES 6533 | SLC6A6 | 1.631 | DISEASES 55553 | SOX6 | 2.581 | DISEASES 6693 | SPN | 2.827 | DISEASES 23626 | SPO11 | 1.518 | DISEASES 6430 | SRSF5 | 1.132 | DISEASES 7018 | TF | 4.38 | DISEASES 7037 | TFRC | 4.501 | DISEASES 84000 | TMPRSS13 | 1.084 | DISEASES 164656 | TMPRSS6 | 3.668 | DISEASES 7318 | UBA7 | 1.085 | DISEASES 55906 | ZC4H2 | 1.722 | DISEASES 161882 | ZFPM1 | 2.012 | DISEASES |
Locus | (Waiting for update.) |
Disease ID | 120 |
---|---|
Disease | beta-thalassemia |
Manually Symptom | UMLS | Name(Total Manually Symptoms:103) C2712335 | dehydration C2707258 | infections C2700513 | aplastic anemia C2700476 | gilbert syndrome C2700440 | bipolar affective disorder C2678504 | osteoporosis C2613439 | extramedullary hemopoiesis C2613439 | extramedullary hematopoiesis C2613439 | extramedullary haematopoiesis C2364133 | infection C2073625 | pleural effusion C1963220 | pulmonary hypertension C1963211 | pericarditis C1963158 | left ventricular diastolic dysfunction C1963148 | iron overload C1962971 | myocarditis C1421374 | porphyria cutanea tarda C1414542 | marfan syndrome C1393529 | vascular complications C1384672 | hypoparathyroidism C1335641 | diamond-blackfan anemia C1264047 | abdominal lymphadenopathy C1263988 | hemolytic disorder C1253937 | pericardial effusion C1000483 | anemia C0948120 | hepatic siderosis C0850672 | hereditary anemia C0850497 | immune deficiency C0795687 | cerebral thrombosis C0702176 | neck abscess C0700208 | scoliosis C0679466 | cognitive deficits C0587044 | left ventricular thrombus C0587044 | left ventricular thrombosis C0581384 | chronic anemia C0524702 | pulmonary thromboembolism C0398623 | hypercoagulability C0376544 | hematopoietic tumor C0340968 | pyruvate kinase deficiency C0282074 | biliary sludge C0271650 | impaired glucose tolerance C0271001 | siderosis C0268064 | transfusion hemosiderosis C0267830 | pyogenic liver abscess C0266798 | cord compression C0263661 | osteoarthropathy C0263560 | chronic leg ulcer C0241885 | exercise intolerance C0239946 | liver fibrosis C0235527 | right heart failure C0235401 | abnormal glucose tolerance C0156221 | acute glomerulonephritis C0155550 | neural hearing loss C0151747 | renal tubular dysfunction C0151723 | hypomagnesemia C0042875 | vitamin e deficiency C0042769 | virus infection C0042769 | viral infections C0040961 | tricuspid regurgitation C0040053 | thrombosis C0040038 | thromboembolism C0038454 | strokes C0038454 | cerebrovascular accident C0037926 | spinal cord compression C0037274 | skin diseases C0037140 | b virus infection C0034012 | delayed puberty C0027051 | myocardial infarction C0024291 | hemophagocytic syndrome C0024141 | systemic lupus erythematosus C0023895 | hepatic pathology C0023890 | liver cirrhosis C0023885 | liver abscess C0023223 | leg ulcer C0022408 | arthropathy C0021359 | infertility C0021053 | immune dysfunction C0020676 | hypothyroidism C0020635 | pituitary insufficiency C0020473 | hyperlipidemia C0019829 | hodgkin disease C0019114 | hemosiderosis C0019080 | hemorrhage C0019045 | hemoglobin disorders C0019025 | hereditary persistence of fetal hemoglobin C0018939 | hematologic disorders C0018801 | heart failure C0018801 | cardiac failure C0018799 | cardiac disease C0018784 | sensorineural hearing loss C0017658 | glomerulonephritis C0014544 | epilepsy C0014356 | enterocolitis C0011849 | diabetes mellitus C0007570 | celiac disease C0005940 | bone disease C0005424 | biliary tract disease C0003864 | arthritis C0002982 | angioid streaks C0002888 | megaloblastic anemia C0002878 | hemolytic anemia C0002871 | anaemia C0002312 | alpha-thalassemia |
Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:4) C0002871 | anemia | 3 C0282193 | iron overload | 3 C0018952 | extramedullary hematopoiesis | 3 C0018801 | heart failure | 1 |
Manually Genotype(Total Text Mining Genotypes:0) |
---|
(Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
---|---|
(Waiting for update.) |
All Snps(Total Genotypes:45) | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
rs104894809 | 11809723 | 2623 | GATA1 | umls:C0005283 | BeFree | Missense mutations in the N-terminal zinc finger (Nf) of GATA1 result in abnormal hematopoiesis, as documented in four families: the mutation V205M leads to both severe macrothrombocytopenia and dyserythropoietic anemia, D218G to macrothrombocytopenia and mild dyserythropoiesis without anemia, G208S to macrothrombocytopenia and R216Q to macrothrombocytopenia with beta-thalassemia. | 0.000542884 | 2002 | GATA1 | X | 48792371 | G | A |
rs104894815 | 11809723 | 2623 | GATA1 | umls:C0005283 | BeFree | Missense mutations in the N-terminal zinc finger (Nf) of GATA1 result in abnormal hematopoiesis, as documented in four families: the mutation V205M leads to both severe macrothrombocytopenia and dyserythropoietic anemia, D218G to macrothrombocytopenia and mild dyserythropoiesis without anemia, G208S to macrothrombocytopenia and R216Q to macrothrombocytopenia with beta-thalassemia. | 0.000542884 | 2002 | GATA1 | X | 48792337 | G | A |
rs104894816 | 11809723 | 2623 | GATA1 | umls:C0005283 | BeFree | Missense mutations in the N-terminal zinc finger (Nf) of GATA1 result in abnormal hematopoiesis, as documented in four families: the mutation V205M leads to both severe macrothrombocytopenia and dyserythropoietic anemia, D218G to macrothrombocytopenia and mild dyserythropoiesis without anemia, G208S to macrothrombocytopenia and R216Q to macrothrombocytopenia with beta-thalassemia. | 0.000542884 | 2002 | GATA1 | X | 48792377 | A | G |
rs11549407 | 15630628 | 3043 | HBB | umls:C0005283 | BeFree | This was documented in FH patients identified on the island of Sardinia, in Italy, where 12% of the inhabitants are carriers of beta-thalassemia due to a single mutation (Q39X) of the beta-globin gene that abolishes the synthesis of beta-globin chain of hemoglobin (beta(o)-thalassemia). | 0.672264398 | 2004 | HBB | 11 | 5226774 | G | T,C,A |
rs11549407 | 10634824 | 3043 | HBB | umls:C0005283 | BeFree | In this population, a single mutation of beta-globin gene (Q39X, beta(0) 39) accounts for >95% of beta-thalassemia cases. | 0.672264398 | 2000 | HBB | 11 | 5226774 | G | T,C,A |
rs137852312 | 11809723 | 2623 | GATA1 | umls:C0005283 | BeFree | Missense mutations in the N-terminal zinc finger (Nf) of GATA1 result in abnormal hematopoiesis, as documented in four families: the mutation V205M leads to both severe macrothrombocytopenia and dyserythropoietic anemia, D218G to macrothrombocytopenia and mild dyserythropoiesis without anemia, G208S to macrothrombocytopenia and R216Q to macrothrombocytopenia with beta-thalassemia. | 0.000542884 | 2002 | NA | NA | NA | NA | NA |
rs1799945 | 11869934 | 3077 | HFE | umls:C0005283 | BeFree | H63D mutation in the HFE gene increases iron overload in beta-thalassemia carriers. | 0.023560699 | 2002 | HFE | 6 | 26090951 | C | G |
rs1799945 | 15182337 | 3077 | HFE | umls:C0005283 | BeFree | Co-inheritance of HFE mutations has a substantial role in iron overload in beta-thalassaemia carriers in north European populations where two HFE mutations, C282Y and H63D, are prevalent. | 0.023560699 | 2004 | HFE | 6 | 26090951 | C | G |
rs1800562 | 15182337 | 3077 | HFE | umls:C0005283 | BeFree | Co-inheritance of HFE mutations has a substantial role in iron overload in beta-thalassaemia carriers in north European populations where two HFE mutations, C282Y and H63D, are prevalent. | 0.023560699 | 2004 | HFE | 6 | 26092913 | G | A |
rs193922552 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | NA | NA | NA | NA | NA |
rs193922555 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226641 | C | - |
rs193922563 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226797 | AGCCTAAGGGTGGGAAAATAGACCA | - |
rs267607298 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226775 | GG | - |
rs281864901 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226662 | G | - |
rs33915217 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226925 | C | T,G,A |
rs33931746 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5227099 | T | G,C |
rs33935445 | 25268796 | 3043 | HBB | umls:C0005283 | BeFree | A new β(0) frameshift mutation, HBB: c.44delT (p.Leu14ArgfsX5), identified in an Argentinean family associated with secondary genetic modifiers of β-thalassemia. | 0.672264398 | 2015 | HBB | 11 | 5226978 | A | G,C |
rs33941849 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5227020 | A | T,G,C |
rs33945777 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226576 | C | T,G,A |
rs33946267 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5225678 | C | T,G,A |
rs33951465 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226947 | A | T,C |
rs33956879 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226928 | A | T,G,C |
rs33960103 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226930 | C | T,G |
rs33969677 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5225714 | C | T,G,A |
rs33971440 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226929 | C | T,A |
rs33974936 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226778 | C | T,A |
rs33980857 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5227101 | A | T,G,C |
rs33994806 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5227157 | G | T,C,A |
rs34305195 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5227071 | T | G |
rs34527846 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226802 | A | T,G,C |
rs34608326 | 6469695 | 3039 | HBA1 | umls:C0005283 | BeFree | HbA2 Victoria delta 24 (B6) Gly----Asp. A new delta chain variant occurring with beta-thalassemia. | 0.049541836 | 1984 | HBA1 | 16 | 176784 | G | A |
rs34690599 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5225832 | G | C |
rs34937014 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226604 | - | T |
rs34999973 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5227161 | G | A |
rs35424040 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226940 | C | T,G,A |
rs35497102 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226996 | TT | - |
rs35532010 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226937 | - | G |
rs35662066 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226971 | G | - |
rs35699606 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226994 | - | C |
rs35703285 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5225740 | A | C |
rs35894115 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226748 | - | T |
rs63751208 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5227172 | G | A |
rs769217 | 22286031 | 847 | CAT | umls:C0005283 | BeFree | A simple method for examination of polymorphisms of catalase exon 9: rs769217 in Hungarian microcytic anemia and beta-thalassemia patients. | 0.001085767 | 2012 | CAT | 11 | 34461361 | C | T |
rs80356820 | NA | 3043 | HBB | umls:C0005283 | CLINVAR | NA | 0.672264398 | NA | HBB | 11 | 5226757 | G | - |
rs80356820 | 23425035 | 3043 | HBB | umls:C0005283 | BeFree | Prevalence and molecular characterization of β-thalassemia in the state of Bahia, Brazil: first identification of mutation HBB: c.135delC in Brazil. | 0.672264398 | 2013 | HBB | 11 | 5226757 | G | - |
GWASdb Annotation(Total Genotypes:0) | |
---|---|
(Waiting for update.) |
GWASdb Snp Trait(Total Genotypes:3) | |||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CHR | POS | SNPID | REF | ALT | ORI_SNPID | PMID | P_VALUE | P_VALUE_TEXT | OR/BETA | CI95_TEXT | GWAS_INITIAL_SAMPLE_SIZE | SUB_POPULATION | SUPER_POPULATION | GWAS_TRAIT | HPO_ID | HPO_TERM | DO_ID | DO_TERM | MESH_ID | MESH_TERM | EFO_ID | EFO_TERM | DOLITE_TERM | RISK_ALLELE | PUBLICATION_TYPE | AA | GENE_SYMBOL | TYPE | REFGENE |
2 | 60719970 | rs766432 | C | A | rs766432 | 20183929 | 1.00E-10 | NA | 2.8 | [2.04-3.84] | 235 mild Thai Chinese cases; 383 severe Thai Chinese cases | Thai Chinese(618) | ALL(618) | ASN(618) | ALL(618) | Beta thalassemia/Hemoglobin E disease | HPOID:0011902 | Abnormal hemoglobin | DOID:12241 | beta thalassemia | D017086 | beta-Thalassemia | hemoglobin e disease | Thalassemia | NA | Research Support, Non-U.S. Gov't | A | BCL11A | intron |
6 | 135427144 | rs9376092 | C | A | rs9376092 | 20183929 | 2.00E-11 | NA | 2.91 | [2.12-3.99] | 235 mild Thai Chinese cases; 383 severe Thai Chinese cases | Thai Chinese(618) | ALL(618) | ASN(618) | ALL(618) | Beta thalassemia/Hemoglobin E disease | HPOID:0011902 | Abnormal hemoglobin | DOID:12241 | beta thalassemia | D017086 | beta-Thalassemia | hemoglobin e disease | Thalassemia | NA | Research Support, Non-U.S. Gov't | C | NA | NA |
11 | 5264146 | rs2071348 | T | G | rs2071348 | 20183929 | 3.00E-15 | NA | 4.05 | [2.64-6.21] | 235 mild Thai Chinese cases; 383 severe Thai Chinese cases | Thai Chinese(618) | ALL(618) | ASN(618) | ALL(618) | Beta thalassemia/Hemoglobin E disease | HPOID:0011902 | Abnormal hemoglobin | DOID:12241 | beta thalassemia | D017086 | beta-Thalassemia | hemoglobin e disease | Thalassemia | NA | Research Support, Non-U.S. Gov't | A | HBBP1 | intron |
Mapped by lexical matching(Total Items:8) | ||||
---|---|---|---|---|
HP ID | HP Name | MP ID | MP Name | Annotation |
HP:0011031 | Abnormality of iron homeostasis | MP:0013302 | increased pancreas iron level | increase in the amount of iron present in the pancreas tissue |
HP:0004370 | Abnormality of temperature regulation | MP:0013621 | decreased internal diameter of femur | reduced cross-sectional distance that extends from one lateral edge of the femur long bone marrow cavity, through its center and to the opposite lateral edge of the bone marrow cavity through the mid point of the femur |
HP:0001639 | Hypertrophic cardiomyopathy | MP:0005330 | cardiomyopathy | diseases of the heart (myocardium); may result from many causes |
HP:0004349 | Reduced bone mineral density | MP:0013630 | increased bone trabecular spacing | increase in the amount of space between trabeculae in cancellous bone |
HP:0001324 | Muscle weakness | MP:0000746 | weakness | state of being infirm or less strong than normal |
HP:0001935 | Microcytic anemia | MP:0001577 | anemia | less than normal levels of red blood cells and/or hemoglobin within red blood cells, or volume of packed red blood cells in the bloodstream, resulting in insufficient oxygenation of tissues and organs |
HP:0000924 | Abnormality of the skeletal system | MP:0013283 | failure of ventral body wall closure | failure of the lateral body wall folds (a combination of mesoderm and ectoderm arising on each side of the embryo) to progress ventrally and meet in the midline and/or fuse to close the ventral body wall; normally, this closure is aided by growth of the h |
HP:0011902 | Abnormal hemoglobin | MP:0001589 | abnormal mean corpuscular hemoglobin | anomalies in the average levels of hemoglobin contained in an erythrocyte |
Mapped by homologous gene(Total Items:21) | ||||
---|---|---|---|---|
HP ID | HP Name | MP ID | MP Name | Annotation |
HP:0002093 | Respiratory insufficiency | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
HP:0004370 | Abnormality of temperature regulation | MP:0020154 | impaired humoral immune response | impaired response of the immune system that mediates secreted antibodies produced in B cells |
HP:0004936 | Venous thrombosis | MP:0014166 | ectopic cranial bone | the appearance of an extra bone structure at an atypical location in or near the cranium |
HP:0000737 | Irritability | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
HP:0011902 | Abnormal hemoglobin | MP:0011101 | prenatal lethality, incomplete penetrance | the appearance of lower than Mendelian ratios of organisms of a given genotype due to death of some, but not all of the organisms between fertilization and birth (Mus: approximately E18.5) |
HP:0001935 | Microcytic anemia | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
HP:0001903 | Anemia | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
HP:0000044 | Hypogonadotrophic hypogonadism | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
HP:0000929 | Abnormality of the skull | MP:0014179 | abnormal blood-retinal barrier function | anomaly in the function of the part of the blood-ocular barrier that consists of cells that are joined tightly together to prevent certain substances from entering the tissue of the retina; the BRB consists of non-fenestrated capillaries of the retinal ci |
HP:0004349 | Reduced bone mineral density | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
HP:0002240 | Hepatomegaly | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
HP:0200042 | Skin ulcer | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
HP:0000924 | Abnormality of the skeletal system | MP:0014071 | increased cardiac muscle glycogen level | greater than the normal concentration of a readily converted carbohydrate reserve in heart muscle |
HP:0011031 | Abnormality of iron homeostasis | MP:0013405 | increased circulating lactate level | greater amount of lactate in the blood which is produced from pyruvate by lactate dehydrogenase |
HP:0001873 | Thrombocytopenia | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
HP:0001081 | Cholelithiasis | MP:0020220 | decreased tear production | decreased production of the amount of fluid produced in the eye |
HP:0012115 | Hepatitis | MP:0013716 | hypolactation | partial failure, or reduced ability to produce or secrete milk from the mammary gland |
HP:0001639 | Hypertrophic cardiomyopathy | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
HP:0001324 | Muscle weakness | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
HP:0001744 | Splenomegaly | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
HP:0000980 | Pallor | MP:0020186 | altered susceptibility to bacterial infection | a change in the likelihood that an organism will develop ill effects from a bacterial infection or from components of or toxins produced by bacteria |
Disease ID | 120 |
---|---|
Disease | beta-thalassemia |
Case | (Waiting for update.) |