eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| bardet-biedl syndrome | ||||
| Disease ID | 24 |
|---|---|
| Disease | bardet-biedl syndrome |
| Definition | An autosomal recessive disorder characterized by RETINITIS PIGMENTOSA; POLYDACTYLY; OBESITY; MENTAL RETARDATION; hypogenitalism; renal dysplasia; and short stature. This syndrome has been distinguished as a separate entity from LAURENCE-MOON SYNDROME. (From J Med Genet 1997 Feb;34(2):92-8) |
| Synonym | bardet biedl syndrome bardet-biedl syndrome (disorder) bardet-biedl syndrome [disease/finding] biedl-bardet syndrome laurence moon bardet biedl syndrome laurence-moon-bardet-biedl syndrome lmbb - laurence-moon-bardet-biedl syndrome syndrome, bardet-biedl syndrome, laurence-moon-bardet-biedl |
| Orphanet | |
| DOID | |
| UMLS | C0752166 |
| MeSH | |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:17) C0028754 | obesity | 6 C0022658 | kidney disease | 2 C0035304 | retinal degeneration | 2 C0022658 | renal disease | 2 C0022661 | chronic kidney disease | 1 C0035334 | retinitis pigmentosa | 1 C0011847 | diabetes | 1 C0035333 | retinitis | 1 C0022661 | end-stage kidney disease | 1 C0028756 | severe obesity | 1 C0456909 | blindness | 1 C0035078 | renal failure | 1 C0151740 | intracranial hypertension | 1 C0020538 | hypertension | 1 C0085655 | polymyositis | 1 C0022661 | chronic renal failure | 1 C0022661 | end stage renal disease | 1 |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:27) 26160 | IFT172 | ORPHANET 585 | BBS4 | CLINVAR;GHR;ORPHANET;UniProtKB-KW;UNIPROT;CTD_human 79738 | BBS10 | CLINVAR;GHR;ORPHANET;UniProtKB-KW;UNIPROT;CTD_human 27241 | BBS9 | CLINVAR;GHR;ORPHANET;UniProtKB-KW;UNIPROT;CTD_human 582 | BBS1 | CLINVAR;GHR;ORPHANET;UniProtKB-KW;UNIPROT;CTD_human 583 | BBS2 | CLINVAR;GHR;ORPHANET;UniProtKB-KW;UNIPROT;CTD_human 129880 | BBS5 | CLINVAR;GHR;ORPHANET;UniProtKB-KW;UNIPROT;CTD_human 55212 | BBS7 | CLINVAR;GHR;ORPHANET;UniProtKB-KW;UNIPROT;CTD_human 11020 | IFT27 | ORPHANET;UniProtKB-KW 92482 | BBIP1 | CLINVAR;ORPHANET;UniProtKB-KW 54903 | MKS1 | CTD_human;GHR;ORPHANET;UNIPROT;UniProtKB-KW 80184 | CEP290 | CLINVAR;GHR;ORPHANET;UniProtKB-KW;UNIPROT;CTD_human 79140 | CCDC28B | UniProtKB-KW 91147 | TMEM67 | CTD_human;UniProtKB-KW;UNIPROT 10806 | SDCCAG8 | ORPHANET;UniProtKB-KW 4867 | NPHP1 | ORPHANET 51057 | WDPCP | CTD_human;ORPHANET;UNIPROT;UniProtKB-KW 8195 | MKKS | CLINVAR;GHR;ORPHANET;UniProtKB-KW;UNIPROT;CTD_human 22954 | TRIM32 | CTD_human;GHR;ORPHANET;UNIPROT;UniProtKB-KW 84100 | ARL6 | CLINVAR;GHR;ORPHANET;UniProtKB-KW;UNIPROT;CTD_human 80173 | IFT74 | UniProtKB-KW 374654 | KIF7 | UniProtKB-KW 79809 | TTC21B | UniProtKB-KW 157657 | C8orf37 | UniProtKB-KW 123016 | TTC8 | CTD_human;GHR;ORPHANET;UNIPROT;UniProtKB-KW 166379 | BBS12 | CLINVAR;GHR;ORPHANET;UniProtKB-KW;UNIPROT;CTD_human 54585 | LZTFL1 | CLINVAR;ORPHANET;UniProtKB-KW |
| Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:18) 55212 | BBS7 | CIPHER;CTD_human 79140 | CCDC28B | CIPHER 115861 | NXNL1 | CIPHER 123016 | TTC8 | CIPHER;CTD_human 27241 | BBS9 | CTD_human 582 | BBS1 | CTD_human 583 | BBS2 | CTD_human 585 | BBS4 | CTD_human 129880 | BBS5 | CTD_human 51057 | WDPCP | CTD_human 91147 | TMEM67 | CTD_human 54903 | MKS1 | CTD_human 22954 | TRIM32 | CTD_human 166379 | BBS12 | CTD_human 79738 | BBS10 | CTD_human 80184 | CEP290 | CTD_human 8195 | MKKS | CTD_human 84100 | ARL6 | CTD_human |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:88) 24 | ABCA4 | 1.419 | DISEASES 22852 | ANKRD26 | 1.767 | DISEASES 84100 | ARL6 | 4.203 | DISEASES 23245 | ASTN2 | 2.262 | DISEASES 10159 | ATP6AP2 | 1.057 | DISEASES 92482 | BBIP1 | 4.44 | DISEASES 79738 | BBS10 | 6.488 | DISEASES 138162 | C9orf116 | 3.564 | DISEASES 57545 | CC2D2A | 2.143 | DISEASES 79140 | CCDC28B | 5.362 | DISEASES 10575 | CCT4 | 2.171 | DISEASES 64072 | CDH23 | 1.252 | DISEASES 80184 | CEP290 | 4.378 | DISEASES 2055 | CLN8 | 1.376 | DISEASES 1259 | CNGA1 | 2.402 | DISEASES 54875 | CNTLN | 2.875 | DISEASES 9696 | CROCC | 3.005 | DISEASES 1639 | DCTN1 | 1.467 | DISEASES 27185 | DISC1 | 1.093 | DISEASES 84062 | DTNBP1 | 1.952 | DISEASES 1907 | EDN2 | 1.05 | DISEASES 10938 | EHD1 | 1.078 | DISEASES 132884 | EVC2 | 1.298 | DISEASES 10640 | EXOC5 | 2.683 | DISEASES 23265 | EXOC7 | 3.253 | DISEASES 149371 | EXOC8 | 2.727 | DISEASES 28982 | FLVCR1 | 2.259 | DISEASES 9573 | GDF3 | 1.756 | DISEASES 10020 | GNE | 1.055 | DISEASES 9001 | HAP1 | 1.903 | DISEASES 3109 | HLA-DMB | 1.189 | DISEASES 9742 | IFT140 | 3.162 | DISEASES 90410 | IFT20 | 4.157 | DISEASES 11020 | IFT27 | 4.982 | DISEASES 80173 | IFT74 | 2.981 | DISEASES 8100 | IFT88 | 1.72 | DISEASES 56623 | INPP5E | 2.336 | DISEASES 11127 | KIF3A | 2.648 | DISEASES 9371 | KIF3B | 2.479 | DISEASES 3801 | KIFC3 | 2.695 | DISEASES 3953 | LEPR | 1.886 | DISEASES 85444 | LRRCC1 | 4.459 | DISEASES 54551 | MAGEL2 | 1.77 | DISEASES 54903 | MKS1 | 4.598 | DISEASES 5891 | MOK | 2.154 | DISEASES 4647 | MYO7A | 1.953 | DISEASES 4649 | MYO9A | 2.658 | DISEASES 4692 | NDN | 1.207 | DISEASES 4828 | NMB | 2.577 | DISEASES 29922 | NME7 | 2.658 | DISEASES 27031 | NPHP3 | 2.797 | DISEASES 261734 | NPHP4 | 3.077 | DISEASES 594857 | NPS | 1.419 | DISEASES 4952 | OCRL | 1.059 | DISEASES 8481 | OFD1 | 3.912 | DISEASES 5048 | PAFAH1B1 | 1.029 | DISEASES 65217 | PCDH15 | 1.355 | DISEASES 5108 | PCM1 | 2.264 | DISEASES 5148 | PDE6G | 2.448 | DISEASES 5828 | PEX2 | 1.966 | DISEASES 5314 | PKHD1 | 1.76 | DISEASES 768206 | PRCD | 1.761 | DISEASES 5587 | PRKD1 | 1.402 | DISEASES 374308 | PTCHD3 | 1.296 | DISEASES 5923 | RASGRF1 | 1.732 | DISEASES 6103 | RPGR | 2.352 | DISEASES 57096 | RPGRIP1 | 1.397 | DISEASES 23322 | RPGRIP1L | 2.972 | DISEASES 388015 | RTL1 | 2.017 | DISEASES 6295 | SAG | 1.385 | DISEASES 10806 | SDCCAG8 | 4.436 | DISEASES 7536 | SF1 | 2.277 | DISEASES 55812 | SPATA7 | 2.509 | DISEASES 6753 | SSTR3 | 2.35 | DISEASES 6809 | STX3 | 2.229 | DISEASES 6812 | STXBP1 | 1.278 | DISEASES 51259 | TMEM216 | 3.409 | DISEASES 91147 | TMEM67 | 3.668 | DISEASES 27095 | TRAPPC3 | 2.352 | DISEASES 22954 | TRIM32 | 5.083 | DISEASES 7106 | TSPAN4 | 1.573 | DISEASES 79989 | TTC26 | 3.791 | DISEASES 123016 | TTC8 | 5.397 | DISEASES 79770 | TXNDC15 | 4.441 | DISEASES 57216 | VANGL2 | 2.447 | DISEASES 157680 | VPS13B | 3.043 | DISEASES 7481 | WNT11 | 1.525 | DISEASES 7694 | ZNF135 | 1.635 | DISEASES |
| Locus | Symbol | Locus(Total Locus:21) |
| Disease ID | 24 |
|---|---|
| Disease | bardet-biedl syndrome |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:25) HP:0000639 | Nystagmus HP:0000028 | Cryptorchidism HP:0000470 | Short neck HP:0004322 | Short stature HP:0001395 | Hepatic fibrosis HP:0000365 | Hearing impairment HP:0000512 | Abnormal electroretinogram HP:0000135 | Hypogonadism HP:0008736 | Hypoplasia of penis HP:0006101 | Finger syndactyly HP:0002167 | Neurological speech impairment HP:0000580 | Pigmentary retinopathy HP:0000822 | Hypertension HP:0001162 | Postaxial hand polydactyly HP:0000494 | Downslanted palpebral fissures HP:0000003 | Multicystic kidney dysplasia HP:0010747 | Medial flaring of the eyebrow HP:0002230 | Generalized hirsutism HP:0001249 | Intellectual disability HP:0008724 | Hypoplasia of the ovary HP:0000426 | Prominent nasal bridge HP:0001513 | Obesity HP:0000100 | Nephrotic syndrome HP:0000368 | Low-set, posteriorly rotated ears HP:0003202 | Skeletal muscle atrophy |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:15) HP:0001513 | Obesity | 6 HP:0000546 | Retinal degeneration | 2 HP:0003774 | End-stage renal failure | 2 HP:0000510 | Retinitis pigmentosa | 1 HP:0000618 | Blindness | 1 HP:0000822 | Hypertension | 1 HP:0002516 | Intracranial pressure elevation | 1 HP:0001250 | Seizures | 1 HP:0002664 | Neoplasia | 1 HP:0012622 | Chronic kidney disease | 1 HP:0002591 | Voracious appetite | 1 HP:0000110 | Renal dysplasia | 1 HP:0100754 | Mania | 1 HP:0000083 | Renal insufficiency | 1 HP:0010442 | Polydactyly | 1 |
| Disease ID | 24 |
|---|---|
| Disease | bardet-biedl syndrome |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:11) |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:4) C0035304 | retinal degeneration | 2 C0022658 | kidney disease | 2 C0035078 | renal failure | 1 C0085655 | polymyositis | 1 |
Manually Genotype(Total Manually Genotypes:1) | |||
|---|---|---|---|
| Gene | Mutation | DOI | Article Title |
| BBS2 | NM_031885.3:c.805_1910del: p.(Val269Glufs*12) | doi:10.1038/gim.2016.155 | Increasing the sensitivity of clinical exome sequencing through improved filtration strategy |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:33) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs113624356 | 25402481 | 379 | ARL4D | umls:C0752166 | BeFree | Furthermore, we show that BBS1 with the M390R mutation, responsible for 30% of all reported BBS disease cases, fails to interact with ARL6-GTP, thus providing a molecular rationale for patient pathologies. | 0.001628651 | 2014 | BBS1;ZDHHC24 | 11 | 66526181 | T | G |
| rs113624356 | 25402481 | 84100 | ARL6 | umls:C0752166 | BeFree | Furthermore, we show that BBS1 with the M390R mutation, responsible for 30% of all reported BBS disease cases, fails to interact with ARL6-GTP, thus providing a molecular rationale for patient pathologies. | 0.365438769 | 2014 | BBS1;ZDHHC24 | 11 | 66526181 | T | G |
| rs113624356 | 22940089 | 582 | BBS1 | umls:C0752166 | BeFree | Phenotypic expression of Bardet-Biedl syndrome in patients homozygous for the common M390R mutation in the BBS1 gene. | 0.369238955 | 2012 | BBS1;ZDHHC24 | 11 | 66526181 | T | G |
| rs113624356 | 23143442 | 583 | BBS2 | umls:C0752166 | BeFree | To investigate the involvement of the Bardet-Biedl syndrome (BBS) gene BBS1 p.M390R variant in nonsyndromic autosomal recessive retinitis pigmentosa (RP). | 0.377663585 | 2012 | BBS1;ZDHHC24 | 11 | 66526181 | T | G |
| rs113624356 | 25402481 | 582 | BBS1 | umls:C0752166 | BeFree | Furthermore, we show that BBS1 with the M390R mutation, responsible for 30% of all reported BBS disease cases, fails to interact with ARL6-GTP, thus providing a molecular rationale for patient pathologies. | 0.369238955 | 2014 | BBS1;ZDHHC24 | 11 | 66526181 | T | G |
| rs113994178 | NA | 582 | BBS1 | umls:C0752166 | CLINVAR | NA | 0.369238955 | NA | NA | 11 | 66510657 | AAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG | - |
| rs113994189 | NA | 585 | BBS4 | umls:C0752166 | CLINVAR | NA | 0.368977445 | NA | BBS4 | 15 | 72709480 | A | - |
| rs113994190 | NA | 585 | BBS4 | umls:C0752166 | CLINVAR | NA | 0.368977445 | NA | BBS4 | 15 | 72712308 | G | C |
| rs113994191 | NA | 585 | BBS4 | umls:C0752166 | CLINVAR | NA | 0.368977445 | NA | BBS4 | 15 | 72722792 | A | C |
| rs113994192 | NA | 585 | BBS4 | umls:C0752166 | CLINVAR | NA | 0.368977445 | NA | BBS4 | 15 | 72712242 | A | G |
| rs113994195 | NA | 8195 | MKKS | umls:C0752166 | CLINVAR | NA | 0.365710211 | NA | MKKS | 20 | 10413074 | AGTACTACTAA | - |
| rs113994196 | NA | 8195 | MKKS | umls:C0752166 | CLINVAR | NA | 0.365710211 | NA | MKKS | 20 | 10412638 | - | CAGG |
| rs119466002 | NA | 55212 | BBS7 | umls:C0752166 | CLINVAR | NA | 0.369172942 | NA | BBS7 | 4 | 121854790 | G | A |
| rs137852857 | 26085087 | 27241 | BBS9 | umls:C0752166 | BeFree | We show that the Bardet-Biedl syndrome-causing G141R mutation in BBS9 likely results in misfolding of the β-propeller. | 0.363810118 | 2015 | BBS9 | 7 | 33177570 | G | A |
| rs137854907 | NA | 84100 | ARL6 | umls:C0752166 | CLINVAR | NA | 0.365438769 | NA | ARL6 | 3 | 97784972 | T | C |
| rs141521925 | NA | 79738 | BBS10 | umls:C0752166 | CLINVAR | NA | 0.365167327 | NA | BBS10 | 12 | 76346249 | T | C |
| rs151344630 | NA | 166379 | BBS12 | umls:C0752166 | CLINVAR | NA | 0.361357209 | NA | BBS12 | 4 | 122742215 | C | G |
| rs179363897 | NA | 129880 | BBS5 | umls:C0752166 | CLINVAR | NA | 0.366534468 | NA | BBS5 | 2 | 169492900 | G | A |
| rs193922709 | NA | 582 | BBS1 | umls:C0752166 | CLINVAR | NA | 0.369238955 | NA | BBS1 | 11 | 66519695 | G | A |
| rs193922710 | NA | 583 | BBS2 | umls:C0752166 | CLINVAR | NA | 0.377663585 | NA | BBS2 | 16 | 56502382 | G | A |
| rs193922711 | NA | 583 | BBS2 | umls:C0752166 | CLINVAR | NA | 0.377663585 | NA | BBS2 | 16 | 56497770 | A | - |
| rs35520756 | NA | 582 | BBS1 | umls:C0752166 | CLINVAR | NA | 0.369238955 | NA | BBS1 | 11 | 66519725 | G | A |
| rs515726134 | NA | 92482 | BBIP1 | umls:C0752166 | CLINVAR | NA | 0.240271442 | NA | PDCD4;BBIP1 | 10 | 110900466 | A | C |
| rs515726135 | NA | 54585 | LZTFL1 | umls:C0752166 | CLINVAR | NA | 0.240542884 | NA | LZTFL1 | 3 | 45835653 | A | G |
| rs515726136 | NA | 54585 | LZTFL1 | umls:C0752166 | CLINVAR | NA | 0.240542884 | NA | LZTFL1 | 3 | 45827459 | C | A |
| rs549625604 | NA | 79738 | BBS10 | umls:C0752166 | CLINVAR | NA | 0.365167327 | NA | BBS10 | 12 | 76347713 | - | A |
| rs587777829 | NA | 582 | BBS1 | umls:C0752166 | CLINVAR | NA | 0.369238955 | NA | BBS1 | 11 | 66514679 | G | A |
| rs727503818 | NA | 79738 | BBS10 | umls:C0752166 | CLINVAR | NA | 0.365167327 | NA | BBS10 | 12 | 76346894 | T | - |
| rs727503819 | NA | 79738 | BBS10 | umls:C0752166 | CLINVAR | NA | 0.365167327 | NA | BBS10 | 12 | 76346895 | T | - |
| rs761101213 | NA | 79738 | BBS10 | umls:C0752166 | CLINVAR | NA | 0.365167327 | NA | BBS10 | 12 | 76347298 | A | - |
| rs762511626 | NA | 27241 | BBS9 | umls:C0752166 | CLINVAR | NA | 0.363810118 | NA | BBS9 | 7 | 33349108 | T | A |
| rs786204444 | NA | 582 | BBS1 | umls:C0752166 | CLINVAR | NA | 0.369238955 | NA | BBS1 | 11 | 66515543 | C | T |
| rs797044604 | NA | 80184 | CEP290 | umls:C0752166 | CLINVAR | NA | 0.364895885 | NA | CEP290 | 12 | 88086450 | C | A |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:10) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0010747 | Medial flaring of the eyebrow | MP:0009657 | failure of chorioallantoic fusion | failure to initiate and/or complete the formation of a highly vascularized extra-embryonic fetal membrane by fusion of the chorion and allantois |
| HP:0001162 | Postaxial hand polydactyly | MP:0009743 | preaxial polydactyly | duplication of all or part of the first ray on one or more of the autopods |
| HP:0008724 | Hypoplasia of the ovary | MP:0004485 | increased response of heart to induced stress | increase in severity of the physiological response of the heart to induced stress such as cardiac hypertrophy due to mechanical pressure overload from aortic banding |
| HP:0003202 | Skeletal muscle atrophy | MP:0014068 | abnormal muscle glycogen level | the normal concentration of a readily converted carbohydrate reserve in muscle tissue |
| HP:0000470 | Short neck | MP:0012720 | elongated neck | increased length of the neck |
| HP:0006101 | Finger syndactyly | MP:0000564 | syndactyly | any degree of webbing or fusion of the digits, may involve only soft tissues or also can include bone |
| HP:0000426 | Prominent nasal bridge | MP:0009903 | abnormal medial nasal prominence morphology | any structural anomaly of the central area of the two limbs of a horseshoe-shaped mesenchymal swelling that lie medial to the olfactory placode or pit in the future nasal region of the embryo; it joins with the ipsilateral maxillary prominence in the form |
| HP:0008736 | Hypoplasia of penis | MP:0013283 | failure of ventral body wall closure | failure of the lateral body wall folds (a combination of mesoderm and ectoderm arising on each side of the embryo) to progress ventrally and meet in the midline and/or fuse to close the ventral body wall; normally, this closure is aided by growth of the h |
| HP:0001395 | Hepatic fibrosis | MP:0003985 | renal fibrosis | formation of fibrous tissue in the kidney as a result of repair or a reactive process |
| HP:0000003 | Multicystic kidney dysplasia | MP:0011376 | abnormal kidney corticomedullary boundary morphology | any structural anomaly of the region demarcating the renal medulla from the surrounding cortex; end-stage renal failure may be associated with loss of the normal corticomedullary boundary |
Mapped by homologous gene(Total Items:25) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0008724 | Hypoplasia of the ovary | MP:0013504 | increased embryonic tissue cell apoptosis | increase in the timing or the number of cells in embryonic tissue undergoing programmed cell death |
| HP:0010747 | Medial flaring of the eyebrow | MP:0012676 | dilated brain ventricles | the luminal space of one or more of the four communicating cavities within the brain that are continuous with the central canal of the spinal cord is increased in volume or area, usually with an increase in contained fluid |
| HP:0003202 | Skeletal muscle atrophy | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001162 | Postaxial hand polydactyly | MP:0014117 | increased pancreatic beta cell apoptosis | increase in the number of pancreatic beta cells undergoing programmed cell death |
| HP:0004322 | Short stature | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000135 | Hypogonadism | MP:0014198 | absent pituitary infundibular stalk | absence of the apical portion of the tubular structure extending from the hypothalamus to the posterior lobe of the pituitary gland |
| HP:0000003 | Multicystic kidney dysplasia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001395 | Hepatic fibrosis | MP:0020134 | abnormal gallbladder size | an anomaly in the size of the gall bladder compared to average, the organ that serves as a storage reservoir for bile |
| HP:0000028 | Cryptorchidism | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000426 | Prominent nasal bridge | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0006101 | Finger syndactyly | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002230 | Generalized hirsutism | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001513 | Obesity | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000470 | Short neck | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000512 | Abnormal electroretinogram | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001249 | Intellectual disability | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0000365 | Hearing impairment | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000639 | Nystagmus | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000580 | Pigmentary retinopathy | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000494 | Downslanted palpebral fissures | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0002167 | Neurological speech impairment | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0000100 | Nephrotic syndrome | MP:0020216 | decreased circulating complement protein level | less than normal levels of the serum proteins that act sequentially to allow for the direct killing of microbes, the disposal of immune complexes, and the regulation of other immune processes |
| HP:0000368 | Low-set, posteriorly rotated ears | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0008736 | Hypoplasia of penis | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000822 | Hypertension | MP:0020216 | decreased circulating complement protein level | less than normal levels of the serum proteins that act sequentially to allow for the direct killing of microbes, the disposal of immune complexes, and the regulation of other immune processes |
| Disease ID | 24 |
|---|---|
| Disease | bardet-biedl syndrome |
| Case | (Waiting for update.) |