eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine

HOME
QUERY
- DISEASE
- GENOTYPE
NETWORK
- PHENOTYPE
- GENE
- COMMON
- DISEASE PAIR
DOWNLOAD
SUBMIT CASE
HELP&FAQ
- HELP&FAQ
- CONTACT US


	acute megakaryoblastic leukemia

Disease ID	1029
Disease	acute megakaryoblastic leukemia
Definition	An acute myeloid leukemia in which 20-30% of the bone marrow or peripheral blood cells are of megakaryocyte lineage. MYELOFIBROSIS or increased bone marrow RETICULIN is common.
Synonym	[m]acute megakaryoblastic leukaemia [m]acute megakaryoblastic leukemia [m]acute megakaryoblastic leukemia (morphologic abnormality) [m]megakaryocytic leukaemia [m]megakaryocytic leukaemia (disorder) [m]megakaryocytic leukemia [m]thrombocytic leukaemia [m]thrombocytic leukemia acute m7 myeloid leukemia acute megakaryoblastic leukaemia acute megakaryoblastic leukaemia, fab m7 acute megakaryoblastic leukaemia, morphology acute megakaryoblastic leukemia (disorder) acute megakaryoblastic leukemia (fab type m7) acute megakaryoblastic leukemia, fab m7 acute megakaryoblastic leukemia, fab m7 (disorder) acute megakaryoblastic leukemia, morphology acute megakaryoblastic leukemia, morphology (morphologic abnormality) acute megakaryoblastic leukemias acute megakaryocytic leukemia acute megakaryocytic leukemias disorder: acute megakaryoblastic leukemia, fab m7 (disorder) fab m7 leukemia myeloid acute m 07 leukemia, acute megakaryoblastic leukemia, acute megakaryocytic leukemia, megakaryoblastic, acute leukemia, megakaryoblastic, acute [disease/finding] leukemia, megakaryocytic leukemia, megakaryocytic, acute leukemia, megakaryocytic, malignant leukemia, myeloid, acute, m7 leukemias, acute megakaryoblastic leukemias, acute megakaryocytic leukemias, megakaryocytic m7 - acute megakaryoblastic leukaemia m7 - acute megakaryoblastic leukemia malignant megakaryocytosis megakaryoblastic leukaemia megakaryoblastic leukemia megakaryoblastic leukemia, acute megakaryoblastic leukemias, acute megakaryocytic leukaemia megakaryocytic leukemia megakaryocytic leukemia (disorder) megakaryocytic leukemia, acute megakaryocytic leukemias megakaryocytic leukemias, acute megakaryocytic myelosis myeloid leukemia acute m 07 myeloid leukemia, acute, m7 thrombocytic leukaemia thrombocytic leukemia
Orphanet	ORPHANET:518
DOID	DOID:8761
UMLS	C0023462
MeSH	D007947
SNOMED-CT	SNOMEDCT_US_2016_09_01:277602003;SNOMEDCT_US_2016_09_01:188754005
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:11) C0013080 \| trisomy 21 \| 5 C0027022 \| myeloproliferative disorder \| 3 C1831998 \| transient myeloproliferative disorder \| 2 C0079744 \| diffuse large b-cell lymphoma \| 1 C0042384 \| vasculitis \| 1 C0079731 \| b-cell lymphoma \| 1 C0039538 \| teratoma \| 1 C0836924 \| thrombocytosis \| 1 C0024299 \| lymphoma \| 1 C0004903 \| beckwith-wiedemann syndrome \| 1 C0027819 \| neuroblastoma \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:4) 5728 \| PTEN \| CLINVAR 2623 \| GATA1 \| CLINVAR 332 \| BIRC5 \| CTD_human 7157 \| TP53 \| CLINVAR
Inferring Gene	(Waiting for update.)
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:48) 9181 \| ARHGEF2 \| 2.512 \| DISEASES 875 \| CBS \| 2.416 \| DISEASES 930 \| CD19 \| 1.567 \| DISEASES 914 \| CD2 \| 1.666 \| DISEASES 978 \| CDA \| 2.282 \| DISEASES 1052 \| CEBPD \| 1.372 \| DISEASES 4850 \| CNOT4 \| 1.821 \| DISEASES 1438 \| CSF2RA \| 2.925 \| DISEASES 8788 \| DLK1 \| 1.327 \| DISEASES 1859 \| DYRK1A \| 1.181 \| DISEASES 2113 \| ETS1 \| 1.174 \| DISEASES 2114 \| ETS2 \| 1.404 \| DISEASES 2131 \| EXT1 \| 1.074 \| DISEASES 2157 \| F8 \| 1.2 \| DISEASES 2623 \| GATA1 \| 5.559 \| DISEASES 2811 \| GP1BA \| 3.176 \| DISEASES 2993 \| GYPA \| 2.208 \| DISEASES 10614 \| HEXIM1 \| 2.317 \| DISEASES 3205 \| HOXA9 \| 1.044 \| DISEASES 3716 \| JAK1 \| 1.533 \| DISEASES 3717 \| JAK2 \| 2.031 \| DISEASES 3718 \| JAK3 \| 2.384 \| DISEASES 27040 \| LAT \| 2.26 \| DISEASES 4067 \| LYN \| 1.782 \| DISEASES 57591 \| MKL1 \| 4.933 \| DISEASES 4311 \| MME \| 1.165 \| DISEASES 5891 \| MOK \| 2.664 \| DISEASES 4352 \| MPL \| 2.652 \| DISEASES 4600 \| MX2 \| 1.739 \| DISEASES 4800 \| NFYA \| 2.171 \| DISEASES 4976 \| OPA1 \| 1.62 \| DISEASES 5034 \| P4HB \| 1.066 \| DISEASES 5087 \| PBX1 \| 1.145 \| DISEASES 23532 \| PRAME \| 1.437 \| DISEASES 3276 \| PRMT1 \| 1.732 \| DISEASES 5906 \| RAP1A \| 1.664 \| DISEASES 64783 \| RBM15 \| 5.069 \| DISEASES 1827 \| RCAN1 \| 1.481 \| DISEASES 387 \| RHOA \| 1.661 \| DISEASES 1992 \| SERPINB1 \| 1.434 \| DISEASES 29072 \| SETD2 \| 1.189 \| DISEASES 23013 \| SPEN \| 1.428 \| DISEASES 54790 \| TET2 \| 1.564 \| DISEASES 203068 \| TUBB \| 1.913 \| DISEASES 11091 \| WDR5 \| 1.901 \| DISEASES 23038 \| WDTC1 \| 2.163 \| DISEASES 161882 \| ZFPM1 \| 2.168 \| DISEASES 7791 \| ZYX \| 2.022 \| DISEASES
Locus	(Waiting for update.)

Disease ID	1029
Disease	acute megakaryoblastic leukemia
Integrated Phenotype	(Waiting for update.)
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:8) HP:0005547 \| Myeloproliferative disorder \| 3 HP:0003006 \| Neuroblastoma \| 1 HP:0002665 \| Lymphoma \| 1 HP:0001894 \| Thrombocytosis \| 1 HP:0012191 \| B-cell lymphoma \| 1 HP:0012156 \| Hemophagocytosis \| 1 HP:0009792 \| Teratoma \| 1 HP:0002633 \| Vasculitis \| 1

Disease ID	1029
Disease	acute megakaryoblastic leukemia
Manually Symptom	UMLS \| Name(Total Manually Symptoms:5) C0948691 \| cerebral aspergillosis C0152025 \| polyneuropathy C0026987 \| myelofibrosis C0020437 \| hypercalcemia C0017567 \| gingival hypertrophy
Text Mined Symptom	(Waiting for update.)

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:10)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs121913504	16843266	51727	CMPK1	umls:C0023462	BeFree	This allowed the identification of an activating mutation (A572V) in the JAK3 pseudokinase domain in the acute megakaryoblastic leukemia (AMKL) cell line CMK.	0.001900093	2006	JAK3	19	17837200	G	A
rs121913504	16843266	4283	CXCL9	umls:C0023462	BeFree	This allowed the identification of an activating mutation (A572V) in the JAK3 pseudokinase domain in the acute megakaryoblastic leukemia (AMKL) cell line CMK.	0.001900093	2006	JAK3	19	17837200	G	A
rs373667881	22294728	10221	TRIB1	umls:C0023462	BeFree	Identification of TRIB1 R107L gain-of-function mutation in human acute megakaryocytic leukemia.	0.000271442	2012	TRIB1	8	125431222	G	T
rs386626619	16598306	3717	JAK2	umls:C0023462	BeFree	We hypothesized that the JAK2 V617F mutation might also be present in samples from patients with acute myeloid leukemia (AML), especially erythroleukemia (AML-M6) or megakaryoblastic leukemia (AML-M7), where it might mimic erythropoietin or thrombopoietin signaling.	0.001085767	2006	NA	NA	NA	NA	NA
rs386626619	16598306	2056	EPO	umls:C0023462	BeFree	We hypothesized that the JAK2 V617F mutation might also be present in samples from patients with acute myeloid leukemia (AML), especially erythroleukemia (AML-M6) or megakaryoblastic leukemia (AML-M7), where it might mimic erythropoietin or thrombopoietin signaling.	0.000814326	2006	NA	NA	NA	NA	NA
rs398124628	NA	2623	GATA1	umls:C0023462	CLINVAR	NA	0.154271197	NA	GATA1	X	48791282	-	ACAGCCACCGCTGCAGCTGC
rs77375493	16598306	2056	EPO	umls:C0023462	BeFree	We hypothesized that the JAK2 V617F mutation might also be present in samples from patients with acute myeloid leukemia (AML), especially erythroleukemia (AML-M6) or megakaryoblastic leukemia (AML-M7), where it might mimic erythropoietin or thrombopoietin signaling.	0.000814326	2006	JAK2;INSL6	9	5073770	G	A,T
rs77375493	16598306	3717	JAK2	umls:C0023462	BeFree	We hypothesized that the JAK2 V617F mutation might also be present in samples from patients with acute myeloid leukemia (AML), especially erythroleukemia (AML-M6) or megakaryoblastic leukemia (AML-M7), where it might mimic erythropoietin or thrombopoietin signaling.	0.001085767	2006	JAK2;INSL6	9	5073770	G	A,T
rs786201044	NA	5728	PTEN	umls:C0023462	CLINVAR	NA	0.12	NA	PTEN	10	87933165	T	C
rs864309495	NA	7157	TP53	umls:C0023462	CLINVAR	NA	0.120814326	NA	TP53	17	7674895	A	-

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:0)
(Waiting for update.)

Disease ID	1029
Disease	acute megakaryoblastic leukemia
Case	(Waiting for update.)

Web Analytics Made Easy - StatCounter