| 3m syndrome | ||||
| Disease ID | 565 |
|---|---|
| Disease | 3m syndrome |
| Synonym | 3-m syndrome 3@m syndrome dolichospondylic dysplasia dolichospondylic dysplasia (disorder) le merrer syndrome miller-mckusick-malvaux syndrome miller-mckusick-malvaux-syndrome (3m syndrome) three m syndrome |
| Orphanet | |
| OMIM | |
| DOID | |
| UMLS | C1848862 |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:1) |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:3) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:13) 617 | BCS1L | 2.858 | DISEASES 9820 | CUL7 | 7.692 | DISEASES 1763 | DNA2 | 2.84 | DISEASES 2296 | FOXC1 | 2.003 | DISEASES 3481 | IGF2 | 1.466 | DISEASES 3483 | IGFALS | 3.162 | DISEASES 23363 | OBSL1 | 7.957 | DISEASES 64864 | RFX7 | 4.66 | DISEASES 5269 | SERPINB6 | 2.355 | DISEASES 64426 | SUDS3 | 3.324 | DISEASES 6905 | TBCE | 2.479 | DISEASES 7280 | TUBB2A | 2.877 | DISEASES 7518 | XRCC4 | 2.299 | DISEASES |
| Locus | Symbol | Locus(Total Locus:3) |
| Disease ID | 565 |
|---|---|
| Disease | 3m syndrome |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:42) HP:0011800 | Midface retrusion HP:0000470 | Short neck HP:0003691 | Scapular winging HP:0000682 | Abnormality of dental enamel HP:0000307 | Pointed chin HP:0004322 | Short stature HP:0001838 | Rocker bottom foot HP:0000232 | Everted lower lip vermilion HP:0004570 | Increased vertebral height HP:0100659 | Abnormality of the cerebral vasculature HP:0000337 | Broad forehead HP:0010306 | Short thorax HP:0008839 | Hypoplastic pelvis HP:0000047 | Hypospadias HP:0001374 | Congenital hip dislocation HP:0002007 | Frontal bossing HP:0003307 | Hyperlordosis HP:0005692 | Joint hyperflexibility HP:0000343 | Long philtrum HP:0000883 | Thin ribs HP:0000684 | Delayed eruption of teeth HP:0000574 | Thick eyebrow HP:0001511 | Intrauterine growth retardation HP:0003175 | Hypoplastic ischia HP:0003022 | Hypoplasia of the ulna HP:0002650 | Scoliosis HP:0002808 | Kyphosis HP:0000888 | Horizontal ribs HP:0000268 | Dolichocephaly HP:0004209 | Clinodactyly of the 5th finger HP:0100625 | Enlarged thorax HP:0009811 | Abnormality of the elbow HP:0003100 | Slender long bone HP:0000411 | Protruding ear HP:0002750 | Delayed skeletal maturation HP:0000463 | Anteverted nares HP:0000325 | Triangular face HP:0000414 | Bulbous nose HP:0000144 | Decreased fertility HP:0000944 | Abnormality of the metaphyses HP:0002983 | Micromelia HP:0003173 | Hypoplastic pubic bone |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:4) |
| Disease ID | 565 |
|---|---|
| Disease | 3m syndrome |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:9) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs121918228 | NA | 9820 | CUL7 | umls:C1848862 | CLINVAR | NA | 0.362985861 | NA | CUL7 | 6 | 43038949 | G | A |
| rs121918229 | NA | 9820 | CUL7 | umls:C1848862 | CLINVAR | NA | 0.362985861 | NA | CUL7 | 6 | 43038891 | T | G |
| rs201406974 | NA | 9820 | CUL7 | umls:C1848862 | CLINVAR | NA | 0.362985861 | NA | CUL7 | 6 | 43046304 | A | C,G |
| rs61752334 | NA | 9820 | CUL7 | umls:C1848862 | CLINVAR | NA | 0.362985861 | NA | CUL7 | 6 | 43044883 | A | C |
| rs730880261 | NA | 9820 | CUL7 | umls:C1848862 | CLINVAR | NA | 0.362985861 | NA | CUL7 | 6 | 43038681 | CA | - |
| rs730880262 | NA | 9820 | CUL7 | umls:C1848862 | CLINVAR | NA | 0.362985861 | NA | CUL7 | 6 | 43043156 | CA | - |
| rs730880263 | NA | 9820 | CUL7 | umls:C1848862 | CLINVAR | NA | 0.362985861 | NA | CUL7 | 6 | 43049665 | G | T |
| rs749509661 | NA | 9820 | CUL7 | umls:C1848862 | CLINVAR | NA | 0.362985861 | NA | CUL7 | 6 | 43038323 | G | A |
| rs794727644 | NA | 9820 | CUL7 | umls:C1848862 | CLINVAR | NA | 0.362985861 | NA | CUL7 | 6 | 43051282 | GCTCCGAGATCAGGGTGCCCAT | - |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:21) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0009811 | Abnormality of the elbow | MP:0008158 | increased diameter of femur | increased width of the cross-sectional distance that extends from one lateral edge of the femur, through its center and to the opposite lateral edge |
| HP:0003173 | Hypoplastic pubic bone | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000684 | Delayed eruption of teeth | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0001511 | Intrauterine growth retardation | MP:0011109 | lethality throughout fetal growth and development, incomplete penetrance | the appearance of lower than Mendelian ratios of organisms of a given genotype due to death of some, but not all of the organisms between the completion of organogenesis and birth (Mus: E14 to approximately E18.5) |
| HP:0000325 | Triangular face | MP:0012546 | triangular face | a face whose lower half becomes relatively thin, approaching an appearance of a triangle with a tip facing downwards; usually associated with a prominent forehead and micrognathia |
| HP:0000470 | Short neck | MP:0012720 | elongated neck | increased length of the neck |
| HP:0003022 | Hypoplasia of the ulna | MP:0012167 | abnormal epigenetic regulation of gene expression | any anomaly in the process that modulates the frequency, rate or extent of gene expression, in which the process is mitotically or meiotically heritable, or is stably self-propagated in the cytoplasm of a resting cell, and does not entail a change in DNA |
| HP:0000232 | Everted lower lip vermilion | MP:0005170 | cleft upper lip | defect in the upper lip where the maxillary prominence fails to merge with the merged medial nasal prominences |
| HP:0004209 | Clinodactyly of the 5th finger | MP:0011665 | d-loop transposition of the great arteries | complete transposition of the great arteries; the d- refers to the dextroposition of the bulboventricular loop (ie, the position of the right ventricle, which is on the right side); in addition, the aorta also tends to be on the right and anterior, and th |
| HP:0003100 | Slender long bone | MP:0013624 | decreased femur compact bone thickness | reduced width of the superficial layer of compact bone at the midpoint of the femur |
| HP:0000888 | Horizontal ribs | MP:0004672 | short ribs | reduced length of the bones forming the bony wall of the chest |
| HP:0000883 | Thin ribs | MP:0004674 | thin ribs | a more slender appearance of the bones forming the bony wall of the chest |
| HP:0000944 | Abnormality of the metaphyses | MP:0013621 | decreased internal diameter of femur | reduced cross-sectional distance that extends from one lateral edge of the femur long bone marrow cavity, through its center and to the opposite lateral edge of the bone marrow cavity through the mid point of the femur |
| HP:0000411 | Protruding ear | MP:0005105 | abnormal middle ear ossicle morphology | any structural anomaly of the three small bones of the middle ear |
| HP:0000144 | Decreased fertility | MP:0008975 | delayed male fertility | ability of a male organism to produce live offspring occurring at a later than expected age |
| HP:0100659 | Abnormality of the cerebral vasculature | MP:0004499 | increased incidence of tumors by chemical induction | higher than normal frequency of tumor incidence induced by one or more chemical carcinogens or mutagens |
| HP:0011800 | Hypoplasia of midface | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0001838 | Rocker bottom foot | MP:0008059 | abnormal podocyte foot process morphology | any structural anomaly of the footlike extension of podocytes that interdigitate with one another to form the walls of the glomerular capillaries |
| HP:0004570 | Increased vertebral height | MP:0006394 | abnormal vertebral epiphyseal plate morphology | any structural anomaly of the lateral cartilaginous centers of ossification; may be found on the lateral, upper, and/or lower surfaces of the vertebrae at different times during development |
| HP:0000682 | Abnormality of dental enamel | MP:0012069 | abnormal horizontal basal cell of olfactory epithelium morphology | any structural anomaly of the flat or angular epithelial cell with condensed nuclei and darkly staining cytoplasm containing numerous intermediate filaments inserted into desmosomes contacting surrounding supporting cells, that lie in contact with the bas |
| HP:0002750 | Delayed skeletal maturation | MP:0003379 | absent sexual maturation | failure to initiate pubertal changes that result in achievement of full sexual capacity |
Mapped by homologous gene(Total Items:42) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0002650 | Scoliosis | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0000411 | Protruding ear | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0010306 | Short thorax | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000268 | Dolichocephaly | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0000325 | Triangular face | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0003691 | Scapular winging | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0003307 | Hyperlordosis | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0000463 | Anteverted nares | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0000682 | Abnormality of dental enamel | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0004322 | Short stature | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0003100 | Slender long bone | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000047 | Hypospadias | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0008839 | Hypoplastic pelvis | MP:0014164 | abnormal ciliary process morphology | any structural anomaly of any of the pigmented processes that radiate from the ciliary muscle and give attachments to ligaments supporting the lens of the eye; these processes increase in thickness as they advance from the orbiculus ciliaris to the exter |
| HP:0001511 | Intrauterine growth retardation | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0001374 | Congenital hip dislocation | MP:0020214 | susceptible to malignant hyperthermia | increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine |
| HP:0000337 | Broad forehead | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0100659 | Abnormality of the cerebral vasculature | MP:0020220 | decreased tear production | decreased production of the amount of fluid produced in the eye |
| HP:0000574 | Thick eyebrow | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0003173 | Hypoplastic pubic bone | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000883 | Thin ribs | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0009811 | Abnormality of the elbow | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0003022 | Hypoplasia of the ulna | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0000470 | Short neck | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002983 | Micromelia | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0003175 | Hypoplastic ischia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0004570 | Increased vertebral height | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0000232 | Everted lower lip vermilion | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0100625 | Enlarged thorax | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000684 | Delayed eruption of teeth | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000343 | Long philtrum | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0004209 | Clinodactyly of the 5th finger | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0000414 | Bulbous nose | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000888 | Horizontal ribs | MP:0014164 | abnormal ciliary process morphology | any structural anomaly of any of the pigmented processes that radiate from the ciliary muscle and give attachments to ligaments supporting the lens of the eye; these processes increase in thickness as they advance from the orbiculus ciliaris to the exter |
| HP:0001838 | Rocker bottom foot | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002750 | Delayed skeletal maturation | MP:0020169 | increased thyroid gland weight | higher than average weight of the thyroid gland |
| HP:0011800 | Hypoplasia of midface | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0005692 | Joint hyperflexibility | MP:0012125 | decreased bronchoconstrictive response | reduction in the expected bronchoconstrictive response to provocation challenge with lipopolysaccharide, bradykinin, histamine or other antigen/allergen or agent, often measured by plethysmography |
| HP:0002808 | Kyphosis | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002007 | Frontal bossing | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000307 | Pointed chin | MP:0014178 | increased brain apoptosis | increase in the number of cells of the brain undergoing programmed cell death |
| HP:0000944 | Abnormality of the metaphyses | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000144 | Decreased fertility | MP:0014198 | absent pituitary infundibular stalk | absence of the apical portion of the tubular structure extending from the hypothalamus to the posterior lobe of the pituitary gland |
| Disease ID | 565 |
|---|---|
| Disease | 3m syndrome |
| Case | (Waiting for update.) |