PedAM

Pediatric Disease Annotations & Medicines


	von hippel-lindau syndrome

Disease ID	626
Disease	von hippel-lindau syndrome
Definition	An autosomal dominant disorder caused by mutations in a tumor suppressor gene. This syndrome is characterized by abnormal growth of small blood vessels leading to a host of neoplasms. They include HEMANGIOBLASTOMA in the RETINA; CEREBELLUM; and SPINAL CORD; PHEOCHROMOCYTOMA; pancreatic tumors; and renal cell carcinoma (see CARCINOMA, RENAL CELL). Common clinical signs include HYPERTENSION and neurological dysfunctions.
Synonym	angiomatoses, familial cerebello-retinal angiomatoses, familial cerebelloretinal angiomatosis retinae angiomatosis, familial cerebello-retinal angiomatosis, familial cerebelloretinal angiophakomatosis retinae et cerebelli cerebello-retinal angiomatoses, familial cerebello-retinal angiomatosis, familial cerebelloretinal angiomatoses, familial cerebelloretinal angiomatosis, familial cerebroretinal angiomatosis disease hippel lindaus von disease hippel-lindau von familial cerebello retinal angiomatosis familial cerebello-retinal angiomatoses familial cerebello-retinal angiomatosis familial cerebelloretinal angiomatoses familial cerebelloretinal angiomatosis hemangioblastomatosis, cerebelloretinal hippel lindau dis hippel lindau disease hippel lindau syndrome hippel lindau syndrome von hippel lindau von disease hippel lindaus syndrome von hippel-lindau disease lindau dis lindau disease lindau von hippel disease lindau' disease lindau's disease lindau's diseases lindaus dis lindaus disease retinae, angiomatosis syndrome, vhl syndrome, von hippel-lindau syndromes, vhl vhl vhl - von hippel-lindau syndrome vhl syndrome vhl syndromes von hippel lindau dis von hippel lindau disease von hippel lindau syndrome von hippel-lindau disease von hippel-lindau disease [disease/finding] von hippel-lindau syndrome (disorder) von hippel-lindau syndrome (vhl) von-hippel lindau disease
Orphanet	ORPHANET:892
OMIM	OMIM:193300 OMIM:608537
DOID	DOID:14175
UMLS	C0019562
MeSH	D006623
SNOMED-CT	SNOMEDCT_US_2016_09_01:46659004
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:35) C0206734 \| hemangioblastomas \| 12 C0019562 \| von hippel-lindau disease \| 10 C0007134 \| renal cell carcinoma \| 8 C0206734 \| hemangioblastoma \| 6 C0031511 \| pheochromocytoma \| 6 C0019562 \| von hippel-lindau syndrome \| 5 C0206754 \| neuroendocrine tumor \| 5 C1306837 \| papillary renal cell carcinoma \| 4 C0018916 \| hemangioma \| 4 C0031511 \| pheochromocytomas \| 3 C0206754 \| neuroendocrine tumors \| 3 C0007134 \| renal cell carcinomas \| 2 C0010633 \| cystadenoma \| 2 C0024299 \| lymphoma \| 2 C1319315 \| colorectal adenocarcinoma \| 1 C0031511 \| phaeochromocytoma \| 1 C0030421 \| paraganglioma \| 1 C0023467 \| acute myeloid leukemia \| 1 C0018916 \| hemangiomas \| 1 C0001418 \| adenocarcinomas \| 1 C0001418 \| adenocarcinoma \| 1 C1332900 \| cerebellar hemangioblastoma \| 1 C0242647 \| mucosa-associated lymphoma \| 1 C0740457 \| renal cancer \| 1 C0278678 \| metastatic renal cell carcinoma \| 1 C0022354 \| obstructive jaundice \| 1 C0037859 \| epididymal cyst \| 1 C0206754 \| neuroendocrine tumour \| 1 C1855995 \| l-2-hydroxyglutaric aciduria \| 1 C0025286 \| meningioma \| 1 C0023470 \| myeloid leukemia \| 1 C0019562 \| von hippel-lindau syndrome (vhl) \| 1 C0011251 \| delusional disorder \| 1 C0032461 \| polycythemia \| 1 C0152013 \| lung adenocarcinoma \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:2) CCND1 \| 595 \| CTD_human VHL \| 7428 \| CLINVAR;GHR;ORPHANET;OMIM;UNIPROT;CTD_human
Inferring Gene	Entrez_id \| Symbol \| Resource(Total Genes:1) 7428 \| VHL \| infer
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:130) 10777 \| ARPP21 \| DISEASES 997 \| CDC34 \| DISEASES 9978 \| RBX1 \| DISEASES 1113 \| CHGA \| DISEASES 4605 \| MYBL2 \| DISEASES 7249 \| TSC2 \| DISEASES 7991 \| TUSC3 \| DISEASES 2057 \| EPOR \| DISEASES 199731 \| CADM4 \| DISEASES 708 \| C1QBP \| DISEASES 5539 \| PPY \| DISEASES 1027 \| CDKN1B \| DISEASES 2026 \| ENO2 \| DISEASES 6500 \| SKP1 \| DISEASES 1044 \| CDX1 \| DISEASES 5552 \| SRGN \| DISEASES 112399 \| EGLN3 \| DISEASES 25796 \| PGLS \| DISEASES 2056 \| EPO \| DISEASES 140628 \| GATA5 \| DISEASES 10343 \| PKDREJ \| DISEASES 2670 \| GFAP \| DISEASES 3656 \| IRAK2 \| DISEASES 7428 \| VHL \| DISEASES 8933 \| FAM127A \| DISEASES 324 \| APC \| DISEASES 29923 \| HILPDA \| DISEASES 55654 \| TMEM127 \| DISEASES 6009 \| RHEB \| DISEASES 1031 \| CDKN2C \| DISEASES 5976 \| UPF1 \| DISEASES 8178 \| ELL \| DISEASES 443 \| ASPA \| DISEASES 6855 \| SYP \| DISEASES 5033 \| P4HA1 \| DISEASES 2034 \| EPAS1 \| DISEASES 5443 \| POMC \| DISEASES 6389 \| SDHA \| DISEASES 5523 \| PPP2R3A \| DISEASES 320 \| APBA1 \| DISEASES 79109 \| MAPKAP1 \| DISEASES 2065 \| ERBB3 \| DISEASES 7157 \| TP53 \| DISEASES 5409 \| PNMT \| DISEASES 5546 \| PRCC \| DISEASES 1030 \| CDKN2B \| DISEASES 2838 \| GPR15 \| DISEASES 760 \| CA2 \| DISEASES 6750 \| SST \| DISEASES 9162 \| DGKI \| DISEASES 9669 \| EIF5B \| DISEASES 3856 \| KRT8 \| DISEASES 6862 \| T \| DISEASES 9317 \| PTER \| DISEASES 54949 \| SDHAF2 \| DISEASES 7314 \| UBB \| DISEASES 112398 \| EGLN2 \| DISEASES 435 \| ASL \| DISEASES 7634 \| ZNF80 \| DISEASES 947 \| CD34 \| DISEASES 5619 \| PRM1 \| DISEASES 55167 \| MSL2 \| DISEASES 6396 \| SEC13 \| DISEASES 4281 \| MID1 \| DISEASES 4867 \| NPHP1 \| DISEASES 7030 \| TFE3 \| DISEASES 65059 \| RAPH1 \| DISEASES 4233 \| MET \| DISEASES 5021 \| OXTR \| DISEASES 84260 \| TCHP \| DISEASES 6794 \| STK11 \| DISEASES 8454 \| CUL1 \| DISEASES 3855 \| KRT7 \| DISEASES 7490 \| WT1 \| DISEASES 5915 \| RARB \| DISEASES 4158 \| MC2R \| DISEASES 4221 \| MEN1 \| DISEASES 3091 \| HIF1A \| DISEASES 23462 \| HEY1 \| DISEASES 23583 \| SMUG1 \| DISEASES 10524 \| KAT5 \| DISEASES 2272 \| FHIT \| DISEASES 4771 \| NF2 \| DISEASES 5979 \| RET \| DISEASES 7068 \| THRB \| DISEASES 5828 \| PEX2 \| DISEASES 11186 \| RASSF1 \| DISEASES 4763 \| NF1 \| DISEASES 5573 \| PRKAR1A \| DISEASES 7516 \| XRCC2 \| DISEASES 5792 \| PTPRF \| DISEASES 4311 \| MME \| DISEASES 3880 \| KRT19 \| DISEASES 2271 \| FH \| DISEASES 54583 \| EGLN1 \| DISEASES 7432 \| VIP \| DISEASES 79577 \| CDC73 \| DISEASES 6391 \| SDHC \| DISEASES 2045 \| EPHA7 \| DISEASES 2959 \| GTF2B \| DISEASES 5314 \| PKHD1 \| DISEASES 988 \| CDC5L \| DISEASES 5728 \| PTEN \| DISEASES 7422 \| VEGFA \| DISEASES 656 \| BMP8B \| DISEASES 6390 \| SDHB \| DISEASES 6392 \| SDHD \| DISEASES 7161 \| TP73 \| DISEASES 768 \| CA9 \| DISEASES 1114 \| CHGB \| DISEASES 2315 \| MLANA \| DISEASES 11202 \| KLK8 \| DISEASES 64223 \| MLST8 \| DISEASES 2047 \| EPHB1 \| DISEASES 2642 \| GCGR \| DISEASES 7852 \| CXCR4 \| DISEASES 7311 \| UBA52 \| DISEASES 131578 \| LRRC15 \| DISEASES 2674 \| GFRA1 \| DISEASES 7849 \| PAX8 \| DISEASES 5076 \| PAX2 \| DISEASES 5378 \| PMS1 \| DISEASES 1012 \| CDH13 \| DISEASES 8842 \| PROM1 \| DISEASES 6513 \| SLC2A1 \| DISEASES 672 \| BRCA1 \| DISEASES 55845 \| BRK1 \| DISEASES 8453 \| CUL2 \| DISEASES 391104 \| VHLL \| DISEASES 100506195 \| LARGE-AS1 \| DISEASES
Locus	(Waiting for update.)

Disease ID	626
Disease	von hippel-lindau syndrome
Integrated Phenotype	(Waiting for update.)
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:29) HP:0002664 \| Neoplasia \| 10 HP:0005584 \| Renal cell carcinoma \| 8 HP:0030731 \| Carcinoma \| 7 HP:0030393 \| Heffner tumor \| 7 HP:0002666 \| Pheochromocytoma \| 6 HP:0010797 \| Hemangioblastoma \| 6 HP:0006766 \| Papillary renal cell carcinoma \| 4 HP:0009726 \| Renal neoplasm \| 4 HP:0001028 \| Strawberry mark \| 4 HP:0009711 \| Retinal capillary hemangioma \| 3 HP:0005306 \| Capillary hemangioma \| 3 HP:0002665 \| Lymphoma \| 2 HP:0000969 \| Dropsy \| 1 HP:0009715 \| Papillary cystadenoma of the epididymis \| 1 HP:0002894 \| Neoplasia of the pancreas \| 1 HP:0040144 \| L-2-hydroxyglutaric aciduria \| 1 HP:0030078 \| Lung adenocarcinoma \| 1 HP:0012062 \| Bone cysts \| 1 HP:0000952 \| Yellow skin \| 1 HP:0003150 \| Glutaric aciduria \| 1 HP:0030424 \| Epididymal cyst \| 1 HP:0012190 \| T cell lymphoma \| 1 HP:0006880 \| Hemangioblastoma, sporadic cerebellar \| 1 HP:0004808 \| Acute myelogenous leukemia \| 1 HP:0001901 \| Abnormally shaped erythrocytes \| 1 HP:0009713 \| Spinal hemangioblastoma \| 1 HP:0012324 \| Myeloid leukemia \| 1 HP:0002668 \| Paragangliomas \| 1 HP:0002858 \| Mengiomia \| 1

Disease ID	626
Disease	von hippel-lindau syndrome
Manually Symptom	(Waiting for update.)
Text Mined Symptom	UMLS \| Name \| Sentences' Count(Total Symptoms:21) C0206734 \| hemangioblastomas \| 11 C0206734 \| hemangioblastoma \| 6 C0007134 \| renal cell carcinoma \| 6 C0031511 \| pheochromocytoma \| 6 C0018916 \| hemangioma \| 4 C0031511 \| pheochromocytomas \| 3 C0007134 \| renal cell carcinomas \| 2 C0730303 \| retinal capillary hemangioma \| 2 C0242363 \| pancreatic neuroendocrine tumor \| 2 C0206754 \| neuroendocrine tumors \| 2 C0022665 \| renal tumors \| 2 C0740457 \| renal cancer \| 1 C1514915 \| retinal hemangioblastoma \| 1 C0030297 \| pancreatic tumor \| 1 C0334101 \| hemangioblastomatosis \| 1 C0022665 \| renal neoplasm \| 1 C1332900 \| cerebellar hemangioblastoma \| 1 C0022354 \| obstructive jaundice \| 1 C0278678 \| metastatic renal cell carcinoma \| 1 C0085666 \| capillary hemangiomas \| 1 C1860389 \| spinal cord hemangioblastoma \| 1

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:65)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs104893824	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10142181	T	A,C
rs104893824	10533030	7428	VHL	umls:C0019562	BeFree	We have identified a family segregating von Hippel-Lindau (VHL) disease with a previously unreported T547A mutation in exon 1 of the VHL gene that causes a Tyr112 to Asn missense alteration in the protein.	0.658392406	1999	VHL	3	10142181	T	A,C
rs104893825	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10149819	G	T
rs104893829	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10142088	C	T
rs104893830	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10146561	G	C
rs119103277	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10142110	G	A,C
rs148935214	19906784	5979	RET	umls:C0019562	BeFree	RET p.Tyr791Phe and p.Ser649Leu and VHL p.Pro81Ser are definitely not pathogenic mutations for VHL and MEN 2.	0.012258492	2010	RET	10	43114546	C	T
rs193922608	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10142089	C	T
rs193922609	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10142167	G	C
rs193922610	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10146544	C	T
rs193922611	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10146631	T	A
rs193922613	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10149847	A	G
rs267607170	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10149814	A	G
rs281860296	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10149909	A	G
rs28940298	12415268	7428	VHL	umls:C0019562	BeFree	The gene associated with von Hippel-Lindau syndrome, VHL, maps to this region, and homozygosity with respect to a C-->T missense mutation in VHL, causing an arginine-to-tryptophan change at amino-acid residue 200 (Arg200Trp), was identified in all individuals affected with Chuvash polycythemia.	0.658392406	2002	VHL	3	10149921	C	T
rs28940298	12393546	7428	VHL	umls:C0019562	UNIPROT	We evaluated the role of VHL in 8 children with a history of polycythemia and an elevated serum Epo level and found 3 different germline VHL mutations in 4 of them.	0.658392406	2003	VHL	3	10149921	C	T
rs28940298	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10149921	C	T
rs35460768	16884327	7428	VHL	umls:C0019562	BeFree	A family with a medical history suggestive of VHL disease was investigated using DNA sequence analysis to determine the presence of the P25L variant of the VHL protein.	0.658392406	2006	VHL	3	10141921	C	T
rs35460768	11257211	7428	VHL	umls:C0019562	BeFree	P25L is a rare variant of the VHL gene and cannot be considered a cause of VHL disease.	0.658392406	2001	VHL	3	10141921	C	T
rs397516440	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10142166	C	G
rs397516441	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10149790	A	G
rs397516442	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10146581	T	-
rs397516443	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10146638	T	G
rs397516444	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10149808	G	T
rs397516445	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10149820	T	C
rs398123481	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10142103	C	G,T
rs398123482	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10142173	T	A
rs398123483	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10149824	-	TTGTCCGT
rs5030622	8956040	7428	VHL	umls:C0019562	UNIPROT	Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan.	0.658392406	1996	NA	NA	NA	NA	NA
rs5030802	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10142055	G	A,T
rs5030803	8956040	7428	VHL	umls:C0019562	UNIPROT	Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan.	0.658392406	1996	VHL	3	10142068	T	G
rs5030804	23842656	7428	VHL	umls:C0019562	BeFree	p.N78S and p.R161Q germline mutations of the VHL gene are present in von Hippel-Lindau syndrome in two pedigrees.	0.658392406	2013	VHL	3	10142080	A	G
rs5030804	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10142080	A	G
rs5030804	8956040	7428	VHL	umls:C0019562	UNIPROT	Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan.	0.658392406	1996	VHL	3	10142080	A	G
rs5030805	12000816	7428	VHL	umls:C0019562	UNIPROT	The group of susceptibility genes for pheochromocytoma that included the proto-oncogene RET (associated with multiple endocrine neoplasia type 2 [MEN-2]) and the tumor-suppressor gene VHL (associated with von Hippel-Lindau disease) now also encompasses the newly identified genes for succinate dehydrogenase subunit D (SDHD) and succinate dehydrogenase subunit B (SDHB), which predispose carriers to pheochromocytomas and glomus tumors.	0.658392406	2002	VHL	3	10142086	G	A,T
rs5030806	8956040	7428	VHL	umls:C0019562	UNIPROT	Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan.	0.658392406	1996	NA	NA	NA	NA	NA
rs5030807	8956040	7428	VHL	umls:C0019562	UNIPROT	Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan.	0.658392406	1996	VHL	3	10142113	T	A,C
rs5030808	12000816	7428	VHL	umls:C0019562	UNIPROT	The group of susceptibility genes for pheochromocytoma that included the proto-oncogene RET (associated with multiple endocrine neoplasia type 2 [MEN-2]) and the tumor-suppressor gene VHL (associated with von Hippel-Lindau disease) now also encompasses the newly identified genes for succinate dehydrogenase subunit D (SDHD) and succinate dehydrogenase subunit B (SDHB), which predispose carriers to pheochromocytomas and glomus tumors.	0.658392406	2002	VHL	3	10142124	G	A,C
rs5030809	12000816	7428	VHL	umls:C0019562	UNIPROT	The group of susceptibility genes for pheochromocytoma that included the proto-oncogene RET (associated with multiple endocrine neoplasia type 2 [MEN-2]) and the tumor-suppressor gene VHL (associated with von Hippel-Lindau disease) now also encompasses the newly identified genes for succinate dehydrogenase subunit D (SDHD) and succinate dehydrogenase subunit B (SDHB), which predispose carriers to pheochromocytomas and glomus tumors.	0.658392406	2002	VHL	3	10142139	T	C
rs5030809	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10142139	T	C
rs5030811	8956040	7428	VHL	umls:C0019562	UNIPROT	Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan.	0.658392406	1996	VHL	3	10146516	C	T
rs5030812	18836774	7428	VHL	umls:C0019562	BeFree	Based on this work, we propose that the nsSNP with a SNPid of rs5030812 is an important candidate for the cause of von Hippel-Lindau syndrome via the VHL gene.	0.658392406	2008	NA	NA	NA	NA	NA
rs5030812	NA	7428	VHL	umls:C0019562	UNIPROT	NA	0.658392406	NA	NA	NA	NA	NA	NA
rs5030817	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10149786	G	A
rs5030818	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10149804	C	G,T
rs5030818	NA	7428	VHL	umls:C0019562	UNIPROT	NA	0.658392406	NA	VHL	3	10149804	C	G,T
rs5030820	12000816	7428	VHL	umls:C0019562	UNIPROT	The group of susceptibility genes for pheochromocytoma that included the proto-oncogene RET (associated with multiple endocrine neoplasia type 2 [MEN-2]) and the tumor-suppressor gene VHL (associated with von Hippel-Lindau disease) now also encompasses the newly identified genes for succinate dehydrogenase subunit D (SDHD) and succinate dehydrogenase subunit B (SDHB), which predispose carriers to pheochromocytomas and glomus tumors.	0.658392406	2002	VHL	3	10149822	C	G,T
rs5030820	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10149822	C	G,T
rs5030821	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10149823	G	A
rs5030821	12000816	7428	VHL	umls:C0019562	UNIPROT	The group of susceptibility genes for pheochromocytoma that included the proto-oncogene RET (associated with multiple endocrine neoplasia type 2 [MEN-2]) and the tumor-suppressor gene VHL (associated with von Hippel-Lindau disease) now also encompasses the newly identified genes for succinate dehydrogenase subunit D (SDHD) and succinate dehydrogenase subunit B (SDHB), which predispose carriers to pheochromocytomas and glomus tumors.	0.658392406	2002	VHL	3	10149823	G	A
rs5030822	NA	7428	VHL	umls:C0019562	UNIPROT	NA	0.658392406	NA	VHL	3	10149856	T	A
rs5030824	12000816	7428	VHL	umls:C0019562	UNIPROT	The group of susceptibility genes for pheochromocytoma that included the proto-oncogene RET (associated with multiple endocrine neoplasia type 2 [MEN-2]) and the tumor-suppressor gene VHL (associated with von Hippel-Lindau disease) now also encompasses the newly identified genes for succinate dehydrogenase subunit D (SDHD) and succinate dehydrogenase subunit B (SDHB), which predispose carriers to pheochromocytomas and glomus tumors.	0.658392406	2002	VHL	3	10149885	C	G
rs5030824	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10149885	C	G
rs5030826	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10142041	C	A,G,T
rs5030827	16502427	7428	VHL	umls:C0019562	UNIPROT	In each of these four families, the major clinical manifestation of VHL disease is multiple early-onset pheochromocytomas (VHL type 2C).	0.658392406	2006	VHL	3	10142097	G	T
rs5030827	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10142097	G	T
rs5030830	8956040	7428	VHL	umls:C0019562	UNIPROT	Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan.	0.658392406	1996	VHL	3	10146526	T	C
rs5030832	8956040	7428	VHL	umls:C0019562	UNIPROT	Germline mutations in the Von Hippel-Lindau disease (VHL) gene in families from North America, Europe, and Japan.	0.658392406	1996	VHL	3	10146535	A	G
rs5030833	12000816	7428	VHL	umls:C0019562	UNIPROT	The group of susceptibility genes for pheochromocytoma that included the proto-oncogene RET (associated with multiple endocrine neoplasia type 2 [MEN-2]) and the tumor-suppressor gene VHL (associated with von Hippel-Lindau disease) now also encompasses the newly identified genes for succinate dehydrogenase subunit D (SDHD) and succinate dehydrogenase subunit B (SDHB), which predispose carriers to pheochromocytomas and glomus tumors.	0.658392406	2002	VHL	3	10146580	T	C,G
rs727503744	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10141773	CGCACGCAGCTCCGCCCCGCG	-
rs727504215	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10146524	G	T
rs77724903	19906784	5979	RET	umls:C0019562	BeFree	RET p.Tyr791Phe and p.Ser649Leu and VHL p.Pro81Ser are definitely not pathogenic mutations for VHL and MEN 2.	0.012258492	2010	RET	10	43118460	A	T
rs794726890	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10142092	G	C
rs794727253	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10146622	A	-
rs794729660	NA	7428	VHL	umls:C0019562	CLINVAR	NA	0.658392406	NA	VHL	3	10142070	ATC	-

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:0)
(Waiting for update.)

Chemical(Total Drugs:0)
(Waiting for update.)

FDA approved drug and dosage information(Total Drugs:0)
(Waiting for update.)

FDA labeling changes(Total Drugs:0)
(Waiting for update.)