PedAM
Pediatric Disease Annotations & Medicines
| retinoblastoma | ||||
| Disease ID | 7 |
|---|---|
| Disease | retinoblastoma |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:32) C2697383 | osteosarcoma C2063120 | pineoblastoma C1963266 | uveitis C1963229 | retinal detachment C1962986 | glaucoma C1704327 | bone sarcomas C1658953 | tumor vasculature C1608408 | malignant transformation C1402829 | leukoencephalitis C1261473 | sarcoma C0920196 | carcinoma of the eyelid C0686377 | central nervous system metastases C0677930 | primary neoplasm C0496836 | ocular cancer C0426768 | o sign C0422833 | ent symptoms C0280449 | secondary acute myelogenous leukemia C0265451 | 13q deletion syndrome C0220654 | malignant meningitis C0220650 | brain metastasis C0162678 | neurofibromatosis C0154916 | rubeosis iridis C0153690 | bone metastases C0152458 | leukocoria C0149893 | secondary glaucoma C0086543 | cataracts C0036454 | visual field defects C0027627 | secondary malignancies C0025362 | mental retardation C0025289 | meningitis C0015414 | ocular tumor C0008626 | chromosomal abnormality |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:6) C0205898 | pineoblastoma | 3 C0035305 | retinal detachment | 3 C0152458 | leukocoria | 2 C0029463 | osteosarcoma | 2 C0015414 | ocular tumor | 1 C0086543 | cataracts | 1 |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
All Snps(Total Genotypes:106) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs1051266 | 20310006 | 4524 | MTHFR | umls:C0035335 | BeFree | A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma. | 0.002909916 | 2010 | SLC19A1 | 21 | 45537880 | T | C |
| rs1051266 | 20310006 | 6573 | SLC19A1 | umls:C0035335 | BeFree | A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma. | 0.000542884 | 2010 | SLC19A1 | 21 | 45537880 | T | C |
| rs1051266 | 20310006 | 7298 | TYMS | umls:C0035335 | BeFree | A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma. | 0.002638474 | 2010 | SLC19A1 | 21 | 45537880 | T | C |
| rs121912431 | 12657672 | 6647 | SOD1 | umls:C0035335 | BeFree | Pharmacological treatment of SOD1(G37R) mice with minocycline, a compound that attenuates microgliosis and slows down disease, lessened the dysregulation of Cdk5/Cdk4 and the phosphorylation of Rb. | 0.000271442 | 2003 | SOD1 | 21 | 31663829 | G | A |
| rs121913296 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48345108 | G | T |
| rs121913300 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48367512 | C | G,T |
| rs121913301 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48368549 | C | T |
| rs121913302 | 20059380 | 5925 | RB1 | umls:C0035335 | BeFree | A c.1363C>T (p.R455X) nonsense mutation of RB1 gene in a southern Chinese retinoblastoma pedigree. | 0.499992533 | 2010 | RB1 | 13 | 48379624 | C | T |
| rs121913302 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48379624 | C | T |
| rs121913303 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48381402 | C | T |
| rs121913304 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48381414 | C | T |
| rs121913305 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48453032 | C | T |
| rs137853292 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48452997 | C | T |
| rs137853293 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48465238 | C | T |
| rs137853294 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48459708 | C | T |
| rs137853296 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48463758 | T | C |
| rs137853297 | 16631255 | 5925 | RB1 | umls:C0035335 | BeFree | To describe the documented growth, clinical course, and histopathology of retinoblastomas in an untreated and otherwise normal right eye of a 27-year-old white male with a g.153211T>A (p.Tyr606X) mutation in the retinoblastoma 1 gene, whose left eye was enucleated at age 2 years for 2 retinoblastomas. | 0.499992533 | 2006 | RB1 | 13 | 48456207 | T | A |
| rs137853297 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48456207 | T | A |
| rs1805087 | 20310006 | 4524 | MTHFR | umls:C0035335 | BeFree | A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma. | 0.002909916 | 2010 | MTR | 1 | 236885200 | A | G |
| rs1805087 | 20310006 | 7298 | TYMS | umls:C0035335 | BeFree | A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma. | 0.002638474 | 2010 | MTR | 1 | 236885200 | A | G |
| rs1805087 | 20310006 | 6573 | SLC19A1 | umls:C0035335 | BeFree | A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma. | 0.000542884 | 2010 | MTR | 1 | 236885200 | A | G |
| rs1805087 | 20310006 | 4548 | MTR | umls:C0035335 | BeFree | MTR polymorphic variant A2756G and retinoblastoma risk in Brazilian children. | 0.002638474 | 2010 | MTR | 1 | 236885200 | A | G |
| rs3092891 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48379594 | C | T |
| rs368087026 | 20310006 | 6573 | SLC19A1 | umls:C0035335 | BeFree | A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma. | 0.000542884 | 2010 | SLC19A1 | 21 | 45530890 | G | A |
| rs368087026 | 20310006 | 7298 | TYMS | umls:C0035335 | BeFree | A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma. | 0.002638474 | 2010 | SLC19A1 | 21 | 45530890 | G | A |
| rs368087026 | 20310006 | 4524 | MTHFR | umls:C0035335 | BeFree | A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma. | 0.002909916 | 2010 | SLC19A1 | 21 | 45530890 | G | A |
| rs386514057 | 20310006 | 7298 | TYMS | umls:C0035335 | BeFree | A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma. | 0.002638474 | 2010 | NA | NA | NA | NA | NA |
| rs386514057 | 20310006 | 6573 | SLC19A1 | umls:C0035335 | BeFree | A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma. | 0.000542884 | 2010 | NA | NA | NA | NA | NA |
| rs386514057 | 20310006 | 4524 | MTHFR | umls:C0035335 | BeFree | A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma. | 0.002909916 | 2010 | NA | NA | NA | NA | NA |
| rs387906520 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1;LINC00441 | 13 | 48303724 | G | T |
| rs387906521 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1;LINC00441 | 13 | 48303715 | G | A |
| rs397507444 | 20310006 | 7298 | TYMS | umls:C0035335 | BeFree | A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma. | 0.002638474 | 2010 | MTHFR | 1 | 11794407 | T | G |
| rs397507444 | 20310006 | 6573 | SLC19A1 | umls:C0035335 | BeFree | A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma. | 0.000542884 | 2010 | MTHFR | 1 | 11794407 | T | G |
| rs397507444 | 20310006 | 4524 | MTHFR | umls:C0035335 | BeFree | A case-control study of 72 retinoblastoma cases and 98 cancer-free children controls was performed to investigate whether the polymorphisms of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MTR A2756G), carrier of reduced folate 1 (RFC-1 A80G) and thymidylate synthase (TYMS 2R > 3R) altered the risk for retinoblastoma. | 0.002909916 | 2010 | MTHFR | 1 | 11794407 | T | G |
| rs398123331 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48380062 | C | T |
| rs398123332 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48381333 | - | T |
| rs398123333 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48459794 | GAATGAGTATGAA | CAC |
| rs55819519 | 22674453 | 7157 | TP53 | umls:C0035335 | BeFree | Using immunohistochemistry, we investigated expression of R132H IDH1, and p53 and retinoblastoma pathways. | 0.060551401 | 2012 | TP53 | 17 | 7673751 | C | T |
| rs587776779 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48473391 | G | - |
| rs587776780 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48456351 | T | C |
| rs587776781 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48465030 | G | - |
| rs587776782 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48367604 | G | A,T |
| rs587776783 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48373493 | G | A |
| rs587776784 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48453057 | AATCTGCTTG | - |
| rs587776785 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48456338 | TTTATAAAA | - |
| rs587776786 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48464997 | G | A |
| rs587776787 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48463835 | G | A |
| rs587776788 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48380182 | ACA | - |
| rs587776789 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48349024 | G | T |
| rs587776790 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1;LINC00441 | 13 | 48303977 | - | GCTGCCGCCGCGGAACCCCCGGC |
| rs587776791 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48471962 | A | G |
| rs587778823 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1;LINC00441 | 13 | 48303984 | GCC | - |
| rs587778824 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48307370 | - | TA |
| rs587778825 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48342639 | GT | - |
| rs587778826 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48347832 | G | T |
| rs587778827 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48362891 | A | - |
| rs587778828 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48364916 | - | A |
| rs587778829 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48368537 | CA | - |
| rs587778830 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48373424 | - | C |
| rs587778831 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48376917 | G | A |
| rs587778832 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48380199 | TT | - |
| rs587778833 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48456298 | C | T |
| rs587778834 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48459700 | C | A,T |
| rs587778835 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48463821 | C | T |
| rs587778836 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48465016 | - | TTGA |
| rs587778837 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48465332 | G | - |
| rs587778838 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48473359 | G | A |
| rs587778839 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48476845 | T | C |
| rs587778840 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48307359 | A | - |
| rs587778841 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48345137 | TGCT | - |
| rs587778842 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48362859 | C | T |
| rs587778843 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48364969 | G | T |
| rs587778844 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48367578 | A | - |
| rs587778845 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48373443 | T | A |
| rs587778846 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48377035 | G | A,T |
| rs587778847 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48379607 | G | T |
| rs587778848 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48380215 | T | C |
| rs587778849 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48463788 | A | T |
| rs587778850 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48473391 | G | A |
| rs587778851 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48476705 | - | C |
| rs587778853 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48342638 | TG | - |
| rs587778854 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48345162 | - | T |
| rs587778855 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48367575 | A | T |
| rs587778857 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48381444 | G | A |
| rs587778858 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48453035 | G | T |
| rs587778859 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48459828 | G | A |
| rs587778860 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48463730 | G | C |
| rs587778861 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48465033 | T | A,C |
| rs587778862 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48307361 | AG | - |
| rs587778863 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48381436 | G | A |
| rs587778864 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48453020 | C | T |
| rs587778865 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48456314 | T | A |
| rs587778866 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48456316 | A | G |
| rs587778867 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48459686 | A | T |
| rs587778868 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48463833 | G | T |
| rs587778869 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1;LINC00441 | 13 | 48304015 | C | T |
| rs587778870 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48345145 | C | G,T |
| rs587778871 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48456354 | G | A |
| rs587781256 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48380096 | ACTTTTAGTAAAAAATTTTTT | - |
| rs587781257 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48456296 | T | - |
| rs727504120 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1;LINC00441 | 13 | 48303966 | GGAACCCCCGGCACCGCCGCCGCCGC | - |
| rs727504121 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48373468 | A | - |
| rs794727199 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48452992 | G | A |
| rs794727372 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48465249 | C | A |
| rs794727481 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48342631 | G | A |
| rs797044649 | NA | 5925 | RB1 | umls:C0035335 | CLINVAR | NA | 0.499992533 | NA | RB1 | 13 | 48380074 | - | ATTATCCATTC |
GWASdb Annotation(Total Genotypes:2) | |||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Chr | Pos | SNP_Id | RefGene | EnsemblGene | ENCODE_Factor | ENCODE_TFBS | Chromosome_interaction | GTEx_eQTL | SNP_TFBS_affinity_GWAS3D | SNP_miRNA_target_affinity_PolymiRTS | SNP_splicing_effect_Skippy | SNP_splicing_effect_MutPred_Splice | SNP_ns_protein_effect_dbNSFP | SNP_syn_effect_Silva | SNP_phosphorylation_effect_PhosSNP | PhastCons_score | PhyloP_score | GERP++_RS | Segway_state | Ancestral_allele | ESP_AF | ESP_AFR | ESP_AFR | ESP_EUR | TG_ASN | TG_AMR | TG_AFR | TG_EUR | Type | Consequence | bStatistic | EncH3K27Ac | EncH3K4Me1 | EncH3K4Me3 | EncNucleo | OMIM | Clinvar |
| 13 | 48955201 | rs2804085 | NM_000321,RB1 | ENST00000267163,ENSG00000139687 | NA | NA | chr13,48950001,48960000,chr19,30210001,30220000,7,Hi-C | NA | Oct-1,49.9386 | AhR,1.3138 | Oct-1,18.1154 | OCT-x,39.5563 | MEF-2,1.8381 | NA | NA | NA | NA | NA | NA | 0.168 | 2.818 | 4.62 | F1 | A | NA | NA | NA | 0.930 | 1.000 | 0.950 | 0.770 | 0.990 | Transcript | INTRONIC | 343 | 2.00 | 3.24 |
| 13 | 49035693 | rs4151601 | NM_000321,RB1 | ENST00000267163,ENSG00000139687 | NA | NA | chr13,49030001,49040000,chr12,60850001,60860000,25,Hi-C | chr13,49030001,49040000,chr7,149500001,149510000,26,Hi-C | chr13,49030001,49040000,chr8,40810001,40820000,29,Hi-C | chr13,49030001,49040000,chr13,30220001,30230000,51,Hi-C | chr13,49030001,49040000,chr13,33060001,33070000,54,Hi-C | chr13,49030001,49040000,chr7,7080001,7090000,15,Hi-C | chr13,49030001,49040000,chr16,7100001,7110000,18,Hi-C | chr13,49030001,49040000,chr7,23380001,23390000,6,Hi-C | chr13,49030001,49040000,chr5,11140001,11150000,8,Hi-C | chr13,49030001,49040000,chr1,231410001,231420000,8,Hi-C | chr13,49030001,49040000,chr3,37220001,37230000,9,Hi-C | chr13,49030001,49040000,chr1,233880001,233890000,10,Hi-C | chr13,49030001,49040000,chr8,95980001,95990000,10,Hi-C | chr13,49030001,49040000,chr16,1130001,1140000,25,Hi-C | NA | LM12,2.0316 | LM71,10.4015 | LM100,1.3897 | LM217,1.8766 | LM220,1.8826 | NA | NA | NA | NA | NA | NA | 0.000 | 0.039 | 0.181 | F0 | G |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:1) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0001123 | Visual field defect | MP:0010402 | ventricular septal defect;HP:0000541 | Retinal detachment |
Mapped by homologous gene(Total Items:1) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0000501 | Glaucoma | MP:0000010 | abnormal abdominal fat pad morphology;HP:0001287 | Meningitis |
Chemical(Total Drugs:3) | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| CUI | ChemicalName | ChemicalID | CasRN | DiseaseName | DiseaseID | DirectEvidence | PubMedIDs | ||
| C0035335 | arsenic trioxide | C006632 | 1327-53-3 | retinoblastoma | MESH:D012175 | therapeutic | 18599993 | ||
| C0035335 | cyclophosphamide | D003520 | 50-18-0 | retinoblastoma | MESH:D012175 | therapeutic | 9616283 | ||
| C0035335 | calcitriol | D002117 | 32222-06-3 | retinoblastoma | MESH:D012175 | therapeutic | 10088815 | ||
FDA approved drug and dosage information(Total Drugs:1) | ||||||||
|---|---|---|---|---|---|---|---|---|
| DiseaseID | Drug_name | active_ingredients | strength | Dosage Form/Route | Marketing Status | TE code | RLD | RS |
| MESH:D012175 | calcijex | calcitriol | 0.001MG/ML Federal Register determination that product was not discontinued or withdrawn for safety or efficacy reasons | INJECTABLE;INJECTION | Discontinued | None | Yes | No |
FDA labeling changes(Total Drugs:1) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| DiseaseID | Pediatric_Labeling_Date | Trade_Name | Generic_Name_or_Proper_Name | Indications Studied | Label Changes Summary | Product Labeling | BPCA(B) | PREA(P) | BPCA(B) and PREA(P) | Pediatric Rule (R) | Sponsor | Pediatric Exclusivity Granted Date | NNPS |
| MESH:D012175 | 11/16/2001 | calcijex | calcitriol | Management of hypocalcemia in patients undergoing chronic renal dialysis | The safety and effectiveness of calcitriol was examined in a double-blind placebo-controlled trial of 35 pediatric patients (13-18 years of age) with end-stage renal disease and on dialysis. The primary efficacy endpoint favored the calcitriol-treated versus the placebo-treated patients Transient hypercalcemia was seen in 1 of 16 calcitriol-treated patients; 6 of 16 (38%) calcitriol-treated patients and 2 of 19 (11%) placebo-treated patients had Ca x P >75 | Labeling | B | - | - | - | Abbott | 02/16/2001 | FALSE' |