| renal tubular dysgenesis | ||||
| Disease ID | 1207 |
|---|---|
| Disease | renal tubular dysgenesis |
| Definition | A developmental defect characterized by absence or poor development of proximal renal tubules. [HPO:probinson] |
| Synonym | allanson pantzar mcleod syndrome primitive renal tubule syndrome renal tubular dysgenesis (disorder) renotubular dysgenesis rtd |
| Orphanet | |
| OMIM | |
| UMLS | C0266313 |
| SNOMED-CT | |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:1) |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:4) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | (Waiting for update.) |
| Locus | (Waiting for update.) |
| Disease ID | 1207 |
|---|---|
| Disease | renal tubular dysgenesis |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:13) HP:0000112 | Nephropathy HP:0000316 | Hypertelorism HP:0008660 | Renotubular dysgenesis HP:0000252 | Microcephaly HP:0000114 | Proximal tubulopathy HP:0001636 | Tetralogy of Fallot HP:0005562 | Multiple renal cysts HP:0001622 | Premature birth HP:0007598 | Bilateral single transverse palmar creases HP:0001561 | Polyhydramnios HP:0001562 | Oligohydramnios HP:0002089 | Pulmonary hypoplasia HP:0005692 | Joint hyperflexibility |
| Text Mined Phenotype | (Waiting for update.) |
| Disease ID | 1207 |
|---|---|
| Disease | renal tubular dysgenesis |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
All Snps(Total Genotypes:16) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs104893677 | NA | 185 | AGTR1 | umls:C0266313 | CLINVAR | NA | 0.48 | NA | AGTR1 | 3 | 148741880 | C | T |
| rs121912702 | NA | 183 | AGT | umls:C0266313 | CLINVAR | NA | 0.480271442 | NA | AGT | 1 | 230710247 | G | A |
| rs121912704 | NA | 1636 | ACE | umls:C0266313 | CLINVAR | NA | 0.360814326 | NA | ACE | 17 | 63480479 | C | G |
| rs121917741 | NA | 5972 | REN | umls:C0266313 | CLINVAR | NA | 0.482171535 | NA | REN | 1 | 204162117 | G | A |
| rs121917742 | NA | 5972 | REN | umls:C0266313 | CLINVAR | NA | 0.482171535 | NA | REN | 1 | 204159399 | C | T |
| rs387906576 | NA | 1636 | ACE | umls:C0266313 | CLINVAR | NA | 0.360814326 | NA | ACE | 17 | 63482666 | TGGA | - |
| rs387906577 | NA | 185 | AGTR1 | umls:C0266313 | CLINVAR | NA | 0.48 | NA | AGTR1 | 3 | 148741145 | - | T |
| rs387906578 | NA | 183 | AGT | umls:C0266313 | CLINVAR | NA | 0.480271442 | NA | AGT | 1 | 230703309 | A | - |
| rs397514687 | NA | 185 | AGTR1 | umls:C0266313 | CLINVAR | NA | 0.48 | NA | AGTR1 | 3 | 148741411 | C | T |
| rs397514688 | NA | 1636 | ACE | umls:C0266313 | CLINVAR | NA | 0.360814326 | NA | ACE | 17 | 63483172 | C | T |
| rs397514689 | NA | 1636 | ACE | umls:C0266313 | CLINVAR | NA | 0.360814326 | NA | ACE | 17 | 63488713 | C | T |
| rs397514690 | NA | 5972 | REN | umls:C0266313 | CLINVAR | NA | 0.482171535 | NA | REN | 1 | 204162135 | G | A |
| rs397514691 | NA | 5972 | REN | umls:C0266313 | CLINVAR | NA | 0.482171535 | NA | REN | 1 | 204160648 | G | T |
| rs398122935 | NA | 185 | AGTR1 | umls:C0266313 | CLINVAR | NA | 0.48 | NA | AGTR1 | 3 | 148741286 | G | A |
| rs74315283 | NA | 183 | AGT | umls:C0266313 | CLINVAR | NA | 0.480271442 | NA | AGT | 1 | 230705933 | C | T |
| rs797045079 | NA | 1636 | ACE | umls:C0266313 | CLINVAR | NA | 0.360814326 | NA | ACE | 17 | 63477106 | CTCGGGCCGCCGGGGGCCGG | - |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:0) |
|---|
| (Waiting for update.) |
Mapped by homologous gene(Total Items:0) |
|---|
| (Waiting for update.) |
Chemical(Total Drugs:0) | |
|---|---|
| (Waiting for update.) | |
FDA approved drug and dosage information(Total Drugs:0) | |
|---|---|
| (Waiting for update.) | |
FDA labeling changes(Total Drugs:0) | |
|---|---|
| (Waiting for update.) | |