PedAM

Pediatric Disease Annotations & Medicines


	renal tubular dysgenesis

Disease ID	1207
Disease	renal tubular dysgenesis
Definition	A developmental defect characterized by absence or poor development of proximal renal tubules. [HPO:probinson]
Synonym	allanson pantzar mcleod syndrome primitive renal tubule syndrome renal tubular dysgenesis (disorder) renotubular dysgenesis rtd
Orphanet	ORPHANET:3033
OMIM	OMIM:267430
UMLS	C0266313
SNOMED-CT	SNOMEDCT_US_2016_09_01:702397002
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:1) C0018995 \| hemochromatosis \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:4) AGT \| 183 \| CLINVAR;CTD_human;ORPHANET;UNIPROT ACE \| 1636 \| CLINVAR;CTD_human;ORPHANET AGTR1 \| 185 \| CLINVAR;CTD_human;ORPHANET;UNIPROT REN \| 5972 \| CLINVAR;CTD_human;ORPHANET;UNIPROT
Inferring Gene	(Waiting for update.)
Text Mined Gene	(Waiting for update.)
Locus	(Waiting for update.)

Disease ID	1207
Disease	renal tubular dysgenesis
Integrated Phenotype	HPO \| Name(Total Integrated Phenotypes:13) HP:0000112 \| Nephropathy HP:0000316 \| Hypertelorism HP:0008660 \| Renotubular dysgenesis HP:0000252 \| Microcephaly HP:0000114 \| Proximal tubulopathy HP:0001636 \| Tetralogy of Fallot HP:0005562 \| Multiple renal cysts HP:0001622 \| Premature birth HP:0007598 \| Bilateral single transverse palmar creases HP:0001561 \| Polyhydramnios HP:0001562 \| Oligohydramnios HP:0002089 \| Pulmonary hypoplasia HP:0005692 \| Joint hyperflexibility
Text Mined Phenotype	(Waiting for update.)

Disease ID	1207
Disease	renal tubular dysgenesis
Manually Symptom	(Waiting for update.)
Text Mined Symptom	(Waiting for update.)

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:16)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs104893677	NA	185	AGTR1	umls:C0266313	CLINVAR	NA	0.48	NA	AGTR1	3	148741880	C	T
rs121912702	NA	183	AGT	umls:C0266313	CLINVAR	NA	0.480271442	NA	AGT	1	230710247	G	A
rs121912704	NA	1636	ACE	umls:C0266313	CLINVAR	NA	0.360814326	NA	ACE	17	63480479	C	G
rs121917741	NA	5972	REN	umls:C0266313	CLINVAR	NA	0.482171535	NA	REN	1	204162117	G	A
rs121917742	NA	5972	REN	umls:C0266313	CLINVAR	NA	0.482171535	NA	REN	1	204159399	C	T
rs387906576	NA	1636	ACE	umls:C0266313	CLINVAR	NA	0.360814326	NA	ACE	17	63482666	TGGA	-
rs387906577	NA	185	AGTR1	umls:C0266313	CLINVAR	NA	0.48	NA	AGTR1	3	148741145	-	T
rs387906578	NA	183	AGT	umls:C0266313	CLINVAR	NA	0.480271442	NA	AGT	1	230703309	A	-
rs397514687	NA	185	AGTR1	umls:C0266313	CLINVAR	NA	0.48	NA	AGTR1	3	148741411	C	T
rs397514688	NA	1636	ACE	umls:C0266313	CLINVAR	NA	0.360814326	NA	ACE	17	63483172	C	T
rs397514689	NA	1636	ACE	umls:C0266313	CLINVAR	NA	0.360814326	NA	ACE	17	63488713	C	T
rs397514690	NA	5972	REN	umls:C0266313	CLINVAR	NA	0.482171535	NA	REN	1	204162135	G	A
rs397514691	NA	5972	REN	umls:C0266313	CLINVAR	NA	0.482171535	NA	REN	1	204160648	G	T
rs398122935	NA	185	AGTR1	umls:C0266313	CLINVAR	NA	0.48	NA	AGTR1	3	148741286	G	A
rs74315283	NA	183	AGT	umls:C0266313	CLINVAR	NA	0.480271442	NA	AGT	1	230705933	C	T
rs797045079	NA	1636	ACE	umls:C0266313	CLINVAR	NA	0.360814326	NA	ACE	17	63477106	CTCGGGCCGCCGGGGGCCGG	-

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:0)
(Waiting for update.)

Chemical(Total Drugs:0)
(Waiting for update.)

FDA approved drug and dosage information(Total Drugs:0)
(Waiting for update.)

FDA labeling changes(Total Drugs:0)
(Waiting for update.)

Web
Analytics