PedAM

Pediatric Disease Annotations & Medicines


	niemann-pick disease, type b

Disease ID	1870
Disease	niemann-pick disease, type b
Synonym	niemann pick dis non neuronopathic type niemann pick dis type b niemann pick disease, non neuronopathic type niemann pick disease, type b niemann pick disease, visceral niemann pick's disease type b niemann picks dis type b niemann-pick disease non-neuropathic type niemann-pick disease type b niemann-pick disease, chronic non-neuronopathic niemann-pick disease, non-neuronopathic type niemann-pick disease, type b (disorder) niemann-pick disease, type b [disease/finding] niemann-pick disease, visceral niemann-pick's disease type b type b niemann pick dis type b niemann pick disease type b niemann-pick disease
Orphanet	ORPHANET:77293
OMIM	OMIM:607616
DOID	DOID:14504
ICD10	ICD10CM:E75.241
MeSH	D052537
SNOMED-CT	SNOMEDCT_US_2016_09_01:39390005
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:1) SMPD1 \| 6609 \| CLINVAR;CTD_human;ORPHANET;UNIPROT
Inferring Gene	(Waiting for update.)
Text Mined Gene	(Waiting for update.)
Locus	(Waiting for update.)

Disease ID	1870
Disease	niemann-pick disease, type b
Integrated Phenotype	HPO \| Name(Total Integrated Phenotypes:13) HP:0002155 \| Increased triglycerides HP:0001982 \| Sea-blue histiocytosis HP:0004322 \| Stature below 3rd percentile HP:0001744 \| Splenomegaly HP:0002207 \| Diffuse reticular or finely nodular infiltrations HP:0004333 \| Bone marrow foam cells HP:0003141 \| Hyperbetalipoproteinemia HP:0003609 \| Foam cells with lamellar inclusion bodies HP:0003233 \| Low HDL-cholesterol HP:0002205 \| Frequent respiratory infections HP:0001103 \| Macular abnormality HP:0002240 \| Enlarged liver HP:0002094 \| Dyspnea
Text Mined Phenotype	(Waiting for update.)

Disease ID	1870
Disease	niemann-pick disease, type b
Manually Symptom	(Waiting for update.)
Text Mined Symptom	(Waiting for update.)

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:24)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs120074117	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6394204	G	A,T
rs120074118	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6394539	CGC	-
rs120074122	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6391795	G	A
rs120074123	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6393278	A	G
rs120074124	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6391976	T	C
rs120074126	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6393620	C	T
rs120074127	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6393680	C	G,T
rs120074128	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6391945	C	A
rs182812968	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6393981	C	T
rs267607073	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6393667	C	A
rs281860677	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6391914	-	TCCCCGCA
rs398123474	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6393215	G	C
rs398123475	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6393652	T	G
rs398123476	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6393975	CT	-
rs398123478	23188845	6609	SMPD1	umls:C0268243	BeFree	R542X mutation in SMPD1 gene: genetically novel mutation with phenotypic features intermediate between type A and type B Niemann-Pick disease.	0.565167327	2014	SMPD1	11	6394335	C	T
rs398123478	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6394335	C	T
rs398123479	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6391822	G	C
rs727504165	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6391419	C	-
rs727504166	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6391540	T	C
rs727504167	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6391638	T	-
rs756366019	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6391623	-	C,T
rs769904764	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6394203	C	T
rs794727252	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6391850	TGTTGAGTGGGCTGGGCCCAGCC	-
rs794727780	NA	6609	SMPD1	umls:C0268243	CLINVAR	NA	0.565167327	NA	SMPD1	11	6394540	GCC	-

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:0)
(Waiting for update.)

Chemical(Total Drugs:0)
(Waiting for update.)

FDA approved drug and dosage information(Total Drugs:0)
(Waiting for update.)

FDA labeling changes(Total Drugs:0)
(Waiting for update.)