PedAM

Pediatric Disease Annotations & Medicines


	mucolipidosis iv

Disease ID	693
Disease	mucolipidosis iv
Definition	An autosomal recessive lysosomal storage disease caused by mutations in the MCOLN1 gene. It is characterized by psychomotor developmental delays and ophthalmologic abnormalities.
Synonym	defic dis ganglioside sialidase deficiency disease, ganglioside sialidase ganglioside sialidase defic dis ganglioside sialidase deficiency ganglioside sialidase deficiency (disorder) ganglioside sialidase deficiency disease ml iv ml4 mucolipidoses, type iv mucolipidosis type iv mucolipidosis, type iv sialolipidoses sialolipidosis type iv mucolipidoses type iv mucolipidosis
Orphanet	ORPHANET:578
OMIM	OMIM:252650
DOID	DOID:2368
ICD10	ICD10CM:E75.11
UMLS	C0238286
SNOMED-CT	SNOMEDCT_US_2016_09_01:111384001
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:1) MCOLN1 \| 57192 \| CLINVAR;ORPHANET;UNIPROT
Inferring Gene	Entrez_id \| Symbol \| Resource(Total Genes:1) 57192 \| MCOLN1 \| infer
Text Mined Gene	(Waiting for update.)
Locus	(Waiting for update.)

Disease ID	693
Disease	mucolipidosis iv
Integrated Phenotype	(Waiting for update.)
Text Mined Phenotype	(Waiting for update.)

Disease ID	693
Disease	mucolipidosis iv
Manually Symptom	UMLS \| Name(Total Manually Symptoms:1) C2598155 \| pain
Text Mined Symptom	(Waiting for update.)

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:25)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs104886461	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1;LOC105372261	19	7526759	A	G
rs121908371	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1	19	7528683	C	T
rs121908372	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1	19	7528920	G	T
rs121908373	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1;LOC105372261	19	7526505	C	T
rs121908374	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1	19	7529173	C	T
rs751298168	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	PNPLA6;MCOLN1	19	7533651	A	C,T
rs754097561	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1	19	7529689	G	A
rs755042147	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1	19	7528639	T	-
rs767122713	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1	19	7527877	A	C
rs797044817	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1	19	7529187	CTT	-
rs797044818	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1	19	7530332	A	G
rs797044819	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	PNPLA6;MCOLN1	19	7533562	G	-
rs797044820	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1;LOC105372261	19	7525092	AAGTTTCGAGCCAAGGGCCGCAAGCCCTGCAAGCT	TCA
rs797044821	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1;LOC105372261	19	7526828	CC	-
rs797044822	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1	19	7529176	-	T
rs797044823	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1	19	7530389	-	GGCCGCAGCAG
rs797044824	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1;LOC105372261	19	7526869	C	T
rs797044825	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1;LOC105372261	19	7526518	T	C
rs797044826	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1;LOC105372261	19	7526852	G	T
rs797044827	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1	19	7529693	T	C
rs797044828	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1	19	7530321	C	G
rs797044829	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1	19	7530314	G	A
rs797044830	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1;LOC105372261	19	7526503	TC	-
rs797044831	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	PNPLA6;MCOLN1	19	7533561	G	-
rs797044832	NA	57192	MCOLN1	umls:C0238286	CLINVAR	NA	0.452681823	NA	MCOLN1;LOC105372261	19	7525164	C	T

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:0)
(Waiting for update.)

Chemical(Total Drugs:0)
(Waiting for update.)

FDA approved drug and dosage information(Total Drugs:0)
(Waiting for update.)

FDA labeling changes(Total Drugs:0)
(Waiting for update.)