PedAM

Pediatric Disease Annotations & Medicines


	ischemic stroke

Disease ID	1033
Disease	ischemic stroke
Definition	A stroke is a medical emergency. There are two types - ischemic and hemorrhagic. Ischemic stroke is the most common type. It is usually caused by a blood clot that blocks or plugs a blood vessel in the brain. This keeps blood from flowing to the brain. Within minutes, brain cells begin to die. Another cause is stenosis, or narrowing of the artery. This can happen because of atherosclerosis, a disease in which plaque builds up inside your arteries. Transient ischemic attacks (TIAs) occur when the blood supply to the brain is interrupted briefly. Having a TIA can mean you are at risk for having a more serious stroke. Symptoms of stroke are Sudden numbness or weakness of the face, arm or leg (especially on one side of the body) Sudden confusion, trouble speaking or understanding speech Sudden trouble seeing in one or both eyes Sudden trouble walking, dizziness, loss of balance or coordination Sudden severe headache with no known cause It is important to treat strokes as quickly as possible. Blood thinners may be used to stop a stroke while it is happening by quickly dissolving the blood clot. Post-stroke rehabilitation can help people overcome disabilities caused by stroke damage. NIH: National Institute of Neurological Disorders and Stroke
Synonym	ischaemic stroke ischaemic strokes ischemic stroke (disorder) ischemic strokes stroke ischemic stroke, ischemic
OMIM	OMIM:601367
UMLS	C0948008
SNOMED-CT	SNOMEDCT_US_2016_09_01:422504002
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:193) C0011847 \| diabetes \| 35 C0004153 \| atherosclerosis \| 29 C0020538 \| hypertension \| 20 C0028790 \| cerebral artery occlusion \| 15 C0149931 \| migraine \| 14 C0040053 \| thrombus \| 11 C0042373 \| vascular disease \| 10 C0011860 \| type 2 diabetes \| 10 C0020456 \| hyperglycemia \| 9 C0003537 \| aphasia \| 9 C0011849 \| diabetes mellitus \| 9 C0520679 \| obstructive sleep apnea \| 8 C0037315 \| sleep apnea \| 8 C0007282 \| carotid stenosis \| 8 C0948265 \| metabolic syndrome \| 8 C0032285 \| pneumonia \| 7 C0016522 \| patent foramen ovale \| 7 C0010068 \| coronary artery disease \| 6 C0040053 \| thrombosis \| 6 C0007787 \| transient ischemic attack \| 6 C0018799 \| heart disease \| 6 C0014118 \| endocarditis \| 6 C0026654 \| moyamoya \| 5 C0007766 \| intracranial aneurysm \| 5 C0027051 \| myocardial infarction \| 5 C0852949 \| arteriopathy \| 5 C0011860 \| type 2 diabetes mellitus \| 5 C0007766 \| cranial aneurysm \| 5 C0022658 \| kidney disease \| 5 C0014121 \| infective endocarditis \| 5 C1561644 \| chronic kidney disease (ckd) \| 5 C0027051 \| myocardial infarct \| 5 C0022661 \| chronic kidney disease \| 5 C0007766 \| intracranial aneurysms \| 4 C0007785 \| cerebral infarct \| 4 C0022116 \| ischemia \| 4 C0751955 \| brain infarction \| 4 C0751955 \| brain infarct \| 4 C0155626 \| acute myocardial infarction \| 4 C0007787 \| transient ischemic attack (tia) \| 3 C0020443 \| hypercholesterolemia \| 3 C0028754 \| obesity \| 3 C0007282 \| carotid artery stenosis \| 3 C0085580 \| essential hypertension \| 3 C0018991 \| hemiplegia \| 3 C0238301 \| nasopharyngeal carcinoma \| 3 C0002871 \| anemia \| 3 C0087086 \| thrombi \| 3 C0022658 \| renal disease \| 3 C0032285 \| pneumoniae \| 3 C0025289 \| meningitis \| 3 C0043117 \| idiopathic thrombocytopenic purpura \| 3 C0007785 \| cerebral infarction \| 3 C0022661 \| end-stage renal disease \| 3 C0034065 \| pulmonary embolism \| 3 C0007222 \| cardiovascular disease \| 3 C0852949 \| arterial disease \| 3 C0026654 \| moyamoya disease \| 3 C0007273 \| carotid artery disease \| 3 C0039263 \| takayasu's arteritis \| 2 C0497327 \| dementia \| 2 C0042373 \| vascular disorders \| 2 C0007785 \| cerebral ischemia \| 2 C0017636 \| glioblastomas \| 2 C0002395 \| alzheimer's disease \| 2 C0917996 \| cerebral aneurysm \| 2 C0032461 \| polycythemia \| 2 C0242666 \| protein s deficiency \| 2 C0014544 \| epilepsy \| 2 C0033687 \| proteinuria \| 2 C1704436 \| peripheral arterial disease \| 2 C0302592 \| cervical ca \| 2 C0042870 \| vitamin d defic \| 2 C0002986 \| fabry disease \| 2 C0031090 \| periodontal disease \| 2 C0242379 \| lung cancer \| 2 C0020635 \| hypopituitarism \| 2 C0039445 \| hereditary hemorrhagic telangiectasia \| 2 C0042373 \| angiopathy \| 2 C0016052 \| fibromuscular dysplasia \| 2 C0010346 \| crohn's disease \| 2 C1527311 \| brain edema \| 2 C0038220 \| status epilepticus \| 2 C0272286 \| immune thrombocytopenia \| 2 C0409974 \| lupus erythematosus \| 2 C0042870 \| vitamin d deficiency \| 2 C0154723 \| migraine with aura \| 2 C0014122 \| infectious endocarditis \| 2 C0011570 \| depression \| 2 C0042373 \| vascular disorder \| 2 C0042373 \| vascular diseases \| 2 C0010068 \| coronary heart disease \| 2 C1527390 \| intracranial neoplasms \| 2 C0338585 \| carotid artery dissection \| 2 C0398623 \| hypercoagulable state \| 2 C0007787 \| transient ischemic attacks \| 2 C0008148 \| chlamydia \| 2 C0024141 \| systemic lupus erythematosus \| 2 C0035439 \| rheumatic heart disease \| 2 C0878544 \| cardiomyopathy \| 1 C0271650 \| prediabetes \| 1 C0162316 \| iron deficiency anemia \| 1 C0008728 \| churg-strauss syndrome \| 1 C0018991 \| hemiplegias \| 1 C0019880 \| homocystinuria \| 1 C0155733 \| aortic atherosclerosis \| 1 C1621895 \| adrenal hyperplasia \| 1 C0007222 \| cardiovascular diseases \| 1 C0263401 \| cutis marmorata \| 1 C0002895 \| sickle cell anemia \| 1 C0039483 \| giant cell arteritis \| 1 C0026848 \| myopathies \| 1 C0023487 \| acute promyelocytic leukemia \| 1 C0032463 \| polycythemia vera \| 1 C0009782 \| connective tissue disease \| 1 C0159069 \| impaired glucose tolerance \| 1 C0014038 \| encephalitis \| 1 C0431399 \| joubert syndrome \| 1 C0018799 \| cardiac disease \| 1 C0020443 \| elevated cholesterol \| 1 C0018799 \| cardiopathy \| 1 C0007775 \| cerebral atherosclerosis \| 1 C0024623 \| gastric cancer \| 1 C0020550 \| hyperthyroidism \| 1 C0035328 \| retinal vein occlusion \| 1 C0023890 \| cirrhosis \| 1 C0009324 \| ulcerative colitis \| 1 C0085278 \| antiphospholipid syndrome \| 1 C0221390 \| nonbacterial thrombotic endocarditis \| 1 C0021053 \| immune dysfunction \| 1 C0154723 \| migraine aura \| 1 C0015458 \| parry-romberg syndrome \| 1 C1527390 \| intracranial tumors \| 1 C0022660 \| acute renal failure \| 1 C0018801 \| cardiac failure \| 1 C0085437 \| bacterial meningitis \| 1 C0024110 \| pulmonary abscess \| 1 C0007682 \| cns diseases \| 1 C0398623 \| hypercoagulability \| 1 C0026266 \| mitral regurgitation \| 1 C0003467 \| anxiety \| 1 C0013421 \| dystonia \| 1 C0085655 \| polymyositis \| 1 C0020676 \| hypothyroidism \| 1 C1384514 \| primary aldosteronism \| 1 C0040127 \| thyrotoxic crisis \| 1 C0851578 \| sleep disorders \| 1 C0007682 \| cns disease \| 1 C0002965 \| unstable angina \| 1 C0023895 \| liver disease \| 1 C0012739 \| disseminated intravascular coagulation (dic) \| 1 C0038019 \| spondylosis \| 1 C1621958 \| glioblastoma multiforme \| 1 C0032290 \| aspiration pneumonia \| 1 C0017636 \| glioblastoma \| 1 C0039446 \| telangiectasia \| 1 C0740392 \| middle cerebral artery infarction \| 1 C0026848 \| myopathy \| 1 C0002895 \| sickle-cell disease \| 1 C0040028 \| essential thrombocythemia \| 1 C0598608 \| hyperhomocysteinemia \| 1 C0037315 \| sleep disordered breathing \| 1 C0751651 \| mitochondrial disease \| 1 C0282488 \| interstitial cystitis \| 1 C1704437 \| respiratory distress syndrome \| 1 C1861784 \| cerebral cavernous malformations \| 1 C1140680 \| ovarian cancer \| 1 C0023890 \| liver cirrhosis \| 1 C0012739 \| disseminated intravascular coagulation \| 1 C1565489 \| renal insufficiency \| 1 C0021831 \| bowel disease \| 1 C0159020 \| neonatal seizures \| 1 C0019937 \| horner's syndrome \| 1 C1140680 \| ovarian ca \| 1 C0007847 \| cervical cancer \| 1 C0035078 \| renal failure \| 1 C1527390 \| intracranial tumor \| 1 C0009319 \| colitis \| 1 C0024266 \| lymphocytic meningitis \| 1 C1960469 \| left ventricular noncompaction \| 1 C0041296 \| tuberculosis \| 1 C0026265 \| mitral valve disease \| 1 C0751651 \| mitochondrial diseases \| 1 C0155502 \| benign paroxysmal positional vertigo \| 1 C0836924 \| thrombocytosis \| 1 C0025322 \| premature menopause \| 1 C0035222 \| acute respiratory distress syndrome \| 1 C1527311 \| brain oedema \| 1 C0008049 \| varicella \| 1 C0036421 \| systemic sclerosis \| 1 C0003507 \| aortic stenosis \| 1 C0007786 \| brain ischemia \| 1 C0024796 \| marfan syndrome \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:3) PARK7 \| 11315 \| GWASCAT SPSB4 \| 92369 \| GWASCAT NAA25 \| 80018 \| GWASCAT
Inferring Gene	Entrez_id \| Symbol \| Resource(Total Genes:59) 348 \| APOE \| infer 3553 \| IL1B \| infer 2162 \| F13A1 \| infer 2147 \| F2 \| infer 2153 \| F5 \| infer 3552 \| IL1A \| infer 3569 \| IL6 \| infer 5144 \| PDE4D \| infer 5175 \| PECAM1 \| infer 1636 \| ACE \| infer 11093 \| ADAMTS13 \| infer 241 \| ALOX5AP \| infer 116519 \| APOA5 \| infer 11132 \| CAPN10 \| infer 6347 \| CCL2 \| infer 929 \| CD14 \| infer 1401 \| CRP \| infer 2053 \| EPHX2 \| infer 2161 \| F12 \| infer 2155 \| F7 \| infer 2243 \| FGA \| infer 2244 \| FGB \| infer 2811 \| GP1BA \| infer 2878 \| GPX3 \| infer 3091 \| HIF1A \| infer 3106 \| HLA-B \| infer 3119 \| HLA-DQB1 \| infer 3122 \| HLA-DRA \| infer 3123 \| HLA-DRB1 \| infer 3303 \| HSPA1A \| infer 3304 \| HSPA1B \| infer 3305 \| HSPA1L \| infer 3383 \| ICAM1 \| infer 3557 \| IL1RN \| infer 3673 \| ITGA2 \| infer 3674 \| ITGA2B \| infer 3675 \| ITGA3 \| infer 3676 \| ITGA4 \| infer 3690 \| ITGB3 \| infer 9365 \| KL \| infer 4282 \| MIF \| infer 4314 \| MMP3 \| infer 4524 \| MTHFR \| infer 4846 \| NOS3 \| infer 4883 \| NPR3 \| infer 4973 \| OLR1 \| infer 5327 \| PLAT \| infer 5444 \| PON1 \| infer 5445 \| PON2 \| infer 5446 \| PON3 \| infer 8858 \| PROZ \| infer 6401 \| SELE \| infer 6403 \| SELP \| infer 5265 \| SERPINA1 \| infer 5054 \| SERPINE1 \| infer 6532 \| SLC6A4 \| infer 6548 \| SLC9A1 \| infer 7099 \| TLR4 \| infer 7124 \| TNF \| infer
Text Mined Gene	(Waiting for update.)
Locus	(Waiting for update.)

Disease ID	1033
Disease	ischemic stroke
Integrated Phenotype	HPO \| Name(Total Integrated Phenotypes:1) HP:0001297 \| Cerebral vascular events
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:170) HP:0005110 \| Atrial fibrillation \| 123 HP:0001297 \| Cerebral vascular events \| 92 HP:0002621 \| Atherosclerosis \| 29 HP:0000822 \| Hypertension \| 20 HP:0002326 \| TIA \| 15 HP:0002076 \| Migraine headaches \| 14 HP:0002170 \| Intracranial hemorrhage \| 12 HP:0100546 \| Narrowing of carotid artery \| 11 HP:0003074 \| High blood glucose \| 9 HP:0000819 \| Diabetes mellitus \| 9 HP:0001269 \| Hemiparesis \| 9 HP:0000969 \| Dropsy \| 9 HP:0002381 \| Aphasia \| 9 HP:0001250 \| Seizures \| 9 HP:0001342 \| Intracerebral hemorrhage \| 8 HP:0012474 \| Obstructed carotid artery \| 8 HP:0002870 \| Obstructive sleep apnea \| 8 HP:0010535 \| Sleep apnea \| 8 HP:0002090 \| Pneumonia \| 7 HP:0001655 \| Patent foramen ovale \| 7 HP:0004944 \| Cerebral artery aneurysm \| 7 HP:0001677 \| Coronary artery disease \| 6 HP:0100543 \| Cognitive deficits \| 6 HP:0002315 \| Headaches \| 6 HP:0002647 \| Aortic dissection \| 6 HP:0002617 \| Aneurysmal dilatation \| 6 HP:0012622 \| Chronic kidney disease \| 5 HP:0002459 \| Dysautonomia \| 5 HP:0100545 \| Arterial stenosis \| 5 HP:0002104 \| Absence of spontaneous respiration \| 5 HP:0006689 \| Bacterial endocarditis \| 5 HP:0004757 \| Paroxysmal atrial fibrillation \| 5 HP:0012493 \| Middle cerebral artery stenosis \| 4 HP:0100584 \| Endocarditis \| 4 HP:0002045 \| Abnormally low body temperature \| 4 HP:0002181 \| Cerebral edema \| 4 HP:0001907 \| Thromboembolic disease \| 4 HP:0001658 \| Myocardial infarction \| 4 HP:0011675 \| Arrhythmias \| 4 HP:0012492 \| Cerebral artery stenosis \| 4 HP:0002180 \| Neurodegeneration \| 4 HP:0011672 \| Cardiac myxoma \| 4 HP:0004950 \| Peripheral artery disease \| 3 HP:0001903 \| Anemia \| 3 HP:0003774 \| End-stage renal failure \| 3 HP:0001695 \| Cardiac arrest \| 3 HP:0001298 \| Encephalopathy \| 3 HP:0002138 \| Subarachnoid hemorrhage \| 3 HP:0002615 \| Low blood pressure \| 3 HP:0002637 \| Brain ischemia \| 3 HP:0003124 \| Elevated serum cholesterol \| 3 HP:0005294 \| Arterial dissection \| 3 HP:0001513 \| Obesity \| 3 HP:0002301 \| Hemiplegia \| 3 HP:0000855 \| Insulin resistance \| 3 HP:0002204 \| Pulmonary embolism \| 3 HP:0030890 \| White matter hyperintensity \| 3 HP:0001268 \| Mental deterioration \| 3 HP:0002077 \| Migraine with aura \| 2 HP:0030731 \| Carcinoma \| 2 HP:0004754 \| Permanent atrial fibrillation \| 2 HP:0001973 \| Autoimmune thrombocytopenia \| 2 HP:0001712 \| Left ventricular hypertrophy \| 2 HP:0030692 \| Brain tumor \| 2 HP:0000716 \| Depression \| 2 HP:0003077 \| Hyperlipidemia \| 2 HP:0030516 \| Homonymous hemianopia \| 2 HP:0002902 \| Hyponatremia \| 2 HP:0001681 \| Angina pectoris \| 2 HP:0002171 \| Cerebral gliosis \| 2 HP:0000083 \| Renal insufficiency \| 2 HP:0001287 \| Meningitis \| 2 HP:0100280 \| Morbus Crohn \| 2 HP:0012158 \| Carotid artery dissection \| 2 HP:0002725 \| Systemic lupus erythematosus \| 2 HP:0012377 \| Hemianopia \| 2 HP:0001901 \| Abnormally shaped erythrocytes \| 2 HP:0040075 \| Hypopituitarism \| 2 HP:0100512 \| Vitamin D deficiency \| 2 HP:0000093 \| Proteinuria \| 2 HP:0001714 \| Ventricular hypertrophy \| 2 HP:0002500 \| Leukoaraiosis \| 2 HP:0001717 \| Coronary artery calcification \| 2 HP:0001257 \| Spasticity \| 2 HP:0002133 \| Status epilepticus \| 2 HP:0000726 \| Dementia \| 2 HP:0004947 \| Arteriovenous fistula \| 1 HP:0002156 \| High urine homocystine levels \| 1 HP:0100279 \| Ulcerative colitis \| 1 HP:0001945 \| Fever \| 1 HP:0011099 \| Spastic hemiparesis \| 1 HP:0001645 \| Sudden cardiac death \| 1 HP:0008480 \| Neck arthritis \| 1 HP:0001694 \| Right-to-left shunt \| 1 HP:0001664 \| Torsade de pointes \| 1 HP:0000965 \| Livedo reticularis \| 1 HP:0002721 \| Immunodeficiency \| 1 HP:0004836 \| Acute promyelocytic leukemia \| 1 HP:0008221 \| Enlarged adrenal glands \| 1 HP:0001650 \| Valvular aortic stenosis \| 1 HP:0003613 \| Antiphospholipid antibodies \| 1 HP:0007201 \| Cerebral artery atherosclerosis \| 1 HP:0001638 \| Cardiomyopathy \| 1 HP:0005521 \| Disseminated intravascular coagulation \| 1 HP:0012531 \| Pain \| 1 HP:0006986 \| Uncontrollable movement in upper arms \| 1 HP:0012397 \| Atherosclerotic changes of aorta \| 1 HP:0002098 \| Respiratory distress \| 1 HP:0000836 \| Overactive thyroid \| 1 HP:0012159 \| Internal carotid artery dissection \| 1 HP:0002529 \| Neuronal loss in central nervous system \| 1 HP:0005303 \| Aortic arch calcification \| 1 HP:0012164 \| Asterixis \| 1 HP:0009908 \| Earlobe crease \| 1 HP:0012126 \| Gastric cancer \| 1 HP:0000078 \| Genital abnormalities \| 1 HP:0001919 \| Acute renal failure \| 1 HP:0100665 \| Angiooedema \| 1 HP:0000158 \| Abnormally large tongue \| 1 HP:0012378 \| Fatigue \| 1 HP:0001009 \| Telangiectases \| 1 HP:0001332 \| Dystonia \| 1 HP:0011899 \| Hyperfibrinogenemia \| 1 HP:0000573 \| Retinal hemorrhage \| 1 HP:0002625 \| Blood clot in a deep vein \| 1 HP:0002835 \| Aspiration \| 1 HP:0010523 \| Alexia \| 1 HP:0002583 \| Colitis \| 1 HP:0002015 \| Swallowing difficulty \| 1 HP:0012048 \| Oromandibular dystonia \| 1 HP:0001394 \| Hepatic cirrhosis \| 1 HP:0006699 \| Ectopic supraventricular rhythms \| 1 HP:0003198 \| Myopathic changes \| 1 HP:0002155 \| Increased triglycerides \| 1 HP:0012735 \| Coughing \| 1 HP:0100724 \| Hypercoagulability \| 1 HP:0100806 \| Sepsis \| 1 HP:0011951 \| Aspiration pneumonia \| 1 HP:0002664 \| Neoplasia \| 1 HP:0001891 \| Iron-deficiency anemia \| 1 HP:0003690 \| Limb weakness \| 1 HP:0005184 \| Prolonged QTc interval \| 1 HP:0001397 \| Hepatic steatosis \| 1 HP:0001278 \| Orthostatic hypotension \| 1 HP:0002427 \| Loss of expressive speech \| 1 HP:0003207 \| Arterial calcification \| 1 HP:0000821 \| Underactive thyroid \| 1 HP:0004420 \| Arterial thrombosis \| 1 HP:0011968 \| Feeding difficulties \| 1 HP:0012520 \| Dilatation of Virchow-Robin spaces \| 1 HP:0100843 \| Glioblastoma \| 1 HP:0005202 \| Helicobacter pylori infection \| 1 HP:0002277 \| Horner's syndrome \| 1 HP:0001894 \| Thrombocytosis \| 1 HP:0001653 \| Mitral valve insufficiency \| 1 HP:0003287 \| Abnormality of mitochondrial metabolism \| 1 HP:0004936 \| Blood clot in vein \| 1 HP:0002321 \| Vertigo \| 1 HP:0012174 \| Glioblastoma multiforme \| 1 HP:0012636 \| Retinal vein occlusion \| 1 HP:0002344 \| Progressive neurologic deterioration \| 1 HP:0000833 \| Glucose intolerance \| 1 HP:0001279 \| Syncope \| 1 HP:0100785 \| Insomnia \| 1 HP:0000739 \| Anxiety \| 1 HP:0004322 \| Stature below 3rd percentile \| 1 HP:0005305 \| Cerebral vein thrombosis \| 1 HP:0012089 \| Arteritis \| 1 HP:0001259 \| Coma \| 1 HP:0030682 \| Left ventricular noncompaction \| 1

Disease ID	1033
Disease	ischemic stroke
Manually Symptom	(Waiting for update.)
Text Mined Symptom	UMLS \| Name \| Sentences' Count(Total Symptoms:47) C0019080 \| hemorrhage \| 32 C0004153 \| atherosclerosis \| 29 C0020538 \| hypertension \| 20 C0021308 \| infarction \| 20 C0149931 \| migraine \| 14 C0009450 \| infection \| 10 C0013922 \| embolism \| 10 C0020456 \| hyperglycemia \| 9 C0003537 \| aphasia \| 9 C0037315 \| sleep apnea \| 8 C0007282 \| carotid stenosis \| 8 C0520679 \| obstructive sleep apnea \| 8 C0032285 \| pneumonia \| 7 C0016522 \| patent foramen ovale \| 7 C0010068 \| coronary artery disease \| 6 C0040053 \| thrombosis \| 6 C0751007 \| intracranial atherosclerosis \| 5 C0577631 \| carotid atherosclerosis \| 5 C1839611 \| n syndrome \| 5 C0007785 \| cerebral infarct \| 4 C0022116 \| ischemia \| 4 C0020672 \| hypothermia \| 4 C0007273 \| carotid artery disease \| 3 C0002940 \| aneurysms \| 3 C0087086 \| thrombi \| 3 C0007282 \| carotid artery stenosis \| 3 C0034065 \| pulmonary embolism \| 3 C0155626 \| acute myocardial infarction \| 3 C0032285 \| pneumoniae \| 3 C0040038 \| thromboembolism \| 3 C0011570 \| depression \| 2 C0497327 \| dementia \| 2 C0398623 \| thrombophilias \| 2 C0021311 \| infections \| 2 C0007785 \| cerebral ischemia \| 2 C1527311 \| brain edema \| 2 C0848782 \| urological impairment \| 2 C0007780 \| cerebral embolism \| 2 C0155733 \| aortic atherosclerosis \| 1 C1096584 \| chlamydia pneumoniae infection \| 1 C0011168 \| dysphagia \| 1 C0598608 \| hyperhomocysteinemia \| 1 C1402315 \| vascular lesions \| 1 C1695782 \| cerebral hypoperfusion \| 1 C0035078 \| renal failure \| 1 C0917801 \| insomnia \| 1 C0012739 \| disseminated intravascular coagulation \| 1

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:280)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs10204475	19910543	130507	UBR3	umls:C0948008	BeFree	In addition, both ZNF650 rs10204475 and intergenic single nucleotide polymorphism rs10486776 were associated with ischemic stroke as well as independent of traditional cardiovascular risk factors in dominant models (OR=1.47, 95% CI=1.12 to 1.96, P=0.005, q=0.040 and OR=1.53, 95% CI=1.15 to 2.02, P=0.003, q=0.036, respectively).	0.000271442	2010	UBR3	2	170076012	T	G
rs10486776	19910543	130507	UBR3	umls:C0948008	BeFree	In addition, both ZNF650 rs10204475 and intergenic single nucleotide polymorphism rs10486776 were associated with ischemic stroke as well as independent of traditional cardiovascular risk factors in dominant models (OR=1.47, 95% CI=1.12 to 1.96, P=0.005, q=0.040 and OR=1.53, 95% CI=1.15 to 2.02, P=0.003, q=0.036, respectively).	0.000271442	2010	LOC101927558	7	15703161	G	A
rs10489177	24122314	92342	METTL18	umls:C0948008	BeFree	In the initial exome sequencing analysis, rs10489177 in c1orf156 gene located on chromosome 1q24 (p < 1 × 10(-8)) and rs17118 in XYLB gene located on chromosome 3p21 (p < 1 × 10(-6)) were found to be significantly associated with IS.	0.000271442	2013	C1orf112;METTL18	1	169793666	T	G
rs10489177	24122314	9942	XYLB	umls:C0948008	BeFree	In the initial exome sequencing analysis, rs10489177 in c1orf156 gene located on chromosome 1q24 (p < 1 × 10(-8)) and rs17118 in XYLB gene located on chromosome 3p21 (p < 1 × 10(-6)) were found to be significantly associated with IS.	0.000271442	2013	C1orf112;METTL18	1	169793666	T	G
rs1062708	19403135	10856	RUVBL2	umls:C0948008	BeFree	After DNA sequencing of linkage disequilibrium blocks containing these SNPs, three tag SNPs (rs6007897 of CELSR1, rs1671021 of LLGL2, and rs1062708 of RUVBL2) and a nonsynonymous SNP (rs4044210 of CELSR1) were examined for their relation to ischemic stroke in subject panels B and C. Both rs6007897 (A-->G, Thr2268Ala) and rs4044210 (A-->G, Ile2107Val) of CELSR1 as well as rs1671021 (T-->C, Phe479Leu) of LLGL2 were significantly associated with ischemic stroke in subject panel B.	0.000542884	2009	RUVBL2;MIR6798	19	49010016	C	G,T
rs1062708	19403135	3993	LLGL2	umls:C0948008	BeFree	After DNA sequencing of linkage disequilibrium blocks containing these SNPs, three tag SNPs (rs6007897 of CELSR1, rs1671021 of LLGL2, and rs1062708 of RUVBL2) and a nonsynonymous SNP (rs4044210 of CELSR1) were examined for their relation to ischemic stroke in subject panels B and C. Both rs6007897 (A-->G, Thr2268Ala) and rs4044210 (A-->G, Ile2107Val) of CELSR1 as well as rs1671021 (T-->C, Phe479Leu) of LLGL2 were significantly associated with ischemic stroke in subject panel B.	0.000542884	2009	RUVBL2;MIR6798	19	49010016	C	G,T
rs10744777	25031287	79513	OR10R1P	umls:C0948008	BeFree	In an overall analysis of 17,970 cases of ischemic stroke and 70,764 controls, we identified a novel association on chromosome 12q24 (rs10744777, odds ratio [OR] 1.10 [1.07-1.13], p = 7.12 × 10(-11)) with ischemic stroke.	0.000271442	2014	ALDH2	12	111795214	T	C
rs10757274	19559344	1030	CDKN2B	umls:C0948008	BeFree	In a hospital based case control study, we investigated the association of cyclin-dependent kinase inhibitor 2A (CDKN2A) gene, cyclin-dependent kinase inhibitor 2B (CDKN2B) gene, and two genetic variants (rs10757274 and rs2383206) on chromosome region 9p21 with ischemic stroke in Chinese Hans.	0.000271442	2009	CDKN2B-AS1	9	22096056	A	G
rs10757274	19559344	1033	CDKN3	umls:C0948008	BeFree	In a hospital based case control study, we investigated the association of cyclin-dependent kinase inhibitor 2A (CDKN2A) gene, cyclin-dependent kinase inhibitor 2B (CDKN2B) gene, and two genetic variants (rs10757274 and rs2383206) on chromosome region 9p21 with ischemic stroke in Chinese Hans.	0.000271442	2009	CDKN2B-AS1	9	22096056	A	G
rs10757274	19559344	1029	CDKN2A	umls:C0948008	BeFree	In a hospital based case control study, we investigated the association of cyclin-dependent kinase inhibitor 2A (CDKN2A) gene, cyclin-dependent kinase inhibitor 2B (CDKN2B) gene, and two genetic variants (rs10757274 and rs2383206) on chromosome region 9p21 with ischemic stroke in Chinese Hans.	0.000542884	2009	CDKN2B-AS1	9	22096056	A	G
rs10757274	20031580	4185	ADAM11	umls:C0948008	BeFree	We found a modest increase in ischemic stroke risk for 2 common (minor allele frequencies 0.46 to 0.49) variants, rs2383207 (P=0.04 in Lund Stroke Register, P=0.01 in MDC) and rs10757274 (P=0.03 in Lund Stroke Register, P=0.03 in MDC), in each sample independently.	0.000271442	2009	CDKN2B-AS1	9	22096056	A	G
rs10947803	19647252	3613	IMPA2	umls:C0948008	BeFree	In a preliminary analysis of 268 controls and 531 IS cases, the rs10947803 SNP of KCNK17 (p=0.012) and the rs7506045 of IMPA2 (p=0.040) were associated with IS, although only the KCNK17 gene was an independent risk factor for IS.	0.000271442	2010	NA	NA	NA	NA	NA
rs10947803	23391755	89822	KCNK17	umls:C0948008	BeFree	The rs10947803 SNP of KCNK17 is associated with cerebral hemorrhage but not ischemic stroke in a Chinese population.	0.001085767	2013	NA	NA	NA	NA	NA
rs11053646	17022953	4973	OLR1	umls:C0948008	BeFree	G501C polymorphism of oxidized LDL receptor gene (OLR1) and ischemic stroke.	0.002909916	2006	OLR1	12	10160849	C	G
rs11053646	17022953	3949	LDLR	umls:C0948008	BeFree	G501C polymorphism of oxidized LDL receptor gene (OLR1) and ischemic stroke.	0.000542884	2006	OLR1	12	10160849	C	G
rs1122608	24190014	10569	SLU7	umls:C0948008	BeFree	This is the first study that demonstrates that rs1122608 confers protection against ischemic stroke and implicates splicing factor SFSR3 in the disease process.	0.000271442	2013	SMARCA4	19	11052925	G	T
rs1130864	23980698	1401	CRP	umls:C0948008	BeFree	Our study indicates that SNP rs1130864 in the CRP gene is an independent predictor of 3-month functional outcome in patients with first-onset IS in a Han Chinese population.	0.01198705	2013	CRP	1	159713301	G	A
rs11614913	24178064	5018	OXA1L	umls:C0948008	BeFree	We evaluated the associations of the hsa-mir-196-a2/rs11614913 T/C, hsa-mir-146a/rs2910164 C/G, and hsa-mir-499/rs3746444 A/G polymorphisms in pre-miRNAs with the risk of ischemic stroke in a Chinese population.	0.000271442	2013	MIR196A2	12	53991815	C	T
rs11614913	25658319	574501	MIR499A	umls:C0948008	BeFree	Using the TaqMan assay, we evaluated the association of hsa-miR-146a/rs2910164, hsa-miR-196a2/rs11614913, and hsa-miR-499/rs3746444 polymorphisms with the risk of ischemic stroke in a Chinese population with 531 ischemic stroke patients and 531 control subjects.	0.000814326	2014	MIR196A2	12	53991815	C	T
rs11614913	24178064	406938	MIR146A	umls:C0948008	BeFree	We evaluated the associations of the hsa-mir-196-a2/rs11614913 T/C, hsa-mir-146a/rs2910164 C/G, and hsa-mir-499/rs3746444 A/G polymorphisms in pre-miRNAs with the risk of ischemic stroke in a Chinese population.	0.001085767	2013	MIR196A2	12	53991815	C	T
rs11712619	20107840	54763	ROPN1	umls:C0948008	BeFree	One SNP (rs4499545) in the ROPN1-KALRN intergenic region and two SNPs in KALRN (rs17286604 and rs11712619) showed significant (P < 0.05) allelic and genotypic (unadjusted and adjusted for hypertension, diabetes, and ever smoking) association with IS risk.	0.000271442	2010	KALRN	3	124300955	C	T
rs11833579	22297388	4815	NINJ2	umls:C0948008	BeFree	Association between 12p13 SNPs rs11833579/rs12425791 near NINJ2 gene and ischemic stroke in East Asian population: evidence from a meta-analysis.	0.002171535	2012	NA	12	666033	G	A
rs11833579	25096477	4815	NINJ2	umls:C0948008	BeFree	A GWAS found that the single-nucleotide polymorphism rs11833579 near the NINJ2 gene on chromosome 12p13 was associated with an increased risk of ischemic stroke in Caucasians in 2009.	0.002171535	2014	NA	12	666033	G	A
rs11833579	24664524	5583	PRKCH	umls:C0948008	BeFree	Significant allelic association was identified between NINJ2 gene rs11833579 (P = 0.008), protein kinase C η gene rs2230501 (P = 0.039) and IS.	0.001628651	2015	NA	12	666033	G	A
rs11833579	21376321	4815	NINJ2	umls:C0948008	BeFree	No evidence for association of 12p13 SNPs rs11833579 and rs12425791 within NINJ2 gene with ischemic stroke in Chinese Han population.	0.002171535	2011	NA	12	666033	G	A
rs11833579	22795341	4815	NINJ2	umls:C0948008	BeFree	In 2009, a GWAS has confirmed that rs11833579 and rs12425791 near the NINJ2 gene could increase the stroke and ischemic stroke (IS) risk.	0.002171535	2012	NA	12	666033	G	A
rs12130333	21691831	27329	ANGPTL3	umls:C0948008	BeFree	Here, we examined three SNPs, rs12130333 located within the ANGPTL3 locus; rs16996148 residing at the CILP2 gene locus; and rs17321515 at the TRIB1 locus, which were originally reported in association with decreased triglyceride levels; therefore, we investigated their possible protective effect against the development of ischemic stroke.	0.000271442	2011	NA	1	62726106	C	T
rs12130333	21691831	148113	CILP2	umls:C0948008	BeFree	Here, we examined three SNPs, rs12130333 located within the ANGPTL3 locus; rs16996148 residing at the CILP2 gene locus; and rs17321515 at the TRIB1 locus, which were originally reported in association with decreased triglyceride levels; therefore, we investigated their possible protective effect against the development of ischemic stroke.	0.000271442	2011	NA	1	62726106	C	T
rs12188950	22274584	5144	PDE4D	umls:C0948008	BeFree	A large-sample assessment of possible association between ischaemic stroke and rs12188950 in the PDE4D gene.	0.031346637	2012	PDE4D;PART1	5	60487490	C	T
rs12342	25299095	79602	ADIPOR2	umls:C0948008	BeFree	The AA genotype and A allele of rs12342 in the adiponectin receptor 2 gene may increase the risk of ischemic stroke, particularly the risk of atherosclerosis cerebral infarction.	0.000271442	2015	ADIPOR2	12	1787714	C	T
rs12425791	21376321	4815	NINJ2	umls:C0948008	BeFree	No evidence for association of 12p13 SNPs rs11833579 and rs12425791 within NINJ2 gene with ischemic stroke in Chinese Han population.	0.002171535	2011	NA	12	674318	G	A,C
rs12425791	22795341	4815	NINJ2	umls:C0948008	BeFree	In 2009, a GWAS has confirmed that rs11833579 and rs12425791 near the NINJ2 gene could increase the stroke and ischemic stroke (IS) risk.	0.002171535	2012	NA	12	674318	G	A,C
rs12425791	22297388	4815	NINJ2	umls:C0948008	BeFree	Association between 12p13 SNPs rs11833579/rs12425791 near NINJ2 gene and ischemic stroke in East Asian population: evidence from a meta-analysis.	0.002171535	2012	NA	12	674318	G	A,C
rs12429692	23079278	4048	LTA4H	umls:C0948008	BeFree	In combined analysis of multiple genes and loci, individuals with ALOX5AP rs12429692 T allele, ALOX5 rs2029253 A allele, and LTA4H rs6538697 C allele suggested a significantly increased susceptibility to IS (adjusted OR, 1.70; 95% CI, 1.07-2.69; P=0.024).	0.000542884	2012	ALOX5AP	13	30738041	A	T
rs12429692	23079278	241	ALOX5AP	umls:C0948008	BeFree	In combined analysis of multiple genes and loci, individuals with ALOX5AP rs12429692 T allele, ALOX5 rs2029253 A allele, and LTA4H rs6538697 C allele suggested a significantly increased susceptibility to IS (adjusted OR, 1.70; 95% CI, 1.07-2.69; P=0.024).	0.009077134	2012	ALOX5AP	13	30738041	A	T
rs12429692	23079278	240	ALOX5	umls:C0948008	BeFree	In combined analysis of multiple genes and loci, individuals with ALOX5AP rs12429692 T allele, ALOX5 rs2029253 A allele, and LTA4H rs6538697 C allele suggested a significantly increased susceptibility to IS (adjusted OR, 1.70; 95% CI, 1.07-2.69; P=0.024).	0.003257302	2012	ALOX5AP	13	30738041	A	T
rs139564723	20130494	1579	CYP4A11	umls:C0948008	BeFree	We identified CYP4A11 C-296T and CYP4F2 V433M were associated with significantly increased risk of ischemic stroke (CT+TT vs. CC, adjusted odds ratio: 1.50, 95% confidence interval: 1.17-1.93, Pcombined=0.001, Pcorr=0.008; V/M+M/M vs. V/V, odds ratio: 1.38, 95% confidence interval: 1.15-1.65, Pcombined=5.6x10, Pcorr=0.005, respectively).	0.000271442	2010	CYP4A11	1	46941729	G	A
rs1401296	17677000	2153	F5	umls:C0948008	BeFree	As a single variant, PROC rs1401296, together with the F5 Leiden mutation, was associated with ischemic stroke events.	0.022812387	2007	LOC105373608	2	127431732	C	T
rs1406961	21779381	56955	MEPE	umls:C0948008	BeFree	Among migraineurs with aura rs7698623 in MEPE (OR = 6.37; 95% CI 3.15-12.90; p = 2.7×10(-7)) and rs4975709 in IRX4 (OR = 5.06; 95% CI 2.66-9.62; p = 7.7×10(-7)) appeared to be associated with ischemic stroke, rs2143678 located close to MDF1 with major CVD (OR = 3.05; 95% CI 1.98-4.69; p = 4.3×10(-7)), and the intergenic rs1406961 with CVD death (OR = 12.33; 95% CI 4.62-32.87; p = 5.2×10(-7)).	0.000542884	2011	NA	20	63264568	A	C
rs1406961	21779381	50805	IRX4	umls:C0948008	BeFree	Among migraineurs with aura rs7698623 in MEPE (OR = 6.37; 95% CI 3.15-12.90; p = 2.7×10(-7)) and rs4975709 in IRX4 (OR = 5.06; 95% CI 2.66-9.62; p = 7.7×10(-7)) appeared to be associated with ischemic stroke, rs2143678 located close to MDF1 with major CVD (OR = 3.05; 95% CI 1.98-4.69; p = 4.3×10(-7)), and the intergenic rs1406961 with CVD death (OR = 12.33; 95% CI 4.62-32.87; p = 5.2×10(-7)).	0.000271442	2011	NA	20	63264568	A	C
rs147377392	15574195	7056	THBD	umls:C0948008	BeFree	Using data from the Stroke Prevention in Young Women Study, we sought to determine the association between the Ala455Val thrombomodulin polymorphism and the occurrence of ischemic stroke in young women.	0.000542884	2004	THBD	20	23048144	A	G
rs1518111	23096091	3586	IL10	umls:C0948008	BeFree	To investigate whether IL10, IL10RA, and IL10RB polymorphisms are associated with the risk of ischemic stroke (IS), selected two IL10 SNPs (rs1518111 and rs1554286), three IL10RA SNPs (rs2256111, rs4252243, and rs2228054), and two IL10RB SNPs (rs999788 and rs2834167) were analyzed in 120 patients with IS and 285 control subjects.	0.002171535	2013	IL10	1	206771300	T	C
rs1524668	24727681	83882	TSPAN10	umls:C0948008	BeFree	When the IS patients were stratified according to their OCSP classification, the genotype frequencies of the ADAM17-rs1524668 polymorphism exhibited a significant association with the PACI subtype of IS.	0.000271442	2015	ADAM17	2	9557243	A	C
rs1554286	23096091	3586	IL10	umls:C0948008	BeFree	To investigate whether IL10, IL10RA, and IL10RB polymorphisms are associated with the risk of ischemic stroke (IS), selected two IL10 SNPs (rs1518111 and rs1554286), three IL10RA SNPs (rs2256111, rs4252243, and rs2228054), and two IL10RB SNPs (rs999788 and rs2834167) were analyzed in 120 patients with IS and 285 control subjects.	0.002171535	2013	IL10	1	206770888	A	G
rs161802	24262325	11315	PARK7	umls:C0948008	GWASCAT	Shared genetic susceptibility to ischemic stroke and coronary artery disease: a genome-wide analysis of common variants.	0.12	2014	PARK7	1	7982766	G	T
rs1654413	12871362	51206	GP6	umls:C0948008	BeFree	Collagen platelet receptor polymorphisms integrin alpha2beta1 C807T and GPVI Q317L and risk of ischemic stroke.	0.001085767	2003	GP6	19	55014991	A	T
rs1671021	19403135	3993	LLGL2	umls:C0948008	BeFree	After DNA sequencing of linkage disequilibrium blocks containing these SNPs, three tag SNPs (rs6007897 of CELSR1, rs1671021 of LLGL2, and rs1062708 of RUVBL2) and a nonsynonymous SNP (rs4044210 of CELSR1) were examined for their relation to ischemic stroke in subject panels B and C. Both rs6007897 (A-->G, Thr2268Ala) and rs4044210 (A-->G, Ile2107Val) of CELSR1 as well as rs1671021 (T-->C, Phe479Leu) of LLGL2 were significantly associated with ischemic stroke in subject panel B.	0.000542884	2009	LLGL2	17	75569090	T	C
rs1671021	21511255	10856	RUVBL2	umls:C0948008	BeFree	Our aim was to test the association of four polymorphisms (rs1671021 in LLGL2, rs753307 in RUVBL2, rs6007897 and rs4044210 in CELSR1) previously identified as ischemic stroke (IS) risk factors in a phased GWAS performed on 6341 Japanese individuals [1].	0.000542884	2011	LLGL2	17	75569090	T	C
rs1671021	21511255	3993	LLGL2	umls:C0948008	BeFree	Our aim was to test the association of four polymorphisms (rs1671021 in LLGL2, rs753307 in RUVBL2, rs6007897 and rs4044210 in CELSR1) previously identified as ischemic stroke (IS) risk factors in a phased GWAS performed on 6341 Japanese individuals [1].	0.000542884	2011	LLGL2	17	75569090	T	C
rs1671021	19403135	10856	RUVBL2	umls:C0948008	BeFree	After DNA sequencing of linkage disequilibrium blocks containing these SNPs, three tag SNPs (rs6007897 of CELSR1, rs1671021 of LLGL2, and rs1062708 of RUVBL2) and a nonsynonymous SNP (rs4044210 of CELSR1) were examined for their relation to ischemic stroke in subject panels B and C. Both rs6007897 (A-->G, Thr2268Ala) and rs4044210 (A-->G, Ile2107Val) of CELSR1 as well as rs1671021 (T-->C, Phe479Leu) of LLGL2 were significantly associated with ischemic stroke in subject panel B.	0.000542884	2009	LLGL2	17	75569090	T	C
rs16851055	24262325	92369	SPSB4	umls:C0948008	GWASCAT	Shared genetic susceptibility to ischemic stroke and coronary artery disease: a genome-wide analysis of common variants.	0.12	2014	SPSB4	3	141080371	G	A
rs16996148	21691831	27329	ANGPTL3	umls:C0948008	BeFree	Here, we examined three SNPs, rs12130333 located within the ANGPTL3 locus; rs16996148 residing at the CILP2 gene locus; and rs17321515 at the TRIB1 locus, which were originally reported in association with decreased triglyceride levels; therefore, we investigated their possible protective effect against the development of ischemic stroke.	0.000271442	2011	NA	19	19547663	G	T
rs16996148	21691831	148113	CILP2	umls:C0948008	BeFree	Here, we examined three SNPs, rs12130333 located within the ANGPTL3 locus; rs16996148 residing at the CILP2 gene locus; and rs17321515 at the TRIB1 locus, which were originally reported in association with decreased triglyceride levels; therefore, we investigated their possible protective effect against the development of ischemic stroke.	0.000271442	2011	NA	19	19547663	G	T
rs17110453	25839935	1558	CYP2C8	umls:C0948008	BeFree	CYP2C8 rs17110453 and EPHX2 rs751141 two-locus interaction increases susceptibility to ischemic stroke.	0.000542884	2015	CYP2C8	10	95069772	A	C
rs17110453	25839935	2053	EPHX2	umls:C0948008	BeFree	CYP2C8 rs17110453 and EPHX2 rs751141 two-locus interaction increases susceptibility to ischemic stroke.	0.003995683	2015	CYP2C8	10	95069772	A	C
rs17118	24122314	92342	METTL18	umls:C0948008	BeFree	In the initial exome sequencing analysis, rs10489177 in c1orf156 gene located on chromosome 1q24 (p < 1 × 10(-8)) and rs17118 in XYLB gene located on chromosome 3p21 (p < 1 × 10(-6)) were found to be significantly associated with IS.	0.000271442	2013	XYLB	3	38362981	C	A
rs17118	24122314	9942	XYLB	umls:C0948008	BeFree	In the initial exome sequencing analysis, rs10489177 in c1orf156 gene located on chromosome 1q24 (p < 1 × 10(-8)) and rs17118 in XYLB gene located on chromosome 3p21 (p < 1 × 10(-6)) were found to be significantly associated with IS.	0.000271442	2013	XYLB	3	38362981	C	A
rs17222919	21816595	240	ALOX5	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.003257302	2011	ALOX5AP	13	30734192	T	G
rs17222919	21816595	5743	PTGS2	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.002442977	2011	ALOX5AP	13	30734192	T	G
rs17222919	21816595	5742	PTGS1	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.001357209	2011	ALOX5AP	13	30734192	T	G
rs17222919	21816595	241	ALOX5AP	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.009077134	2011	ALOX5AP	13	30734192	T	G
rs17286604	20107840	54763	ROPN1	umls:C0948008	BeFree	One SNP (rs4499545) in the ROPN1-KALRN intergenic region and two SNPs in KALRN (rs17286604 and rs11712619) showed significant (P < 0.05) allelic and genotypic (unadjusted and adjusted for hypertension, diabetes, and ever smoking) association with IS risk.	0.000271442	2010	KALRN	3	124233370	C	T
rs17321515	21691831	148113	CILP2	umls:C0948008	BeFree	Here, we examined three SNPs, rs12130333 located within the ANGPTL3 locus; rs16996148 residing at the CILP2 gene locus; and rs17321515 at the TRIB1 locus, which were originally reported in association with decreased triglyceride levels; therefore, we investigated their possible protective effect against the development of ischemic stroke.	0.000271442	2011	LOC105375745	8	125474167	A	G
rs17321515	21691831	27329	ANGPTL3	umls:C0948008	BeFree	Here, we examined three SNPs, rs12130333 located within the ANGPTL3 locus; rs16996148 residing at the CILP2 gene locus; and rs17321515 at the TRIB1 locus, which were originally reported in association with decreased triglyceride levels; therefore, we investigated their possible protective effect against the development of ischemic stroke.	0.000271442	2011	LOC105375745	8	125474167	A	G
rs174546	25008580	80308	FLAD1	umls:C0948008	BeFree	For the 11% of the population homozygous for the minor T-allele of rs174546 that associates with lower ∆5 FADS activity, high ALA intake and ALA-to-LA intake ratio may be preferable in the prevention of CVD and ischemic stroke.	0.000271442	2014	FADS1	11	61802358	C	T
rs17696736	24262325	80018	NAA25	umls:C0948008	GWASCAT	Shared genetic susceptibility to ischemic stroke and coronary artery disease: a genome-wide analysis of common variants.	0.12	2014	NAA25	12	112049014	A	G
rs1799945	17389307	3077	HFE	umls:C0948008	BeFree	We tested the hypothesis that the HFE genotypes H63D/H63D, H63D/wild type, C282Y/H63D, C282Y/C282Y, and C282Y/wild type are risk factors for symptomatic carotid atherosclerosis, ischemic cerebrovascular disease (ICVD), and ischemic stroke.	0.000814326	2007	HFE	6	26090951	C	G
rs1799983	24986538	4846	NOS3	umls:C0948008	BeFree	Screening of the NOS3 gene identifies the variants 894G/T, 1998C/G and 2479G/A to be associated with acute onset ischemic stroke in young Asian Indians.	0.015244352	2014	NOS3	7	150999023	T	G
rs1799983	17108813	4846	NOS3	umls:C0948008	BeFree	An interaction between the E298D and T-786C polymorphisms in NOS3, cigarette smoking, and risk of incident coronary heart disease and ischemic stroke events appears to exist, suggesting a potential complex interplay between genetic and environmental factors and cardiovascular disease risk.	0.015244352	2006	NOS3	7	150999023	T	G
rs1799983	18781402	4846	NOS3	umls:C0948008	BeFree	Glu298Asp polymorphism of the endothelial nitric oxide synthase gene in Turkish patients with ischemic stroke.	0.015244352	2009	NOS3	7	150999023	T	G
rs1799983	24573998	4846	NOS3	umls:C0948008	BeFree	Endothelial nitric oxide (eNOS) gene G894T and VNTR polymorphisms are closely associated with the risk of ischemic stroke development for Asians: meta-analysis of epidemiological studies.	0.015244352	2014	NOS3	7	150999023	T	G
rs1799983	16787209	4846	NOS3	umls:C0948008	BeFree	However, it is the interplay of both environmental and common genetic factors [such as the Leiden V, methylenetetrahydrofolate reductase C677T, apolipopotein E 4, endothelial nitric oxide synthase G894T, angiotensin-converting enzyme I/D and angiotensin II type 1 receptor A1166C mutations and polymorphisms] that leads to the development of ischaemic stroke.	0.015244352	2006	NOS3	7	150999023	T	G
rs1799983	22940147	4846	NOS3	umls:C0948008	BeFree	Previous studies have shown that ischemic stroke (IS) was closely associated with the Glu298Asp polymorphism in the eNOS gene and the 677C-T (Ala→Val) polymorphism in methylenetetrahydrofolate reductase (MTHRF) gene.	0.015244352	2012	NOS3	7	150999023	T	G
rs1799983	15595935	4524	MTHFR	umls:C0948008	BeFree	The eNOS G894T or eNOS 894TT genotypes in combination with the MTHFR 677TT or ACE D/D genotype increases the risk of ischaemic stroke.	0.02920744	2005	NOS3	7	150999023	T	G
rs1799983	22940147	4524	MTHFR	umls:C0948008	BeFree	Previous studies have shown that ischemic stroke (IS) was closely associated with the Glu298Asp polymorphism in the eNOS gene and the 677C-T (Ala→Val) polymorphism in methylenetetrahydrofolate reductase (MTHRF) gene.	0.02920744	2012	NOS3	7	150999023	T	G
rs1799983	19804474	4846	NOS3	umls:C0948008	BeFree	Endothelial nitric oxide synthase Glu298Asp, 4b/a, and -786T>C gene polymorphisms and the risk of ischemic stroke.	0.015244352	2010	NOS3	7	150999023	T	G
rs1799983	15595935	1636	ACE	umls:C0948008	BeFree	The eNOS G894T or eNOS 894TT genotypes in combination with the MTHFR 677TT or ACE D/D genotype increases the risk of ischaemic stroke.	0.016058678	2005	NOS3	7	150999023	T	G
rs1799983	16787209	185	AGTR1	umls:C0948008	BeFree	However, it is the interplay of both environmental and common genetic factors [such as the Leiden V, methylenetetrahydrofolate reductase C677T, apolipopotein E 4, endothelial nitric oxide synthase G894T, angiotensin-converting enzyme I/D and angiotensin II type 1 receptor A1166C mutations and polymorphisms] that leads to the development of ischaemic stroke.	0.002171535	2006	NOS3	7	150999023	T	G
rs1799983	16787209	4524	MTHFR	umls:C0948008	BeFree	However, it is the interplay of both environmental and common genetic factors [such as the Leiden V, methylenetetrahydrofolate reductase C677T, apolipopotein E 4, endothelial nitric oxide synthase G894T, angiotensin-converting enzyme I/D and angiotensin II type 1 receptor A1166C mutations and polymorphisms] that leads to the development of ischaemic stroke.	0.02920744	2006	NOS3	7	150999023	T	G
rs1799983	23544143	4846	NOS3	umls:C0948008	BeFree	The meta-analysis indicated that eNOS gene 4b/a, T-786C, G894T polymorphism might be associated with IS.	0.015244352	2013	NOS3	7	150999023	T	G
rs1799983	16787209	1636	ACE	umls:C0948008	BeFree	However, it is the interplay of both environmental and common genetic factors [such as the Leiden V, methylenetetrahydrofolate reductase C677T, apolipopotein E 4, endothelial nitric oxide synthase G894T, angiotensin-converting enzyme I/D and angiotensin II type 1 receptor A1166C mutations and polymorphisms] that leads to the development of ischaemic stroke.	0.016058678	2006	NOS3	7	150999023	T	G
rs1799998	23950878	1585	CYP11B2	umls:C0948008	BeFree	Lack of an association between CYP11B2 C-344T gene polymorphism and ischemic stroke: a meta-analysis of 7,710 subjects.	0.001357209	2013	CYP11B2;LOC105375793	8	142918184	A	G
rs1799998	21228735	1585	CYP11B2	umls:C0948008	BeFree	Above all, our results suggest that genetic variation rs1799998 (-344C/T) of CYP11B2 gene may contribute to the risk of IS with moderate effect in Han Chinese population.	0.001357209	2011	CYP11B2;LOC105375793	8	142918184	A	G
rs1800469	22769019	6356	CCL11	umls:C0948008	BeFree	In the non-hypertensive group, CCL11 rs3744508, LTC4S rs730012, FCER1B rs569108, TGFB1 rs1800469, LTA rs909253 and CCL11 rs4795895 were associated with ischemic stroke.	0.000542884	2012	TGFB1;B9D2	19	41354391	A	G
rs1800562	17389307	3077	HFE	umls:C0948008	BeFree	We tested the hypothesis that the HFE genotypes H63D/H63D, H63D/wild type, C282Y/H63D, C282Y/C282Y, and C282Y/wild type are risk factors for symptomatic carotid atherosclerosis, ischemic cerebrovascular disease (ICVD), and ischemic stroke.	0.000814326	2007	HFE	6	26092913	G	A
rs1800796	24782217	3553	IL1B	umls:C0948008	BeFree	Our study suggests that IL-6 rs1800796 and IL-1B rs1864169 polymorphisms are associated with ischemic stroke risk in the Chinese population.	0.009001189	2015	IL6;LOC541472	7	22726627	G	C
rs1800796	25325233	463	ZFHX3	umls:C0948008	BeFree	Nonparametric linkage analysis revealed that the rs1800796 polymorphism in the interleukin-6 (IL-6) gene is significantly linked to the small arterial occlusion (SAO) subtype (p=0.022), while the rs7193343 polymorphism in the ZFHX3 gene is linked to IS (p=0.002) under the dominant model.	0.000814326	2015	IL6;LOC541472	7	22726627	G	C
rs1800796	24782217	3569	IL6	umls:C0948008	BeFree	Our study suggests that IL-6 rs1800796 and IL-1B rs1864169 polymorphisms are associated with ischemic stroke risk in the Chinese population.	0.010162901	2015	IL6;LOC541472	7	22726627	G	C
rs1800947	16733231	1401	CRP	umls:C0948008	GAD	[Association study between C-reactive protein genes and ischemic stroke in Japanese subjects.]	0.01198705	2006	CRP	1	159713648	C	T,G,A
rs1801133	25144711	4524	MTHFR	umls:C0948008	BeFree	In addition, MTHFR rs1801133 also was associated with cerebral hemorrhage (OR = 1.48; 95%CI, 1.16 to 1.89; P = 0.001) but not with ischemic stroke (OR = 1.08; 95%CI, 0.96 to 1.22; P = 0.210).	0.02920744	2014	MTHFR	1	11796321	G	A
rs1801282	17359638	5468	PPARG	umls:C0948008	BeFree	Peroxisome proliferator-activated receptor-gamma Pro12Ala polymorphism is associated with the susceptibility to ischemic stroke in Taeeumin classified by Sasang medicine.	0.001357209	2007	PPARG	3	12351626	C	G
rs1801708	24633486	1909	EDNRA	umls:C0948008	BeFree	A allele of rs1801708 in EDNRA gene can increase the risk of IS in Northern Han women population.	0.000542884	2015	EDNRA	4	147481217	G	A
rs1805087	11672761	4548	MTR	umls:C0948008	BeFree	The G allele of MS A2756G yields an OR of 0.92(95% CI 0.47-1.81) for IS and 1.17 (95% CI 0.58-2.37) for MI.	0.000542884	2001	MTR	1	236885200	A	G
rs1805192	17359638	5468	PPARG	umls:C0948008	BeFree	Peroxisome proliferator-activated receptor-gamma Pro12Ala polymorphism is associated with the susceptibility to ischemic stroke in Taeeumin classified by Sasang medicine.	0.001357209	2007	PPARG	3	12379739	C	G
rs1864169	24782217	3553	IL1B	umls:C0948008	BeFree	Our study suggests that IL-6 rs1800796 and IL-1B rs1864169 polymorphisms are associated with ischemic stroke risk in the Chinese population.	0.009001189	2015	GTF2A1;SNORA79	14	81203689	G	T
rs1864169	24782217	3569	IL6	umls:C0948008	BeFree	Our study suggests that IL-6 rs1800796 and IL-1B rs1864169 polymorphisms are associated with ischemic stroke risk in the Chinese population.	0.010162901	2015	GTF2A1;SNORA79	14	81203689	G	T
rs1883832	20504251	958	CD40	umls:C0948008	BeFree	CD40-1C>T polymorphism (rs1883832) is associated with brain vessel reocclusion after fibrinolysis in ischemic stroke.	0.000814326	2010	CD40	20	46118343	T	C
rs2029253	23079278	241	ALOX5AP	umls:C0948008	BeFree	In combined analysis of multiple genes and loci, individuals with ALOX5AP rs12429692 T allele, ALOX5 rs2029253 A allele, and LTA4H rs6538697 C allele suggested a significantly increased susceptibility to IS (adjusted OR, 1.70; 95% CI, 1.07-2.69; P=0.024).	0.009077134	2012	ALOX5	10	45396036	A	G
rs2029253	23079278	240	ALOX5	umls:C0948008	BeFree	In combined analysis of multiple genes and loci, individuals with ALOX5AP rs12429692 T allele, ALOX5 rs2029253 A allele, and LTA4H rs6538697 C allele suggested a significantly increased susceptibility to IS (adjusted OR, 1.70; 95% CI, 1.07-2.69; P=0.024).	0.003257302	2012	ALOX5	10	45396036	A	G
rs2029253	23079278	4048	LTA4H	umls:C0948008	BeFree	In combined analysis of multiple genes and loci, individuals with ALOX5AP rs12429692 T allele, ALOX5 rs2029253 A allele, and LTA4H rs6538697 C allele suggested a significantly increased susceptibility to IS (adjusted OR, 1.70; 95% CI, 1.07-2.69; P=0.024).	0.000542884	2012	ALOX5	10	45396036	A	G
rs2029253	23079278	4056	LTC4S	umls:C0948008	BeFree	Under the recessive genetic model, ALOX5 rs2029253 variant reduced IS risk (adjusted OR, 0.78; 95% CI, 0.60-1.00; P=0.048) while LTA4H rs6538697 and LTC4S rs730012 variants increased (adjusted OR, 1.66; 95% CI, 1.04-2.64; P=0.032 and adjusted OR, 3.63; 95% CI, 1.01-13.05; P=0.048, respectively).	0.000814326	2012	ALOX5	10	45396036	A	G
rs20417	20472470	5743	PTGS2	umls:C0948008	BeFree	Impact of COX-2 rs5275 and rs20417 and GPIIIa rs5918 polymorphisms on 90-day ischemic stroke functional outcome: a novel finding.	0.002442977	2011	PTGS2;PACERR	1	186681189	C	G
rs2043211	24385277	22900	CARD8	umls:C0948008	BeFree	Regulation of CARD8 expression by ANRIL and association of CARD8 single nucleotide polymorphism rs2043211 (p.C10X) with ischemic stroke.	0.000271442	2014	CARD8	19	48234449	A	T
rs2043211	24385277	100048912	CDKN2B-AS1	umls:C0948008	BeFree	Regulation of CARD8 expression by ANRIL and association of CARD8 single nucleotide polymorphism rs2043211 (p.C10X) with ischemic stroke.	0.000542884	2014	CARD8	19	48234449	A	T
rs2066714	16446539	19	ABCA1	umls:C0948008	BeFree	We investigated 244 unrelated, consecutively enrolled patients with ischemic stroke, 150 patients with coronary heart disease (CHD) and 193 blood donors for allele frequencies (AFs) of three common ABCA1 polymorphisms (R219K, V771M and I883M).	0.001085767	2006	ABCA1	9	104824472	T	C
rs2070600	24107402	177	AGER	umls:C0948008	BeFree	Among the studied polymorphisms, only the polymorphism at 82G/S of RAGE gene was associated with the risk for ischemic stroke irrespective of the stroke subtypes.	0.000814326	2013	AGER	6	32183666	C	T
rs2070699	24633486	1906	EDN1	umls:C0948008	BeFree	In EDN1 gene, T allele of rs5370 and G allele of rs2070699 may be IS incidence risk factors in Northern Han male population.	0.000271442	2015	EDN1	6	12292539	G	T
rs2070874	21501388	3565	IL4	umls:C0948008	BeFree	Interleukin-4 (IL4) polymorphisms (rs2243250, rs2070874) were analysed in Korean patients with ischaemic stroke (IS) (n=119) and intracerebral haemorrhage (ICH) (n=79), and age-matched controls (n =267, IS; n=401, ICH) using direct sequencing.	0.000814326	2011	IL4	5	132674018	C	T
rs2107538	23198952	6347	CCL2	umls:C0948008	BeFree	This is a pilot study analysing association of chemokine gene polymorphisms (CXCL1, rs3117604; CXCL2, rs3806792; CCL2, rs2857656 and rs3760396; CCL5, rs2107538) in Korean patients with ischemic stroke (IS) (n = 120) and age-matched controls (n = 267).	0.003452799	2012	CCL5;LOC105371744	17	35880776	C	T
rs2107595	26093197	9734	HDAC9	umls:C0948008	BeFree	Association of GWAS-supported loci rs2107595 in HDAC9 gene with ischemic stroke in southern Han Chinese.	0.001628651	2015	LOC105375175	7	19009765	G	A
rs2108622	20130494	1579	CYP4A11	umls:C0948008	BeFree	We identified CYP4A11 C-296T and CYP4F2 V433M were associated with significantly increased risk of ischemic stroke (CT+TT vs. CC, adjusted odds ratio: 1.50, 95% confidence interval: 1.17-1.93, Pcombined=0.001, Pcorr=0.008; V/M+M/M vs. V/V, odds ratio: 1.38, 95% confidence interval: 1.15-1.65, Pcombined=5.6x10, Pcorr=0.005, respectively).	0.000271442	2010	CYP4F2	19	15879621	C	T
rs2108622	20227456	8529	CYP4F2	umls:C0948008	BeFree	CYP4F2 gene V433M polymorphism is associated with ischemic stroke in the male Northern Chinese Han population.	0.001357209	2010	CYP4F2	19	15879621	C	T
rs2108622	18574070	8529	CYP4F2	umls:C0948008	BeFree	The V433M variant of the CYP4F2 is associated with ischemic stroke in male Swedes beyond its effect on blood pressure.	0.001357209	2008	CYP4F2	19	15879621	C	T
rs2108622	20130494	8529	CYP4F2	umls:C0948008	BeFree	Interestingly, the effects of CYP4F2 V433M on ischemic stroke in our study was only evident in male individuals.	0.001357209	2010	CYP4F2	19	15879621	C	T
rs213045	24026618	1889	ECE1	umls:C0948008	BeFree	The present study suggested that the C-338A polymorphism of the ECE-1b gene was associated with an increased risk of ischemic stroke in the Chinese Han population.	0.000542884	2013	ECE1	1	21290752	G	T
rs2139733	24668187	4842	NOS1	umls:C0948008	BeFree	T allele of rs2293050 and A allele of rs2139733 in nNOS gene may contribute to increased susceptibility of LAA-caused ischemic stroke in Han Chinese.	0.000542884	2015	NOS1	12	117288937	T	A
rs2143678	21779381	50805	IRX4	umls:C0948008	BeFree	Among migraineurs with aura rs7698623 in MEPE (OR = 6.37; 95% CI 3.15-12.90; p = 2.7×10(-7)) and rs4975709 in IRX4 (OR = 5.06; 95% CI 2.66-9.62; p = 7.7×10(-7)) appeared to be associated with ischemic stroke, rs2143678 located close to MDF1 with major CVD (OR = 3.05; 95% CI 1.98-4.69; p = 4.3×10(-7)), and the intergenic rs1406961 with CVD death (OR = 12.33; 95% CI 4.62-32.87; p = 5.2×10(-7)).	0.000271442	2011	NA	6	41655295	G	T
rs2143678	21779381	56955	MEPE	umls:C0948008	BeFree	Among migraineurs with aura rs7698623 in MEPE (OR = 6.37; 95% CI 3.15-12.90; p = 2.7×10(-7)) and rs4975709 in IRX4 (OR = 5.06; 95% CI 2.66-9.62; p = 7.7×10(-7)) appeared to be associated with ischemic stroke, rs2143678 located close to MDF1 with major CVD (OR = 3.05; 95% CI 1.98-4.69; p = 4.3×10(-7)), and the intergenic rs1406961 with CVD death (OR = 12.33; 95% CI 4.62-32.87; p = 5.2×10(-7)).	0.000542884	2011	NA	6	41655295	G	T
rs2228054	23096091	3586	IL10	umls:C0948008	BeFree	To investigate whether IL10, IL10RA, and IL10RB polymorphisms are associated with the risk of ischemic stroke (IS), selected two IL10 SNPs (rs1518111 and rs1554286), three IL10RA SNPs (rs2256111, rs4252243, and rs2228054), and two IL10RB SNPs (rs999788 and rs2834167) were analyzed in 120 patients with IS and 285 control subjects.	0.002171535	2013	IL10RA	11	117993398	G	A
rs2228064	21816595	241	ALOX5AP	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.009077134	2011	ALOX5	10	45382602	G	A
rs2228064	21816595	240	ALOX5	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.003257302	2011	ALOX5	10	45382602	G	A
rs2228064	21816595	5743	PTGS2	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.002442977	2011	ALOX5	10	45382602	G	A
rs2228064	21816595	5742	PTGS1	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.001357209	2011	ALOX5	10	45382602	G	A
rs2228315	25720421	6404	SELPLG	umls:C0948008	BeFree	In addition, we identified the missense SNP rs2228315 in the PSGL1-gene as a candidate polymorphism for ischemic stroke-related PLA.	0.000542884	2015	SELPLG	12	108624122	C	T
rs2230500	22808203	5583	PRKCH	umls:C0948008	BeFree	The SNP (rs2230500) in PRKCH (the gene encoding protein kinase C η) is associated with ischemic stroke and cerebral hemorrhage in the Chinese population, but the molecular mechanisms are not clear.	0.001628651	2012	PRKCH	14	61457521	G	A
rs2230501	24664524	5583	PRKCH	umls:C0948008	BeFree	Significant allelic association was identified between NINJ2 gene rs11833579 (P = 0.008), protein kinase C η gene rs2230501 (P = 0.039) and IS.	0.001628651	2015	PRKCH	14	61457523	A	C
rs2230806	16446539	19	ABCA1	umls:C0948008	BeFree	We investigated 244 unrelated, consecutively enrolled patients with ischemic stroke, 150 patients with coronary heart disease (CHD) and 193 blood donors for allele frequencies (AFs) of three common ABCA1 polymorphisms (R219K, V771M and I883M).	0.001085767	2006	ABCA1	9	104858586	C	T
rs2230806	24157307	19	ABCA1	umls:C0948008	BeFree	ATP-binding cassette transporter A1 R219K polymorphism and ischemic stroke risk in the Chinese population: a meta-analysis.	0.001085767	2013	ABCA1	9	104858586	C	T
rs2231137	19023099	9429	ABCG2	umls:C0948008	BeFree	The Val12Met SNP in ABCG2 (encoding a transporter of sterols and xenobiotics) was associated with incident ischemic stroke in white and black participants of CHS.	0.000271442	2009	ABCG2	4	88139962	C	T
rs2243250	21501388	3565	IL4	umls:C0948008	BeFree	Interleukin-4 (IL4) polymorphisms (rs2243250, rs2070874) were analysed in Korean patients with ischaemic stroke (IS) (n=119) and intracerebral haemorrhage (ICH) (n=79), and age-matched controls (n =267, IS; n=401, ICH) using direct sequencing.	0.000814326	2011	IL4	5	132673462	C	T
rs2256111	23096091	3586	IL10	umls:C0948008	BeFree	To investigate whether IL10, IL10RA, and IL10RB polymorphisms are associated with the risk of ischemic stroke (IS), selected two IL10 SNPs (rs1518111 and rs1554286), three IL10RA SNPs (rs2256111, rs4252243, and rs2228054), and two IL10RB SNPs (rs999788 and rs2834167) were analyzed in 120 patients with IS and 285 control subjects.	0.002171535	2013	IL10RA	11	117993332	A	G
rs2281939	18394047	10580	SORBS1	umls:C0948008	BeFree	We investigated the association between the SORBS1 T228A polymorphism and ischaemic stroke.	0.000271442	2008	SORBS1	10	95414595	T	C
rs2293050	24668187	4842	NOS1	umls:C0948008	BeFree	T allele of rs2293050 and A allele of rs2139733 in nNOS gene may contribute to increased susceptibility of LAA-caused ischemic stroke in Han Chinese.	0.000542884	2015	NOS1	12	117281017	C	T
rs2383206	19559344	1029	CDKN2A	umls:C0948008	BeFree	In a hospital based case control study, we investigated the association of cyclin-dependent kinase inhibitor 2A (CDKN2A) gene, cyclin-dependent kinase inhibitor 2B (CDKN2B) gene, and two genetic variants (rs10757274 and rs2383206) on chromosome region 9p21 with ischemic stroke in Chinese Hans.	0.000542884	2009	CDKN2B-AS1	9	22115027	A	G
rs2383206	19559344	1030	CDKN2B	umls:C0948008	BeFree	In a hospital based case control study, we investigated the association of cyclin-dependent kinase inhibitor 2A (CDKN2A) gene, cyclin-dependent kinase inhibitor 2B (CDKN2B) gene, and two genetic variants (rs10757274 and rs2383206) on chromosome region 9p21 with ischemic stroke in Chinese Hans.	0.000271442	2009	CDKN2B-AS1	9	22115027	A	G
rs2383206	19559344	1033	CDKN3	umls:C0948008	BeFree	In a hospital based case control study, we investigated the association of cyclin-dependent kinase inhibitor 2A (CDKN2A) gene, cyclin-dependent kinase inhibitor 2B (CDKN2B) gene, and two genetic variants (rs10757274 and rs2383206) on chromosome region 9p21 with ischemic stroke in Chinese Hans.	0.000271442	2009	CDKN2B-AS1	9	22115027	A	G
rs2383207	20031580	4185	ADAM11	umls:C0948008	BeFree	We found a modest increase in ischemic stroke risk for 2 common (minor allele frequencies 0.46 to 0.49) variants, rs2383207 (P=0.04 in Lund Stroke Register, P=0.01 in MDC) and rs10757274 (P=0.03 in Lund Stroke Register, P=0.03 in MDC), in each sample independently.	0.000271442	2009	CDKN2B-AS1	9	22115960	A	G
rs2566514	24986538	4846	NOS3	umls:C0948008	BeFree	Screening of the NOS3 gene identifies the variants 894G/T, 1998C/G and 2479G/A to be associated with acute onset ischemic stroke in young Asian Indians.	0.015244352	2014	NOS3	7	151007162	C	A,G
rs2686342	22662160	10645	CAMKK2	umls:C0948008	BeFree	In addition, an intronic SNP in CAMKK2, rs2686342, were associated with a decreased risk of IS (OR 0.89; 95% CI = 0.82-0.97; P = 0.011).	0.000271442	2012	CAMKK2	12	121247385	T	A
rs2736100	26201603	7015	TERT	umls:C0948008	BeFree	The aim of the present study was to determine whether six variants in the TERT gene are associated with risk of incident coronary heart disease, incident ischemic stroke, and mortality in participants in the biracial population-based Atherosclerosis Risk in Communities (ARIC) study, including rs2736100 that was found to influence mean telomere length in a genome-wide analysis.	0.000271442	2015	TERT	5	1286401	C	A
rs2834167	23096091	3586	IL10	umls:C0948008	BeFree	To investigate whether IL10, IL10RA, and IL10RB polymorphisms are associated with the risk of ischemic stroke (IS), selected two IL10 SNPs (rs1518111 and rs1554286), three IL10RA SNPs (rs2256111, rs4252243, and rs2228054), and two IL10RB SNPs (rs999788 and rs2834167) were analyzed in 120 patients with IS and 285 control subjects.	0.002171535	2013	IL10RB	21	33268483	A	G
rs2857656	23198952	6347	CCL2	umls:C0948008	BeFree	This is a pilot study analysing association of chemokine gene polymorphisms (CXCL1, rs3117604; CXCL2, rs3806792; CCL2, rs2857656 and rs3760396; CCL5, rs2107538) in Korean patients with ischemic stroke (IS) (n = 120) and age-matched controls (n = 267).	0.003452799	2012	CCL2	17	34254988	G	A,C
rs28933698	21555590	4854	NOTCH3	umls:C0948008	BeFree	We demonstrate that the C455R and R1031C mutations define different hypomorphic activity states of Notch 3, a property linked to ischemic stroke susceptibility in mouse models we generated.	0.001900093	2011	NOTCH3	19	15189004	A	G
rs2910164	24178064	5018	OXA1L	umls:C0948008	BeFree	We evaluated the associations of the hsa-mir-196-a2/rs11614913 T/C, hsa-mir-146a/rs2910164 C/G, and hsa-mir-499/rs3746444 A/G polymorphisms in pre-miRNAs with the risk of ischemic stroke in a Chinese population.	0.000271442	2013	LOC285628;MIR146A	5	160485411	C	G
rs2910164	25658319	406938	MIR146A	umls:C0948008	BeFree	In summary, this study provides evidence that miR-146a/rs2910164 might be associated with a significantly increased risk of ischemic stroke in a Chinese population, and the combined effects between miRNA polymorphism and fasting glucose /blood lipid levels may contribute to stroke pathogenesis.	0.001085767	2014	LOC285628;MIR146A	5	160485411	C	G
rs2910164	24178064	406938	MIR146A	umls:C0948008	BeFree	We evaluated the associations of the hsa-mir-196-a2/rs11614913 T/C, hsa-mir-146a/rs2910164 C/G, and hsa-mir-499/rs3746444 A/G polymorphisms in pre-miRNAs with the risk of ischemic stroke in a Chinese population.	0.001085767	2013	LOC285628;MIR146A	5	160485411	C	G
rs2910164	25658319	574501	MIR499A	umls:C0948008	BeFree	Using the TaqMan assay, we evaluated the association of hsa-miR-146a/rs2910164, hsa-miR-196a2/rs11614913, and hsa-miR-499/rs3746444 polymorphisms with the risk of ischemic stroke in a Chinese population with 531 ischemic stroke patients and 531 control subjects.	0.000814326	2014	LOC285628;MIR146A	5	160485411	C	G
rs3117604	23198952	6347	CCL2	umls:C0948008	BeFree	This is a pilot study analysing association of chemokine gene polymorphisms (CXCL1, rs3117604; CXCL2, rs3806792; CCL2, rs2857656 and rs3760396; CCL5, rs2107538) in Korean patients with ischemic stroke (IS) (n = 120) and age-matched controls (n = 267).	0.003452799	2012	CXCL1	4	73868951	T	C
rs3135506	18274806	116519	APOA5	umls:C0948008	BeFree	Apolipoprotein A5 gene C56G variant confers risk for the development of large-vessel associated ischemic stroke.	0.004267125	2008	APOA5	11	116791691	G	A,C
rs351855	23206452	2264	FGFR4	umls:C0948008	BeFree	Association between fibroblast growth factor receptor 4 Gly388Arg polymorphism and ischaemic stroke.	0.000542884	2012	FGFR4	5	177093242	G	A
rs3730043	18511872	1636	ACE	umls:C0948008	BeFree	Among the gene polymorphisms tested in the study, association of gene polymorphisms with increasing risk of ischemic stroke was confirmed in 6 polymorphisms including angiotensin-converting enzyme insertion/deletion (ACE I/D; OR = 1.87, 95% CI = 1.45-2.42), methylenetetrahydrofolate reductase (MTHFR) C677T (OR = 1.55, 95% CI = 1.26-1.90), plasminogen activator inhibitor 1 (PAI-1) 4G/5G (OR = 1.79, 95% CI = 1.20-2.67), beta-fibrinogen (beta-Fg) -455A/G (OR = 1.48, 95% CI = 1.14-1.92), beta-Fg -148T/C (OR = 1.72, 95% CI = 1.42-2.07), apolipoprotein E (ApoE) epsilon2-4 (OR = 2.39, 95% CI = 1.94-2.95).	0.016058678	2008	ACE	17	63491216	C	T
rs3730043	16787209	1636	ACE	umls:C0948008	BeFree	However, it is the interplay of both environmental and common genetic factors [such as the Leiden V, methylenetetrahydrofolate reductase C677T, apolipopotein E 4, endothelial nitric oxide synthase G894T, angiotensin-converting enzyme I/D and angiotensin II type 1 receptor A1166C mutations and polymorphisms] that leads to the development of ischaemic stroke.	0.016058678	2006	ACE	17	63491216	C	T
rs3730043	18387982	2147	F2	umls:C0948008	BeFree	The aim of this study was to evaluate the prevalence of factor V Leiden (FVL), prothrombin G20210A, methylenetetrahydrofolate reductase (MTHFR) C677T gene mutations, and angiotensin-converting enzyme (ACE) I/D polymorphism in ischemic stroke (IS) patients.	0.024636535	2009	ACE	17	63491216	C	T
rs3730043	15534175	4524	MTHFR	umls:C0948008	BeFree	Statistically significant associations with ischemic stroke were identified for factor V Leiden Arg506Gln (OR, 1.33; 95% CI, 1.12-1.58), methylenetetrahydrofolate reductase C677T (OR, 1.24; 95% CI, 1.08-1.42), prothrombin G20210A (OR, 1.44; 95% CI, 1.11-1.86), and angiotensin-converting enzyme insertion/deletion (OR, 1.21; 95% CI, 1.08-1.35).	0.02920744	2004	ACE	17	63491216	C	T
rs3730043	17455988	348	APOE	umls:C0948008	BeFree	Of the eight candidate genes studied, three were associated with ischaemic stroke: the angiotensin I converting enzyme (ACE) insertion/deletion (I/D) polymorphism with a mean OR of 1.90 (95% CI 1.23-2.93) in the Chinese and 1.74 (95% CI 0.88-3.42) in the Japanese; the summary OR for the C677T variant of 5,10-methylenetetrahydrofolate reductase (MTHFR) was 1.18 (95% CI 0.90-1.56) in Chinese and 1.34 (95% CI 0.87-2.06) in Koreans; and the pooled OR for the apolipoprotein E (APOE) gene was 2.18 (95% CI 1.52-3.13) in Chinese and 1.51 (95% CI 0.93-2.45) in Japanese.	0.017958771	2007	ACE	17	63491216	C	T
rs3730043	16787209	185	AGTR1	umls:C0948008	BeFree	However, it is the interplay of both environmental and common genetic factors [such as the Leiden V, methylenetetrahydrofolate reductase C677T, apolipopotein E 4, endothelial nitric oxide synthase G894T, angiotensin-converting enzyme I/D and angiotensin II type 1 receptor A1166C mutations and polymorphisms] that leads to the development of ischaemic stroke.	0.002171535	2006	ACE	17	63491216	C	T
rs3730043	16787209	4846	NOS3	umls:C0948008	BeFree	However, it is the interplay of both environmental and common genetic factors [such as the Leiden V, methylenetetrahydrofolate reductase C677T, apolipopotein E 4, endothelial nitric oxide synthase G894T, angiotensin-converting enzyme I/D and angiotensin II type 1 receptor A1166C mutations and polymorphisms] that leads to the development of ischaemic stroke.	0.015244352	2006	ACE	17	63491216	C	T
rs3730043	18387982	2153	F5	umls:C0948008	BeFree	The aim of this study was to evaluate the prevalence of factor V Leiden (FVL), prothrombin G20210A, methylenetetrahydrofolate reductase (MTHFR) C677T gene mutations, and angiotensin-converting enzyme (ACE) I/D polymorphism in ischemic stroke (IS) patients.	0.022812387	2009	ACE	17	63491216	C	T
rs3730043	15534175	1636	ACE	umls:C0948008	BeFree	Statistically significant associations with ischemic stroke were identified for factor V Leiden Arg506Gln (OR, 1.33; 95% CI, 1.12-1.58), methylenetetrahydrofolate reductase C677T (OR, 1.24; 95% CI, 1.08-1.42), prothrombin G20210A (OR, 1.44; 95% CI, 1.11-1.86), and angiotensin-converting enzyme insertion/deletion (OR, 1.21; 95% CI, 1.08-1.35).	0.016058678	2004	ACE	17	63491216	C	T
rs3730043	15534175	2153	F5	umls:C0948008	BeFree	Statistically significant associations with ischemic stroke were identified for factor V Leiden Arg506Gln (OR, 1.33; 95% CI, 1.12-1.58), methylenetetrahydrofolate reductase C677T (OR, 1.24; 95% CI, 1.08-1.42), prothrombin G20210A (OR, 1.44; 95% CI, 1.11-1.86), and angiotensin-converting enzyme insertion/deletion (OR, 1.21; 95% CI, 1.08-1.35).	0.022812387	2004	ACE	17	63491216	C	T
rs3730043	18387982	4524	MTHFR	umls:C0948008	BeFree	The aim of this study was to evaluate the prevalence of factor V Leiden (FVL), prothrombin G20210A, methylenetetrahydrofolate reductase (MTHFR) C677T gene mutations, and angiotensin-converting enzyme (ACE) I/D polymorphism in ischemic stroke (IS) patients.	0.02920744	2009	ACE	17	63491216	C	T
rs3730043	16787209	4524	MTHFR	umls:C0948008	BeFree	However, it is the interplay of both environmental and common genetic factors [such as the Leiden V, methylenetetrahydrofolate reductase C677T, apolipopotein E 4, endothelial nitric oxide synthase G894T, angiotensin-converting enzyme I/D and angiotensin II type 1 receptor A1166C mutations and polymorphisms] that leads to the development of ischaemic stroke.	0.02920744	2006	ACE	17	63491216	C	T
rs3730043	17455988	1636	ACE	umls:C0948008	BeFree	Of the eight candidate genes studied, three were associated with ischaemic stroke: the angiotensin I converting enzyme (ACE) insertion/deletion (I/D) polymorphism with a mean OR of 1.90 (95% CI 1.23-2.93) in the Chinese and 1.74 (95% CI 0.88-3.42) in the Japanese; the summary OR for the C677T variant of 5,10-methylenetetrahydrofolate reductase (MTHFR) was 1.18 (95% CI 0.90-1.56) in Chinese and 1.34 (95% CI 0.87-2.06) in Koreans; and the pooled OR for the apolipoprotein E (APOE) gene was 2.18 (95% CI 1.52-3.13) in Chinese and 1.51 (95% CI 0.93-2.45) in Japanese.	0.016058678	2007	ACE	17	63491216	C	T
rs3730043	15534175	2147	F2	umls:C0948008	BeFree	Statistically significant associations with ischemic stroke were identified for factor V Leiden Arg506Gln (OR, 1.33; 95% CI, 1.12-1.58), methylenetetrahydrofolate reductase C677T (OR, 1.24; 95% CI, 1.08-1.42), prothrombin G20210A (OR, 1.44; 95% CI, 1.11-1.86), and angiotensin-converting enzyme insertion/deletion (OR, 1.21; 95% CI, 1.08-1.35).	0.024636535	2004	ACE	17	63491216	C	T
rs3736599	23112845	2099	ESR1	umls:C0948008	BeFree	SULT1E1 -64G/A, COMT Val158Met, ESR1 c.454-397 T/C and c.454-351 A/G genes were genotyped and compared between cases and controls to identify single nucleotide polymorphisms associated with ischemic stroke susceptibility.	0.001900093	2012	SULT1E1	4	69860103	C	T
rs3744508	22769019	6356	CCL11	umls:C0948008	BeFree	In the non-hypertensive group, CCL11 rs3744508, LTC4S rs730012, FCER1B rs569108, TGFB1 rs1800469, LTA rs909253 and CCL11 rs4795895 were associated with ischemic stroke.	0.000542884	2012	NA	NA	NA	NA	NA
rs3746444	24178064	406938	MIR146A	umls:C0948008	BeFree	We evaluated the associations of the hsa-mir-196-a2/rs11614913 T/C, hsa-mir-146a/rs2910164 C/G, and hsa-mir-499/rs3746444 A/G polymorphisms in pre-miRNAs with the risk of ischemic stroke in a Chinese population.	0.001085767	2013	MYH7B;MIR499A;MIR499B	20	34990448	A	G
rs3746444	24178064	5018	OXA1L	umls:C0948008	BeFree	We evaluated the associations of the hsa-mir-196-a2/rs11614913 T/C, hsa-mir-146a/rs2910164 C/G, and hsa-mir-499/rs3746444 A/G polymorphisms in pre-miRNAs with the risk of ischemic stroke in a Chinese population.	0.000271442	2013	MYH7B;MIR499A;MIR499B	20	34990448	A	G
rs3746444	24178064	574501	MIR499A	umls:C0948008	BeFree	The present study provided evidence that hsa-mir-499/rs3746444 A/G polymorphism might be associated with a significantly increased risk of ischemic stroke in a Chinese population, indicating that the common genetic polymorphism in pre-microRNAs contributed to the pathogenesis of ischemic stroke.	0.000814326	2013	MYH7B;MIR499A;MIR499B	20	34990448	A	G
rs3746444	25658319	574501	MIR499A	umls:C0948008	BeFree	Using the TaqMan assay, we evaluated the association of hsa-miR-146a/rs2910164, hsa-miR-196a2/rs11614913, and hsa-miR-499/rs3746444 polymorphisms with the risk of ischemic stroke in a Chinese population with 531 ischemic stroke patients and 531 control subjects.	0.000814326	2014	MYH7B;MIR499A;MIR499B	20	34990448	A	G
rs375752214	16787209	4524	MTHFR	umls:C0948008	BeFree	However, it is the interplay of both environmental and common genetic factors [such as the Leiden V, methylenetetrahydrofolate reductase C677T, apolipopotein E 4, endothelial nitric oxide synthase G894T, angiotensin-converting enzyme I/D and angiotensin II type 1 receptor A1166C mutations and polymorphisms] that leads to the development of ischaemic stroke.	0.02920744	2006	NOS3	7	150998541	C	T
rs375752214	16787209	4846	NOS3	umls:C0948008	BeFree	However, it is the interplay of both environmental and common genetic factors [such as the Leiden V, methylenetetrahydrofolate reductase C677T, apolipopotein E 4, endothelial nitric oxide synthase G894T, angiotensin-converting enzyme I/D and angiotensin II type 1 receptor A1166C mutations and polymorphisms] that leads to the development of ischaemic stroke.	0.015244352	2006	NOS3	7	150998541	C	T
rs375752214	16787209	1636	ACE	umls:C0948008	BeFree	However, it is the interplay of both environmental and common genetic factors [such as the Leiden V, methylenetetrahydrofolate reductase C677T, apolipopotein E 4, endothelial nitric oxide synthase G894T, angiotensin-converting enzyme I/D and angiotensin II type 1 receptor A1166C mutations and polymorphisms] that leads to the development of ischaemic stroke.	0.016058678	2006	NOS3	7	150998541	C	T
rs375752214	16787209	185	AGTR1	umls:C0948008	BeFree	However, it is the interplay of both environmental and common genetic factors [such as the Leiden V, methylenetetrahydrofolate reductase C677T, apolipopotein E 4, endothelial nitric oxide synthase G894T, angiotensin-converting enzyme I/D and angiotensin II type 1 receptor A1166C mutations and polymorphisms] that leads to the development of ischaemic stroke.	0.002171535	2006	NOS3	7	150998541	C	T
rs3760396	23198952	6347	CCL2	umls:C0948008	BeFree	This is a pilot study analysing association of chemokine gene polymorphisms (CXCL1, rs3117604; CXCL2, rs3806792; CCL2, rs2857656 and rs3760396; CCL5, rs2107538) in Korean patients with ischemic stroke (IS) (n = 120) and age-matched controls (n = 267).	0.003452799	2012	CCL2	17	34254422	G	C
rs3806792	23198952	6347	CCL2	umls:C0948008	BeFree	This is a pilot study analysing association of chemokine gene polymorphisms (CXCL1, rs3117604; CXCL2, rs3806792; CCL2, rs2857656 and rs3760396; CCL5, rs2107538) in Korean patients with ischemic stroke (IS) (n = 120) and age-matched controls (n = 267).	0.003452799	2012	CXCL2	4	74099557	T	C
rs3842788	21816595	241	ALOX5AP	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.009077134	2011	PTGS1	9	122377927	G	A
rs3842788	21816595	5743	PTGS2	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.002442977	2011	PTGS1	9	122377927	G	A
rs3842788	21816595	5742	PTGS1	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.001357209	2011	PTGS1	9	122377927	G	A
rs3842788	21816595	240	ALOX5	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.003257302	2011	PTGS1	9	122377927	G	A
rs386545618	16053469	4524	MTHFR	umls:C0948008	BeFree	The folate-sensitive polymorphism methylenetetrahydrofolate reductase (MTHFR) c. 677 C > T (A222V) referred a non-significant risk of ischemic stroke (odds ratio: 1.20) in all patients, and homozygosity for MTHFR c. 677 C > T was associated with an earlier onset of stroke selectively in patients younger than 60 years (38 +/- 3 years vs. 45 +/- 1 years; P = 0.043).	0.02920744	2005	NA	NA	NA	NA	NA
rs386545618	15576298	4524	MTHFR	umls:C0948008	BeFree	Methylenetetrahydrofolate reductase gene A222V polymorphism and risk of ischemic stroke.	0.02920744	2004	NA	NA	NA	NA	NA
rs386556114	16446539	19	ABCA1	umls:C0948008	BeFree	We investigated 244 unrelated, consecutively enrolled patients with ischemic stroke, 150 patients with coronary heart disease (CHD) and 193 blood donors for allele frequencies (AFs) of three common ABCA1 polymorphisms (R219K, V771M and I883M).	0.001085767	2006	NA	NA	NA	NA	NA
rs386556293	24107402	177	AGER	umls:C0948008	BeFree	Among the studied polymorphisms, only the polymorphism at 82G/S of RAGE gene was associated with the risk for ischemic stroke irrespective of the stroke subtypes.	0.000814326	2013	NA	NA	NA	NA	NA
rs386592567	21816595	5743	PTGS2	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.002442977	2011	NA	NA	NA	NA	NA
rs386592567	21816595	240	ALOX5	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.003257302	2011	NA	NA	NA	NA	NA
rs386592567	21816595	5742	PTGS1	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.001357209	2011	NA	NA	NA	NA	NA
rs386592567	21816595	241	ALOX5AP	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.009077134	2011	NA	NA	NA	NA	NA
rs386602118	24035862	627	BDNF	umls:C0948008	BeFree	Brain-derived neurotrophic factor G196A polymorphism predicts 90-day outcome of ischemic stroke in Chinese: a novel finding.	0.002171535	2013	NA	NA	NA	NA	NA
rs386602276	17401157	3356	HTR2A	umls:C0948008	BeFree	Association of the 5-HT2A receptor gene polymorphism 102T/C with ischemic stroke.	0.000271442	2006	NA	NA	NA	NA	NA
rs3918232	24986538	4846	NOS3	umls:C0948008	BeFree	Screening of the NOS3 gene identifies the variants 894G/T, 1998C/G and 2479G/A to be associated with acute onset ischemic stroke in young Asian Indians.	0.015244352	2014	NOS3	7	151009552	G	A
rs397507444	23642756	4524	MTHFR	umls:C0948008	BeFree	Methylenetetrahydrofolate reductase (C677T and A1298C) polymorphisms, hyperhomocysteinemia, and ischemic stroke in Tunisian patients.	0.02920744	2013	MTHFR	1	11794407	T	G
rs397507444	17113927	4524	MTHFR	umls:C0948008	BeFree	In conclusion, the C677T and A1298C polymorphisms of the MTHFR gene are genetic risk factors for hamorrhagic and ischemic stroke respectively, independent of other atherothrombotic risk factors.	0.02920744	2006	MTHFR	1	11794407	T	G
rs397507444	24128767	4524	MTHFR	umls:C0948008	BeFree	Association of the A1298C polymorphism in MTHFR gene with ischemic stroke.	0.02920744	2013	MTHFR	1	11794407	T	G
rs397507444	25440348	4524	MTHFR	umls:C0948008	BeFree	An analysis of the results obtained in this study and a critical review of previously published studies indicate that the A1298C polymorphism of the MTHFR gene is not related to ischemic stroke in children.	0.02920744	2014	MTHFR	1	11794407	T	G
rs4044210	19403135	3993	LLGL2	umls:C0948008	BeFree	After DNA sequencing of linkage disequilibrium blocks containing these SNPs, three tag SNPs (rs6007897 of CELSR1, rs1671021 of LLGL2, and rs1062708 of RUVBL2) and a nonsynonymous SNP (rs4044210 of CELSR1) were examined for their relation to ischemic stroke in subject panels B and C. Both rs6007897 (A-->G, Thr2268Ala) and rs4044210 (A-->G, Ile2107Val) of CELSR1 as well as rs1671021 (T-->C, Phe479Leu) of LLGL2 were significantly associated with ischemic stroke in subject panel B.	0.000542884	2009	CELSR1	22	46390418	T	C
rs4044210	21511255	10856	RUVBL2	umls:C0948008	BeFree	Our aim was to test the association of four polymorphisms (rs1671021 in LLGL2, rs753307 in RUVBL2, rs6007897 and rs4044210 in CELSR1) previously identified as ischemic stroke (IS) risk factors in a phased GWAS performed on 6341 Japanese individuals [1].	0.000542884	2011	CELSR1	22	46390418	T	C
rs4044210	21511255	3993	LLGL2	umls:C0948008	BeFree	Our aim was to test the association of four polymorphisms (rs1671021 in LLGL2, rs753307 in RUVBL2, rs6007897 and rs4044210 in CELSR1) previously identified as ischemic stroke (IS) risk factors in a phased GWAS performed on 6341 Japanese individuals [1].	0.000542884	2011	CELSR1	22	46390418	T	C
rs4044210	25117632	9620	CELSR1	umls:C0948008	BeFree	The CELSR1 polymorphisms rs6007897 and rs4044210 are associated with ischaemic stroke in Chinese Han population.	0.000814326	2015	CELSR1	22	46390418	T	C
rs4044210	19403135	10856	RUVBL2	umls:C0948008	BeFree	After DNA sequencing of linkage disequilibrium blocks containing these SNPs, three tag SNPs (rs6007897 of CELSR1, rs1671021 of LLGL2, and rs1062708 of RUVBL2) and a nonsynonymous SNP (rs4044210 of CELSR1) were examined for their relation to ischemic stroke in subject panels B and C. Both rs6007897 (A-->G, Thr2268Ala) and rs4044210 (A-->G, Ile2107Val) of CELSR1 as well as rs1671021 (T-->C, Phe479Leu) of LLGL2 were significantly associated with ischemic stroke in subject panel B.	0.000542884	2009	CELSR1	22	46390418	T	C
rs4073259	22849376	241	ALOX5AP	umls:C0948008	BeFree	These results suggest the ALOX5AP SNP A allele in rs4073259 and genotype rs9579646 GG, rs9551963 AC, and haplotype rs9315050 & rs9551963 AAAC were associated with an increased risk of ischemic stroke in the Han population, while rs4073259 GG was associated with a decreased risk.	0.009077134	2012	ALOX5AP	13	30732134	G	A
rs41322052	24325389	4846	NOS3	umls:C0948008	BeFree	Association between endothelial nitric oxide synthase gene polymorphism (T-786C) and ischemic stroke susceptibility: a meta-analysis.	0.015244352	2015	NOS3	7	150993018	C	T
rs41322052	17108813	4846	NOS3	umls:C0948008	BeFree	An interaction between the E298D and T-786C polymorphisms in NOS3, cigarette smoking, and risk of incident coronary heart disease and ischemic stroke events appears to exist, suggesting a potential complex interplay between genetic and environmental factors and cardiovascular disease risk.	0.015244352	2006	NOS3	7	150993018	C	T
rs41322052	23544143	4846	NOS3	umls:C0948008	BeFree	The meta-analysis indicated that eNOS gene 4b/a, T-786C, G894T polymorphism might be associated with IS.	0.015244352	2013	NOS3	7	150993018	C	T
rs41507953	20065888	2053	EPHX2	umls:C0948008	BeFree	Homozygosity for the EPHX2 K55R polymorphism increases the long-term risk of ischemic stroke in men: a study in Swedes.	0.003995683	2010	EPHX2	8	27500988	A	G
rs4252243	23096091	3586	IL10	umls:C0948008	BeFree	To investigate whether IL10, IL10RA, and IL10RB polymorphisms are associated with the risk of ischemic stroke (IS), selected two IL10 SNPs (rs1518111 and rs1554286), three IL10RA SNPs (rs2256111, rs4252243, and rs2228054), and two IL10RB SNPs (rs999788 and rs2834167) were analyzed in 120 patients with IS and 285 control subjects.	0.002171535	2013	IL10RA	11	117985012	C	T
rs434473	21816595	241	ALOX5AP	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.009077134	2011	ALOX12;ALOX12-AS1	17	7001615	A	G
rs434473	21816595	5743	PTGS2	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.002442977	2011	ALOX12;ALOX12-AS1	17	7001615	A	G
rs434473	21816595	5742	PTGS1	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.001357209	2011	ALOX12;ALOX12-AS1	17	7001615	A	G
rs434473	21816595	240	ALOX5	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.003257302	2011	ALOX12;ALOX12-AS1	17	7001615	A	G
rs4499545	20107840	54763	ROPN1	umls:C0948008	BeFree	One SNP (rs4499545) in the ROPN1-KALRN intergenic region and two SNPs in KALRN (rs17286604 and rs11712619) showed significant (P < 0.05) allelic and genotypic (unadjusted and adjusted for hypertension, diabetes, and ever smoking) association with IS risk.	0.000271442	2010	ROPN1	3	123986995	G	A
rs4795895	22769019	6356	CCL11	umls:C0948008	BeFree	In the non-hypertensive group, CCL11 rs3744508, LTC4S rs730012, FCER1B rs569108, TGFB1 rs1800469, LTA rs909253 and CCL11 rs4795895 were associated with ischemic stroke.	0.000542884	2012	CCL11	17	34284427	A	G
rs4975709	21779381	50805	IRX4	umls:C0948008	BeFree	Among migraineurs with aura rs7698623 in MEPE (OR = 6.37; 95% CI 3.15-12.90; p = 2.7×10(-7)) and rs4975709 in IRX4 (OR = 5.06; 95% CI 2.66-9.62; p = 7.7×10(-7)) appeared to be associated with ischemic stroke, rs2143678 located close to MDF1 with major CVD (OR = 3.05; 95% CI 1.98-4.69; p = 4.3×10(-7)), and the intergenic rs1406961 with CVD death (OR = 12.33; 95% CI 4.62-32.87; p = 5.2×10(-7)).	0.000271442	2011	IRX4	5	1877166	A	C
rs4975709	21779381	56955	MEPE	umls:C0948008	BeFree	Among migraineurs with aura rs7698623 in MEPE (OR = 6.37; 95% CI 3.15-12.90; p = 2.7×10(-7)) and rs4975709 in IRX4 (OR = 5.06; 95% CI 2.66-9.62; p = 7.7×10(-7)) appeared to be associated with ischemic stroke, rs2143678 located close to MDF1 with major CVD (OR = 3.05; 95% CI 1.98-4.69; p = 4.3×10(-7)), and the intergenic rs1406961 with CVD death (OR = 12.33; 95% CI 4.62-32.87; p = 5.2×10(-7)).	0.000542884	2011	IRX4	5	1877166	A	C
rs4986790	15910856	7099	TLR4	umls:C0948008	BeFree	Toll-like receptor 4 gene C119A but not Asp299Gly polymorphism is associated with ischemic stroke among ethnic Chinese in Taiwan.	0.003995683	2005	TLR4	9	117713024	A	G
rs505151	24599757	255738	PCSK9	umls:C0948008	BeFree	Effect of E670G Polymorphism in PCSK9 Gene on the Risk and Severity of Coronary Heart Disease and Ischemic Stroke in a Tunisian Cohort.	0.000814326	2014	PCSK9	1	55063514	G	A
rs5063	25144711	4878	NPPA	umls:C0948008	BeFree	After adjusting for age, sex, BMI and hypertension status by logistic regression analysis, we found that NPPA rs5063 was significantly associated with both ischemic stroke (odds ratio [OR] 0.69; 95% confidence interval [CI], 0.52 to 0.90; P = 0.006) and cerebral hemorrhage(OR = 0.39; 95%CI, 0.19 to 0.78; P = 0.007).	0.001085767	2014	NPPA;NPPA-AS1	1	11847591	C	T
rs5065	22400494	4878	NPPA	umls:C0948008	BeFree	However, in logistic analysis for Trial of Org 10172 in Acute Stroke Treatment (TOAST) classification of ischemic stroke, nonsynonymous rs5065 (STOP152Arg) and rs5067 in 3'UTR of NPPA, which were in complete linkage disequilibrium, showed significant associations with cardioembolic stroke.	0.001085767	2012	NPPA;NPPA-AS1	1	11846011	A	G
rs5067	22400494	4878	NPPA	umls:C0948008	BeFree	However, in logistic analysis for Trial of Org 10172 in Acute Stroke Treatment (TOAST) classification of ischemic stroke, nonsynonymous rs5065 (STOP152Arg) and rs5067 in 3'UTR of NPPA, which were in complete linkage disequilibrium, showed significant associations with cardioembolic stroke.	0.001085767	2012	NPPA;NPPA-AS1	1	11845924	A	G,T
rs5186	24981111	185	AGTR1	umls:C0948008	BeFree	A polymorphism in the angiotensin II type 1 receptor gene (AGTR1/rs5186) has been associated with an increased risk for arterial stiffness, hypertension, and ischemic stroke.	0.002171535	2014	AGTR1	3	148742201	A	C
rs5275	21816595	241	ALOX5AP	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.009077134	2011	PTGS2	1	186673926	A	G
rs5275	21816595	5743	PTGS2	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.002442977	2011	PTGS2	1	186673926	A	G
rs5275	21816595	5742	PTGS1	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.001357209	2011	PTGS2	1	186673926	A	G
rs5275	20472470	5743	PTGS2	umls:C0948008	BeFree	Impact of COX-2 rs5275 and rs20417 and GPIIIa rs5918 polymorphisms on 90-day ischemic stroke functional outcome: a novel finding.	0.002442977	2011	PTGS2	1	186673926	A	G
rs5275	21816595	240	ALOX5	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.003257302	2011	PTGS2	1	186673926	A	G
rs5370	24633486	1906	EDN1	umls:C0948008	BeFree	In EDN1 gene, T allele of rs5370 and G allele of rs2070699 may be IS incidence risk factors in Northern Han male population.	0.000271442	2015	EDN1	6	12296022	G	T
rs5498	12637697	3569	IL6	umls:C0948008	BeFree	Synergistic effect of -174 G/C polymorphism of the interleukin-6 gene promoter and 469 E/K polymorphism of the intercellular adhesion molecule-1 gene in Italian patients with history of ischemic stroke.	0.010162901	2003	ICAM1;ICAM4;LOC105372272	19	10285007	A	G
rs5498	17089918	3383	ICAM1	umls:C0948008	BeFree	The K469E polymorphism of the ICAM-1 gene has recently been associated with ischemic stroke, atherosclerosis of femoral arteries and microvascular complications of type 2 diabetes.	0.00554839	2006	ICAM1;ICAM4;LOC105372272	19	10285007	A	G
rs5498	18791855	3383	ICAM1	umls:C0948008	BeFree	Intercellular adhesion molecule-1 gene K469E polymorphism and ischemic stroke: a case-control study in a Chinese population.	0.00554839	2009	ICAM1;ICAM4;LOC105372272	19	10285007	A	G
rs5498	12637697	3383	ICAM1	umls:C0948008	BeFree	Synergistic effect of -174 G/C polymorphism of the interleukin-6 gene promoter and 469 E/K polymorphism of the intercellular adhesion molecule-1 gene in Italian patients with history of ischemic stroke.	0.00554839	2003	ICAM1;ICAM4;LOC105372272	19	10285007	A	G
rs5628	21816595	240	ALOX5	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.003257302	2011	PTGIS	20	49524145	C	A,G,T
rs5628	21816595	5742	PTGS1	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.001357209	2011	PTGIS	20	49524145	C	A,G,T
rs5628	21816595	241	ALOX5AP	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.009077134	2011	PTGIS	20	49524145	C	A,G,T
rs5628	21816595	5743	PTGS2	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.002442977	2011	PTGIS	20	49524145	C	A,G,T
rs569108	22769019	6356	CCL11	umls:C0948008	BeFree	In the non-hypertensive group, CCL11 rs3744508, LTC4S rs730012, FCER1B rs569108, TGFB1 rs1800469, LTA rs909253 and CCL11 rs4795895 were associated with ischemic stroke.	0.000542884	2012	MS4A2	11	60095631	A	G
rs5918	20472470	5743	PTGS2	umls:C0948008	BeFree	Impact of COX-2 rs5275 and rs20417 and GPIIIa rs5918 polymorphisms on 90-day ischemic stroke functional outcome: a novel finding.	0.002442977	2011	ITGB3	17	47283364	T	C
rs6007897	19403135	3993	LLGL2	umls:C0948008	BeFree	After DNA sequencing of linkage disequilibrium blocks containing these SNPs, three tag SNPs (rs6007897 of CELSR1, rs1671021 of LLGL2, and rs1062708 of RUVBL2) and a nonsynonymous SNP (rs4044210 of CELSR1) were examined for their relation to ischemic stroke in subject panels B and C. Both rs6007897 (A-->G, Thr2268Ala) and rs4044210 (A-->G, Ile2107Val) of CELSR1 as well as rs1671021 (T-->C, Phe479Leu) of LLGL2 were significantly associated with ischemic stroke in subject panel B.	0.000542884	2009	CELSR1	22	46384624	T	C
rs6007897	19403135	10856	RUVBL2	umls:C0948008	BeFree	After DNA sequencing of linkage disequilibrium blocks containing these SNPs, three tag SNPs (rs6007897 of CELSR1, rs1671021 of LLGL2, and rs1062708 of RUVBL2) and a nonsynonymous SNP (rs4044210 of CELSR1) were examined for their relation to ischemic stroke in subject panels B and C. Both rs6007897 (A-->G, Thr2268Ala) and rs4044210 (A-->G, Ile2107Val) of CELSR1 as well as rs1671021 (T-->C, Phe479Leu) of LLGL2 were significantly associated with ischemic stroke in subject panel B.	0.000542884	2009	CELSR1	22	46384624	T	C
rs6007897	25117632	9620	CELSR1	umls:C0948008	BeFree	The CELSR1 polymorphisms rs6007897 and rs4044210 are associated with ischaemic stroke in Chinese Han population.	0.000814326	2015	CELSR1	22	46384624	T	C
rs6007897	21511255	3993	LLGL2	umls:C0948008	BeFree	Our aim was to test the association of four polymorphisms (rs1671021 in LLGL2, rs753307 in RUVBL2, rs6007897 and rs4044210 in CELSR1) previously identified as ischemic stroke (IS) risk factors in a phased GWAS performed on 6341 Japanese individuals [1].	0.000542884	2011	CELSR1	22	46384624	T	C
rs6007897	21511255	10856	RUVBL2	umls:C0948008	BeFree	Our aim was to test the association of four polymorphisms (rs1671021 in LLGL2, rs753307 in RUVBL2, rs6007897 and rs4044210 in CELSR1) previously identified as ischemic stroke (IS) risk factors in a phased GWAS performed on 6341 Japanese individuals [1].	0.000542884	2011	CELSR1	22	46384624	T	C
rs6313	17401157	3356	HTR2A	umls:C0948008	BeFree	Association of the 5-HT2A receptor gene polymorphism 102T/C with ischemic stroke.	0.000271442	2006	HTR2A	13	46895805	G	A
rs6538697	23079278	240	ALOX5	umls:C0948008	BeFree	In combined analysis of multiple genes and loci, individuals with ALOX5AP rs12429692 T allele, ALOX5 rs2029253 A allele, and LTA4H rs6538697 C allele suggested a significantly increased susceptibility to IS (adjusted OR, 1.70; 95% CI, 1.07-2.69; P=0.024).	0.003257302	2012	LTA4H;LOC102723340	12	96009832	T	C
rs6538697	23079278	4056	LTC4S	umls:C0948008	BeFree	Under the recessive genetic model, ALOX5 rs2029253 variant reduced IS risk (adjusted OR, 0.78; 95% CI, 0.60-1.00; P=0.048) while LTA4H rs6538697 and LTC4S rs730012 variants increased (adjusted OR, 1.66; 95% CI, 1.04-2.64; P=0.032 and adjusted OR, 3.63; 95% CI, 1.01-13.05; P=0.048, respectively).	0.000814326	2012	LTA4H;LOC102723340	12	96009832	T	C
rs6538697	23079278	4048	LTA4H	umls:C0948008	BeFree	In combined analysis of multiple genes and loci, individuals with ALOX5AP rs12429692 T allele, ALOX5 rs2029253 A allele, and LTA4H rs6538697 C allele suggested a significantly increased susceptibility to IS (adjusted OR, 1.70; 95% CI, 1.07-2.69; P=0.024).	0.000542884	2012	LTA4H;LOC102723340	12	96009832	T	C
rs6538697	23079278	241	ALOX5AP	umls:C0948008	BeFree	In combined analysis of multiple genes and loci, individuals with ALOX5AP rs12429692 T allele, ALOX5 rs2029253 A allele, and LTA4H rs6538697 C allele suggested a significantly increased susceptibility to IS (adjusted OR, 1.70; 95% CI, 1.07-2.69; P=0.024).	0.009077134	2012	LTA4H;LOC102723340	12	96009832	T	C
rs662	17406108	5444	PON1	umls:C0948008	BeFree	We studied the significance of the Q192R and M55L polymorphisms of the PON1 gene and the C311S polymorphism of the PON2 gene in different etiologies of ischemic stroke.	0.01062984	2007	PON1	7	95308134	T	C
rs662	17406108	5445	PON2	umls:C0948008	BeFree	We studied the significance of the Q192R and M55L polymorphisms of the PON1 gene and the C311S polymorphism of the PON2 gene in different etiologies of ischemic stroke.	0.00554839	2007	PON1	7	95308134	T	C
rs662	17920578	5444	PON1	umls:C0948008	BeFree	Paraoxonase/arylesterase ratio, PON1 192Q/R polymorphism and PON1 status are associated with increased risk of ischemic stroke.	0.01062984	2008	PON1	7	95308134	T	C
rs662	24433930	5444	PON1	umls:C0948008	BeFree	The salt stimulation property of serum paraoxonase (PON1) could be a valuable factor in evaluating the enzyme status in ischemic stroke: the role of activity-determined PON1 192Q/R phenotypes.	0.01062984	2014	PON1	7	95308134	T	C
rs662799	16954607	116519	APOA5	umls:C0948008	BeFree	Apolipoprotein A5 gene promoter region T-1131C polymorphism associates with elevated circulating triglyceride levels and confers susceptibility for development of ischemic stroke.	0.004267125	2006	APOA5	11	116792991	G	A
rs7007329	16953275	100128998	C20orf181	umls:C0948008	BeFree	These results suggest that the G-T haplotype at rs7007329-rs8178750 of the tPA gene is a genetic marker for IS, and that tPA or a neighboring gene is a susceptibility gene for IS.	0.004071628	2006	NA	8	42212037	C	G
rs7193343	25325233	463	ZFHX3	umls:C0948008	BeFree	Nonparametric linkage analysis revealed that the rs1800796 polymorphism in the interleukin-6 (IL-6) gene is significantly linked to the small arterial occlusion (SAO) subtype (p=0.022), while the rs7193343 polymorphism in the ZFHX3 gene is linked to IS (p=0.002) under the dominant model.	0.000814326	2015	ZFHX3	16	72995261	T	C
rs730012	23079278	4056	LTC4S	umls:C0948008	BeFree	Under the recessive genetic model, ALOX5 rs2029253 variant reduced IS risk (adjusted OR, 0.78; 95% CI, 0.60-1.00; P=0.048) while LTA4H rs6538697 and LTC4S rs730012 variants increased (adjusted OR, 1.66; 95% CI, 1.04-2.64; P=0.032 and adjusted OR, 3.63; 95% CI, 1.01-13.05; P=0.048, respectively).	0.000814326	2012	LTC4S	5	179793637	A	C
rs730012	22769019	6356	CCL11	umls:C0948008	BeFree	In the non-hypertensive group, CCL11 rs3744508, LTC4S rs730012, FCER1B rs569108, TGFB1 rs1800469, LTA rs909253 and CCL11 rs4795895 were associated with ischemic stroke.	0.000542884	2012	LTC4S	5	179793637	A	C
rs7493	17406108	5445	PON2	umls:C0948008	BeFree	We studied the significance of the Q192R and M55L polymorphisms of the PON1 gene and the C311S polymorphism of the PON2 gene in different etiologies of ischemic stroke.	0.00554839	2007	PON2	7	95405463	G	C
rs7493	22183305	5445	PON2	umls:C0948008	BeFree	Association between paraoxonase 2 Ser311Cys polymorphism and ischemic stroke risk: a meta-analysis involving 5,008 subjects.	0.00554839	2012	PON2	7	95405463	G	C
rs7493	17406108	5444	PON1	umls:C0948008	BeFree	We studied the significance of the Q192R and M55L polymorphisms of the PON1 gene and the C311S polymorphism of the PON2 gene in different etiologies of ischemic stroke.	0.01062984	2007	PON2	7	95405463	G	C
rs7506045	19647252	3613	IMPA2	umls:C0948008	BeFree	In a preliminary analysis of 268 controls and 531 IS cases, the rs10947803 SNP of KCNK17 (p=0.012) and the rs7506045 of IMPA2 (p=0.040) were associated with IS, although only the KCNK17 gene was an independent risk factor for IS.	0.000271442	2010	IMPA2	18	11987273	C	T
rs751141	25839935	2053	EPHX2	umls:C0948008	BeFree	CYP2C8 rs17110453 and EPHX2 rs751141 two-locus interaction increases susceptibility to ischemic stroke.	0.003995683	2015	EPHX2	8	27516348	G	A
rs751141	25839935	1558	CYP2C8	umls:C0948008	BeFree	CYP2C8 rs17110453 and EPHX2 rs751141 two-locus interaction increases susceptibility to ischemic stroke.	0.000542884	2015	EPHX2	8	27516348	G	A
rs753307	21511255	10856	RUVBL2	umls:C0948008	BeFree	Our aim was to test the association of four polymorphisms (rs1671021 in LLGL2, rs753307 in RUVBL2, rs6007897 and rs4044210 in CELSR1) previously identified as ischemic stroke (IS) risk factors in a phased GWAS performed on 6341 Japanese individuals [1].	0.000542884	2011	RUVBL2	19	49015227	C	T
rs753307	21511255	3993	LLGL2	umls:C0948008	BeFree	Our aim was to test the association of four polymorphisms (rs1671021 in LLGL2, rs753307 in RUVBL2, rs6007897 and rs4044210 in CELSR1) previously identified as ischemic stroke (IS) risk factors in a phased GWAS performed on 6341 Japanese individuals [1].	0.000542884	2011	RUVBL2	19	49015227	C	T
rs75932628	23800361	54209	TREM2	umls:C0948008	BeFree	A significant association was observed for the TREM2 p.R47H substitution in susceptibility to frontotemporal dementia (OR = 5.06; p-value = 0.001) and Parkinson's disease (OR = 2.67; p-value = 0.026), while no evidence of association with risk of amyotrophic lateral sclerosis, progressive supranuclear palsy or ischemic stroke was observed.	0.000271442	2013	TREM2;LOC105375056	6	41161514	C	A,T
rs7698623	21779381	50805	IRX4	umls:C0948008	BeFree	Among migraineurs with aura rs7698623 in MEPE (OR = 6.37; 95% CI 3.15-12.90; p = 2.7×10(-7)) and rs4975709 in IRX4 (OR = 5.06; 95% CI 2.66-9.62; p = 7.7×10(-7)) appeared to be associated with ischemic stroke, rs2143678 located close to MDF1 with major CVD (OR = 3.05; 95% CI 1.98-4.69; p = 4.3×10(-7)), and the intergenic rs1406961 with CVD death (OR = 12.33; 95% CI 4.62-32.87; p = 5.2×10(-7)).	0.000271442	2011	MEPE	4	87834676	T	A,C
rs7698623	21779381	56955	MEPE	umls:C0948008	BeFree	Among migraineurs with aura rs7698623 in MEPE (OR = 6.37; 95% CI 3.15-12.90; p = 2.7×10(-7)) and rs4975709 in IRX4 (OR = 5.06; 95% CI 2.66-9.62; p = 7.7×10(-7)) appeared to be associated with ischemic stroke, rs2143678 located close to MDF1 with major CVD (OR = 3.05; 95% CI 1.98-4.69; p = 4.3×10(-7)), and the intergenic rs1406961 with CVD death (OR = 12.33; 95% CI 4.62-32.87; p = 5.2×10(-7)).	0.000542884	2011	MEPE	4	87834676	T	A,C
rs7872802	21816595	5743	PTGS2	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.002442977	2011	PTGES	9	129753451	A	G
rs7872802	21816595	241	ALOX5AP	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.009077134	2011	PTGES	9	129753451	A	G
rs7872802	21816595	240	ALOX5	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.003257302	2011	PTGES	9	129753451	A	G
rs7872802	21816595	5742	PTGS1	umls:C0948008	BeFree	To investigate whether single nucleotide polymorphisms (SNPs) of eicosanoid biosynthesis genes are associated with intracerebral hemorrhage (ICH) and ischemic stroke (IS), seven SNPs in the coding or promoter regions were selected: ALOX12 (rs434473, Asn322Ser), ALOX5 (rs2228064, Thr90Thr), ALOX5AP (rs17222919, -1316T/G), PTGES (rs7872802, -404A/G), PTGIS (rs5628, Leu256Leu), PTGS1 (rs3842788, Gln41Gln) and PTGS2 (rs5275, 3'UTR).	0.001357209	2011	PTGES	9	129753451	A	G
rs8178750	16953275	100128998	C20orf181	umls:C0948008	BeFree	These results suggest that the G-T haplotype at rs7007329-rs8178750 of the tPA gene is a genetic marker for IS, and that tPA or a neighboring gene is a susceptibility gene for IS.	0.004071628	2006	PLAT	8	42187353	G	A
rs841	21963893	2643	GCH1	umls:C0948008	BeFree	One SNP located in the intron of GCH1 (rs841) was associated with IS independent of the traditional cardiovascular risk factors in co-dominant and dominant models (P=0.003, q=0.027; P=0.00006, q=0.0108; respectively).	0.000542884	2011	GCH1	14	54843774	G	A
rs854560	17406108	5444	PON1	umls:C0948008	BeFree	We studied the significance of the Q192R and M55L polymorphisms of the PON1 gene and the C311S polymorphism of the PON2 gene in different etiologies of ischemic stroke.	0.01062984	2007	PON1	7	95316772	A	C,G,N,T
rs854560	17406108	5445	PON2	umls:C0948008	BeFree	We studied the significance of the Q192R and M55L polymorphisms of the PON1 gene and the C311S polymorphism of the PON2 gene in different etiologies of ischemic stroke.	0.00554839	2007	PON1	7	95316772	A	C,G,N,T
rs909253	22769019	6356	CCL11	umls:C0948008	BeFree	In the non-hypertensive group, CCL11 rs3744508, LTC4S rs730012, FCER1B rs569108, TGFB1 rs1800469, LTA rs909253 and CCL11 rs4795895 were associated with ischemic stroke.	0.000542884	2012	LTA;LOC100287329	6	31572536	A	G
rs9315050	22849376	241	ALOX5AP	umls:C0948008	BeFree	These results suggest the ALOX5AP SNP A allele in rs4073259 and genotype rs9579646 GG, rs9551963 AC, and haplotype rs9315050 & rs9551963 AAAC were associated with an increased risk of ischemic stroke in the Han population, while rs4073259 GG was associated with a decreased risk.	0.009077134	2012	ALOX5AP	13	30761908	A	G
rs9551963	22849376	241	ALOX5AP	umls:C0948008	BeFree	These results suggest the ALOX5AP SNP A allele in rs4073259 and genotype rs9579646 GG, rs9551963 AC, and haplotype rs9315050 & rs9551963 AAAC were associated with an increased risk of ischemic stroke in the Han population, while rs4073259 GG was associated with a decreased risk.	0.009077134	2012	ALOX5AP	13	30758410	A	C
rs9579646	22849376	241	ALOX5AP	umls:C0948008	BeFree	These results suggest the ALOX5AP SNP A allele in rs4073259 and genotype rs9579646 GG, rs9551963 AC, and haplotype rs9315050 & rs9551963 AAAC were associated with an increased risk of ischemic stroke in the Han population, while rs4073259 GG was associated with a decreased risk.	0.009077134	2012	ALOX5AP	13	30736442	G	A
rs966221	23863764	5144	PDE4D	umls:C0948008	BeFree	A PDE4D polymorphism, single-nucleotide polymorphism (SNP) 83 (rs966221), is associated with ischemic stroke.	0.031346637	2014	PDE4D	5	60206693	A	G
rs999788	23096091	3586	IL10	umls:C0948008	BeFree	To investigate whether IL10, IL10RA, and IL10RB polymorphisms are associated with the risk of ischemic stroke (IS), selected two IL10 SNPs (rs1518111 and rs1554286), three IL10RA SNPs (rs2256111, rs4252243, and rs2228054), and two IL10RB SNPs (rs999788 and rs2834167) were analyzed in 120 patients with IS and 285 control subjects.	0.002171535	2013	IL10RB;IL10RB-AS1	21	33265726	C	T

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:542)
CHR	POS	SNPID	REF	ALT	ORI_SNPID	PMID	P_VALUE	P_VALUE_TEXT	OR/BETA	CI95_TEXT	GWAS_INITIAL_SAMPLE_SIZE	SUB_POPULATION	SUPER_POPULATION	GWAS_TRAIT	HPO_ID	HPO_TERM	DO_ID	DO_TERM	MESH_ID	MESH_TERM	EFO_ID	EFO_TERM	DOLITE_TERM	RISK_ALLELE	PUBLICATION_TYPE	AA	GENE_SYMBOL	TYPE	REFGENE
1	5296844	rs2353169	T	C	rs2353169	17434096	9.98E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
1	8042826	rs161802	G	T	rs161802	24262325	2.00E-07	NA	1.11	[1.08-1.16]	12,389 cases; 62,004 controls	NOPOP(74393)	ALL(74393)	NOPOP(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs161802-T	Review	Research Support, N.I.H., Extramural	Meta-Analysis
1	8095500	rs225132	T	G	rs225132	24262325	6.00E-08	NA	1.12	[1.08-1.16]	12,389 cases; 62,004 controls	NOPOP(74393)	ALL(74393)	NOPOP(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs225132-G	Review	Research Support, N.I.H., Extramural	Meta-Analysis
1	15790639	rs11579489	G	A	rs11579489	22384361	3.00E-06	Cardioembolic stroke (lacunar stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
1	18391974	rs9286088	A	C	rs9286088	17434096	1.30E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
1	30993931	rs72650565	T	C	rs72650565	21957438	9.07E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
1	48017067	rs502392	T	C	rs502392	17434096	2.21E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
1	48713394	rs986027	C	T	rs986027	22384361	9.10E-06	Cardioembolic stroke (large artery stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
1	54011192	rs2986655	A	G	rs2986655	17434096	2.96E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
1	55304970	rs7549251	G	A	rs7549251	22384361	1.80E-06	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
1	63614961	rs1887808	G	A	rs1887808	22941190	4.62E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
1	76557784	rs1251575	A	G	rs1251575	17434096	6.05E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
1	88610289	rs1336578	C	T	rs1336578	22941190	6.44E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
1	102706193	rs11164428	C	G	rs11164428	21957438	2.50E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
1	114531480	rs12029840	C	T	rs12029840	22384361	4.30E-06	Cardioembolic stroke (lacunar stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
1	146940196	rs11240065	T	C	rs11240065	21957438	9.57E-07	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
1	146940196	rs148158062	T	TGTTCCTTC	rs11240065	21957438	9.57E-07	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
1	146940196	rs56352300	T	TGTTCCTTC	rs11240065	21957438	9.57E-07	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
1	146970946	rs10900374	G	A	rs10900374	21957438	6.32E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
1	146973797	rs1845807	G	A	rs1845807	21957438	6.22E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
1	146984463	rs17160321	G	A	rs17160321	21957438	9.65E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
1	146984515	rs17160322	A	G	rs17160322	21957438	9.65E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
1	146985525	rs17160327	G	T	rs17160327	21957438	9.58E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
1	146986473	rs1013587	A	G	rs1013587	21957438	9.63E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
1	146989520	rs12046574	C	T	rs12046574	21957438	9.60E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
1	156629037	rs11360	A	G	rs11360	17434096	3.57E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
1	164440415	rs12723400	G	A	rs12723400	17434096	7.02E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
1	175320746	rs10489319	T	C	rs10489319	22941190	8.46E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
1	175321636	rs2236886	C	G,T	rs2236886	22941190	8.29E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
1	175339089	rs16848329	A	G	rs16848329	22941190	7.85E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
1	175341548	rs16848353	G	A	rs16848353	22941190	8.01E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
1	175342485	rs12730963	T	C	rs12730963	22941190	8.15E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
1	176429600	rs7553073	A	G	rs7553073	22941190	5.59E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
1	176434044	rs7531549	G	A	rs7531549	22941190	3.91E-07	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
1	176435567	rs7515586	C	T	rs7515586	22941190	4.36E-07	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
1	192616195	rs4658062	G	A	rs4658062	17434096	1.20E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
1	207106478	rs291102	G	A	rs291102	17434096	6.84E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
1	207110888	rs291097	G	A	rs291097	17434096	6.84E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
1	210847740	rs4366378	A	C	rs4366378	17434096	2.13E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
1	237258799	rs16834810	G	A	rs16834810	22384361	3.30E-06	Ischemic stroke early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
1	243781174	rs320309	A	G	rs320309	17434096	8.14E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
1	243894782	rs10803155	A	G	rs10803155	17434096	1.33E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
1	243916478	rs1545654	A	T	rs1545654	17434096	1.33E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
1	243933568	rs897960	G	A	rs897960	17434096	3.83E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
1	244004392	rs4593807	G	A	rs4593807	17434096	3.12E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
2	3079363	rs62119855	C	T	rs62119855	21957438	9.09E-06	Ischemic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
2	3083625	rs7371392	A	G	rs7371392	21957438	8.49E-06	Ischemic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
2	3086833	rs10169682	C	T	rs10169682	21957438	2.63E-06	Ischemic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
2	3087454	rs12714371	T	A	rs12714371	21957438	9.03E-06	Ischemic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
2	3098843	rs4854189	G	A	rs4854189	21957438	2.09E-06	Ischemic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
2	3099075	rs1453822	T	G	rs1453822	21957438	6.18E-06	Ischemic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
2	6695161	rs1870131	C	T	rs1870131	17434096	2.63E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
2	9643688	rs12467921	A	G	rs12467921	22941190	9.12E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
2	9645789	rs2276338	C	T	rs2276338	22941190	8.66E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
2	9646388	rs7580419	C	T	rs7580419	22941190	8.93E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
2	9648215	rs10211522	C	T	rs10211522	22941190	9.25E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
2	9648374	rs17590793	G	C	rs17590793	22941190	9.65E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
2	39580377	rs2058863	G	A	rs2058863	17434096	4.01E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
2	53782559	rs13407662	C	T	rs13407662	23041239	5.00E-08	SVD	1.95	[1.53-2.48]	12,389 European ancestry cases; 62,004 European ancestry controls	European(74393)	ALL(74393)	EUR(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs13407662-T	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
2	59205954	rs7577730	T	G	rs7577730	21957438	7.42E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
2	101759350	rs17025300	T	C	rs17025300	22941190	5.44E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
2	107454575	rs2034357	G	A	rs2034357	17434096	7.77E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
2	135214570	rs10179686	C	T	rs10179686	24262325	8.00E-06	NA	1.69	[1.34-2.13]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	rs10179686-T
2	153473794	rs2304556	T	G	rs2304556	22384361	1.10E-04	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
2	153473794	rs2304556	T	G	rs2304556	22384361	1.20E-07	Ischemic stroke early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
2	153586899	rs1986743	A	G	rs1986743	22384361	2.70E-07	Ischemic stroke early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
2	153586899	rs1986743	A	G	rs1986743	22384361	3.90E-04	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
2	156754055	rs10193997	T	C	rs10193997	17434096	1.59E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
2	156756235	rs10198409	A	G	rs10198409	17434096	1.59E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
2	156759291	rs1402071	C	T	rs1402071	17434096	8.45E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
2	187731384	rs10497673	T	C	rs10497673	17434096	3.27E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
2	193035723	rs10191803	T	C	rs10191803	22384361	5.80E-06	Cardioembolic stroke (ischemic stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
2	220311039	rs748515	C	A	rs748515	17434096	8.89E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
2	222208451	rs1897119	G	C	rs1897119	22941190	5.05E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
3	6006004	rs17043997	A	G	rs17043997	22941190	6.16E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
3	7748736	rs9860560	T	G	rs9860560	22941190	5.51E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
3	7748843	rs1504047	T	G	rs1504047	22941190	5.51E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
3	7758042	rs1354407	A	G	rs1354407	22941190	5.55E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
3	8230904	rs13088606	C	T	rs13088606	22384361	6.10E-06	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
3	8233002	rs390783	T	C	rs390783	22384361	3.90E-06	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
3	8239386	rs4684589	G	A	rs4684589	22384361	9.80E-06	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
3	8240179	rs6780741	A	G	rs6780741	22384361	9.10E-06	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
3	24211739	rs2683530	T	C	rs2683530	17434096	6.32E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
3	64252968	rs1471377	A	G	rs1471377	22941190	7.92E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
3	65250132	rs7431862	G	A	rs7431862	21957438	2.73E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
3	78908171	rs1383407	T	C	rs1383407	21940970	7.63E-05	Ischemic stroke	NA	NA	223 cases; 248 stroke-affected siblings; 84 stroke-unaffected siblings	NOPOP(555)	ALL(555)	NOPOP(555)	ALL(555)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
3	87262998	rs1994487	A	G	rs1994487	22384361	4.80E-06	Cardioembolic stroke (large artery stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
3	112207075	rs546779181	C	CT	rs76802195	21957438	9.43E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
3	112207075	rs71134837	C	CT	rs76802195	21957438	9.43E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
3	112207075	rs76802195	C	T	rs76802195	21957438	9.43E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
3	140799213	rs16851055	G	A	rs16851055	23041239	6.00E-07	IS	1.12	[1.07-1.17]	12,389 European ancestry cases; 62,004 European ancestry controls	European(74393)	ALL(74393)	EUR(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs16851055-G	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
3	140799213	rs16851055	G	A	rs16851055	24262325	7.00E-07	NA	1.11	[1.06-1.16]	12,389 cases; 62,004 controls	NOPOP(74393)	ALL(74393)	NOPOP(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs16851055-A	Review	Research Support, N.I.H., Extramural	Meta-Analysis
3	140799213	rs16851055	G	A	rs16851055	24262325	8.00E-04	NA	1.16	[1.06-1.28]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	NA
3	151375575	rs4679898	T	C	rs4679898	22941190	9.18E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
3	171940305	rs34770855	A	G	rs34770855	21957438	6.94E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
3	171942911	rs79676570	T	G	rs79676570	21957438	7.87E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
3	171949208	rs11712833	G	A	rs11712833	21957438	8.08E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
3	171950181	rs35898760	C	T	rs35898760	21957438	8.19E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
3	171954098	rs6445051	A	G	rs6445051	21957438	8.19E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
3	171956029	rs34718992	A	G	rs34718992	21957438	8.19E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
3	187711072	rs57649868	C	T	rs57649868	21957438	7.77E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
3	187718139	rs35198260	G	A	rs35198260	21957438	7.45E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
3	187998081	rs6792835	C	G	rs6792835	24262325	1.16E-05	NA	1.46	[1.23-1.73]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	rs6792835-G
4	5159654	rs7683724	A	G	rs7683724	22941190	6.06E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
4	20760089	rs4697177	T	G	rs4697177	17434096	6.80E-04	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
4	24749535	rs17621680	A	G	rs17621680	21957438	9.51E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	24750063	rs6851578	C	T	rs6851578	21957438	4.84E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	24750082	rs10021418	T	C	rs10021418	21957438	4.84E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	24750934	rs12505599	C	T	rs12505599	21957438	4.91E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	24753718	rs60978593	C	G	rs60978593	21957438	4.83E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	28821006	rs6844183	A	G	rs6844183	21957438	9.03E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	28824300	rs12503203	T	A	rs12503203	21957438	9.33E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	28827874	rs4479690	T	C	rs4479690	21957438	5.02E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	35081710	rs12504677	A	G	rs12504677	21957438	8.65E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	35081710	rs148746864	A	ATGCCTGCAGCAGAAGCCGG	rs12504677	21957438	8.65E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	35081710	rs71196002	A	ATGCCTGCAGCAGAAGCCGG	rs12504677	21957438	8.65E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	46721833	rs6853207	C	T	rs6853207	17434096	5.76E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
4	56285305	rs504836	C	T	rs504836	17434096	6.58E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
4	56290220	rs534654	A	G	rs534654	17434096	6.58E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
4	63378266	rs13126803	T	G	rs13126803	17434096	1.20E-04	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
4	68515155	rs354872	T	C	rs354872	17434096	5.27E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
4	74598809	rs4694636	G	T	rs4694636	22384361	7.70E-06	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
4	74600211	rs11730667	G	A	rs11730667	22384361	2.60E-06	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
4	86720838	rs7699404	T	C	rs7699404	22941190	9.58E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
4	97266060	rs4146411	G	A	rs4146411	17434096	6.55E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
4	97757127	rs1922859	C	T	rs1922859	17434096	8.71E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
4	111699326	rs12646447	T	C	rs12646447	24262325	3.00E-08	NA	1.14	[1.09-1.20]	12,389 cases; 62,004 controls	NOPOP(74393)	ALL(74393)	NOPOP(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs12646447-C	Review	Research Support, N.I.H., Extramural	Meta-Analysis
4	111710169	rs2200733	C	T	rs2200733	18991354	2.00E-10	NA	1.26	[1.17-1.35]	1,661 cases; 10,815 controls	NOPOP(12476)	ALL(12476)	NOPOP(12476)	ALL(12476)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs2200733-T	Multicenter Study	Research Support, Non-U.S. Gov't	C
4	111718067	rs6843082	G	A	rs6843082	23041239	2.00E-07	IS	1.11	[1.06-1.15]	12,389 European ancestry cases; 62,004 European ancestry controls	European(74393)	ALL(74393)	EUR(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs6843082-G	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
4	111718067	rs6843082	G	A	rs6843082	23041239	3.00E-16	CS	1.36	[1.27-1.47]	12,389 European ancestry cases; 62,004 European ancestry controls	European(74393)	ALL(74393)	EUR(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs6843082-G	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
4	122893191	rs10032994	G	A	rs10032994	21957438	1.04E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	123884646	rs1458756	A	G	rs1458756	22941190	3.05E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
4	126105391	rs2390774	T	C	rs2390774	21957438	9.78E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126105423	rs77237251	G	C	rs77237251	21957438	9.71E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126108001	rs10015153	C	T	rs10015153	21957438	3.11E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126115911	rs74446632	C	T	rs74446632	21957438	8.57E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126116796	rs75132432	G	A	rs75132432	21957438	8.74E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126120454	rs17009284	C	T	rs17009284	21957438	6.74E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126120908	rs17009293	C	T	rs17009293	21957438	6.68E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126120973	rs17009295	T	C	rs17009295	21957438	6.66E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126121029	rs75411930	T	C	rs75411930	21957438	5.73E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126121347	rs77848747	C	T	rs77848747	21957438	6.35E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126123188	rs79880362	C	T	rs79880362	21957438	6.16E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126123223	rs77111565	A	T	rs77111565	21957438	6.14E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126124653	rs76347205	T	C	rs76347205	21957438	6.18E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126124687	rs74528143	T	C	rs74528143	21957438	6.18E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126124816	rs77794498	G	A	rs77794498	21957438	6.19E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126125193	rs78584562	C	T	rs78584562	21957438	6.19E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126125280	rs113925077	T	C	rs113925077	21957438	6.19E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126125447	rs113317289	C	A,T	rs113317289	21957438	6.19E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126125656	rs111724418	C	T	rs111724418	21957438	6.19E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126125674	rs80174004	T	G	rs80174004	21957438	6.21E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126125703	rs79089592	G	T	rs79089592	21957438	6.22E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126126029	rs80304652	G	T	rs80304652	21957438	6.22E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126126033	rs79297447	T	C	rs79297447	21957438	6.18E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126126050	rs111871934	G	T	rs111871934	21957438	6.19E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126126443	rs181908164	C	G	rs10715778	21957438	6.19E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126126454	rs369671596	AAAAAC	A	rs74619085	21957438	6.20E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126126454	rs74619085	A	C	rs74619085	21957438	6.20E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126127051	rs112971835	C	T	rs112971835	21957438	6.15E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126128221	rs77483077	T	C	rs77483077	21957438	6.12E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126128258	rs79935447	C	T	rs79935447	21957438	6.13E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126128557	rs111868999	C	T	rs111868999	21957438	6.10E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126128567	rs116714449	T	C	rs116714449	21957438	6.10E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126129312	rs76938166	A	G	rs76938166	21957438	6.07E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126129362	rs76916795	T	C	rs76916795	21957438	6.05E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126129496	rs80286028	G	A	rs80286028	21957438	6.05E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126129527	rs74686632	T	G	rs74686632	21957438	6.04E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126130124	rs75378844	C	G	rs75378844	21957438	6.03E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126130191	rs76662258	G	T	rs76662258	21957438	6.03E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126130263	rs78444453	C	T	rs78444453	21957438	6.00E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126132763	rs75997408	C	T	rs75997408	21957438	5.99E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126133816	rs79350978	C	T	rs79350978	21957438	5.99E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126134008	rs74621709	C	T	rs74621709	21957438	5.98E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126134308	rs77791386	T	C	rs77791386	21957438	5.98E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126134671	rs75721283	A	G	rs75721283	21957438	5.96E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	126137769	rs79274102	A	C	rs79274102	21957438	5.87E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	155440450	rs6834179	A	G	rs6834179	21957438	6.91E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	155446305	rs4482740	G	A	rs4482740	21957438	3.23E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
4	184612553	rs67383011	G	C	rs67383011	22384361	3.00E-06	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
5	1966852	rs16902181	C	T	rs16902181	17434096	9.76E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
5	9335344	rs1205731	G	A	rs1205731	17434096	4.77E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
5	24262450	rs13178734	T	C	rs13178734	17434096	7.25E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
5	24269794	rs7700267	G	A	rs7700267	17434096	5.96E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
5	61495113	rs17366217	C	T	rs17366217	22384361	2.00E-06	Ischemic stroke early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
5	71765539	rs2112298	G	A	rs2112298	21957438	9.91E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
5	71768906	rs10079381	C	G	rs10079381	21957438	9.04E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
5	71771346	rs10061668	A	G	rs10061668	21957438	8.78E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
5	73677709	rs1687349	C	T	rs1687349	17434096	6.46E-06	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
5	85541926	rs10069795	C	T	rs10069795	22384361	8.00E-06	Cardioembolic stroke (large artery stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
5	85619565	rs7700699	T	A	rs7700699	22384361	2.90E-06	Cardioembolic stroke (large artery stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
5	86293796	rs7717290	G	A	rs7717290	22941190	9.96E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
5	86319195	rs10942487	T	C	rs10942487	22941190	1.30E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
5	86331748	rs4283829	C	T	rs4283829	22941190	3.74E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
5	86350878	rs7715840	A	C	rs7715840	22941190	3.61E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
5	86378336	rs2544688	A	G	rs2544688	22941190	3.57E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
5	86386565	rs2624189	G	A	rs2624189	22941190	9.38E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
5	86409436	rs2112166	A	G	rs2112166	22941190	7.71E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
5	86410998	rs1004988	T	G	rs1004988	22941190	5.95E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
5	98880299	rs17167021	A	G	rs17167021	24262325	1.00E-07	NA	1.81	[1.42-2.30]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	rs17167021-G
5	103408356	rs1289192	A	G	rs1289192	17434096	5.91E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
5	104709892	rs7341006	G	A	rs7341006	17434096	3.77E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
5	104724885	rs10074087	T	C	rs10074087	17434096	3.41E-06	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
5	104784402	rs10073707	T	C	rs10073707	17434096	1.63E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
5	104788643	rs10038910	T	C	rs10038910	17434096	3.41E-06	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
5	104794603	rs4479819	G	A	rs4479819	17434096	8.96E-06	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
5	112786843	rs26990	C	T	rs26990	17434096	1.96E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
5	129521126	rs2015018	A	G	rs2015018	17434096	7.24E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
5	129552816	rs6861345	A	G	rs6861345	17434096	8.86E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
5	144393385	rs10059999	C	T	rs10059999	21957438	7.41E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
5	147122020	rs6895278	T	C	rs6895278	17434096	8.15E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
5	159292703	rs31694	A	G	rs31694	17434096	5.29E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
6	11401519	rs17507623	G	A	rs17507623	21957438	6.18E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	20865597	rs9465922	C	A	rs9465922	22384361	5.50E-07	Ischemic stroke early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
6	21701841	rs4712626	G	A	rs4712626	17434096	8.89E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
6	29674700	rs56918232	G	A	rs114026990	21957438	5.14E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	29679908	rs73410967	T	C	rs114370686	21957438	3.91E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	29681161	rs557729411	C	A	rs114230517	21957438	2.76E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	29681161	rs73410989	C	A	rs114230517	21957438	2.76E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	32123639	rs2269425	G	A	rs2269425	17434096	1.72E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
6	39207558	rs16868846	G	C	rs16868846	21957438	3.71E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	39211825	rs60637107	G	A	rs60637107	21957438	3.80E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	39229421	rs116181858	C	G	rs116181858	21957438	4.32E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	39229743	rs114566901	A	C	rs114566901	21957438	4.39E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	39256986	rs115057884	T	C	rs115057884	21957438	2.46E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	39262535	rs2815063	C	A	rs2815063	21957438	5.55E-07	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	39273426	rs10807204	C	G	rs10807204	17434096	6.70E-04	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
6	44472854	rs9296440	A	G	rs9296440	22941190	4.89E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44573454	rs4714797	C	G	rs4714797	22941190	9.89E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44573822	rs4711790	C	T	rs4711790	22941190	7.10E-07	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44574614	rs13202385	C	A	rs13202385	22941190	9.49E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44576665	rs9395035	A	G	rs9395035	22941190	8.86E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44577322	rs12526438	G	A	rs12526438	22941190	8.53E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44578074	rs9381341	C	G	rs9381341	22941190	8.63E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44584387	rs4714801	A	G	rs4714801	22941190	7.64E-08	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44591850	rs900403	G	A	rs900403	22941190	3.19E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44592706	rs9472313	G	A	rs9472313	22941190	5.43E-08	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44594159	rs556621	T	G	rs556621	22941190	5.00E-08	LAA	1.21	[1.13-1.30]	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs556621-A	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44594192	rs556512	A	G	rs556512	22941190	4.25E-08	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44595142	rs658726	G	T	rs658726	22941190	8.12E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44595212	rs504615	G	A	rs504615	22941190	4.58E-07	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44595393	rs1767788	C	T	rs1767788	22941190	5.42E-07	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44595443	rs646977	C	T	rs646977	22941190	9.12E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44596053	rs497177	T	G	rs497177	22941190	2.57E-07	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44596341	rs632728	T	C	rs632728	22941190	1.15E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44596341	rs632728	T	C	rs632728	24262325	2.00E-07	NA	1.19	[1.11-1.28]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	rs632728-T
6	44596354	rs1680900	A	C	rs1680900	22941190	1.41E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	44758098	rs1293457	T	C	rs1293457	21940970	4.79E-04	Ischemic stroke	NA	NA	223 cases; 248 stroke-affected siblings; 84 stroke-unaffected siblings	NOPOP(555)	ALL(555)	NOPOP(555)	ALL(555)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
6	44896803	rs3778507	G	A	rs3778507	21940970	1.38E-04	Ischemic stroke	NA	NA	223 cases; 248 stroke-affected siblings; 84 stroke-unaffected siblings	NOPOP(555)	ALL(555)	NOPOP(555)	ALL(555)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
6	49725341	rs527461	A	C	rs527461	21957438	5.70E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	49747462	rs489184	T	C	rs489184	21957438	3.57E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	50322944	rs1845031	C	T	rs1845031	22941190	1.52E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	70029389	rs10485251	A	C	rs10485251	17434096	9.60E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
6	89169157	rs7763511	C	T	rs7763511	17434096	4.94E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
6	106269803	rs1876561	C	T	rs1876561	17434096	2.74E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
6	134621071	rs12197956	T	G	rs12197956	21957438	8.82E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	134621107	rs7763911	A	G	rs7763911	21957438	8.82E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	134621215	rs12204317	A	C	rs12204317	21957438	8.82E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	134622943	rs12194586	C	T	rs12194586	21957438	8.82E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	134623840	rs9493891	G	A	rs9493891	21957438	8.82E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
6	148934993	rs911979	T	C	rs911979	17434096	3.07E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
6	150572330	rs6910142	T	C	rs6910142	22384361	2.40E-06	Ischemic stroke (other known cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
6	158980351	rs9457403	A	G	rs9457403	22941190	4.76E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	164724047	rs794114	A	G	rs794114	17434096	8.52E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
6	169696264	rs7452888	A	G	rs7452888	22941190	4.17E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
6	169706687	rs9505900	C	T	rs9505900	22941190	2.36E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
7	19036775	rs2023938	T	C	rs2023938	24262325	1.65E-06	NA	1.14	[1.08-1.20]	12,389 cases; 62,004 controls	NOPOP(74393)	ALL(74393)	NOPOP(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs2023938-C	Review	Research Support, N.I.H., Extramural	Meta-Analysis
7	19036775	rs2023938	T	C	rs2023938	24262325	2.33E-09	NA	1.38	[1.24-1.53]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	rs2023938-C
7	19049388	rs2107595	G	A	rs2107595	21957438	7.68E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
7	19049388	rs2107595	G	A	rs2107595	23041239	2.00E-16	LVD	1.39	[1.27-1.53]	12,389 European ancestry cases; 62,004 European ancestry controls	European(74393)	ALL(74393)	EUR(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs2107595-A	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
7	19049388	rs2107595	G	A	rs2107595	23041239	4.00E-06	IS	1.12	[1.07-1.17]	12,389 European ancestry cases; 62,004 European ancestry controls	European(74393)	ALL(74393)	EUR(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs2107595-A	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
7	19049388	rs2107595	G	A	rs2107595	24262325	3.00E-12	NA	1.39	[1.27-1.52]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	rs2107595-A
7	19049388	rs2107595	G	A	rs2107595	24262325	4.40E-06	NA	1.11	[1.06-1.16]	12,389 cases; 62,004 controls	NOPOP(74393)	ALL(74393)	NOPOP(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs2107595-A	Review	Research Support, N.I.H., Extramural	Meta-Analysis
7	19052733	rs57301765	G	A	rs57301765	21957438	7.55E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
7	48718056	rs13438050	C	G	rs13438050	21957438	6.88E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
7	48718406	rs10258912	T	C	rs10258912	21957438	6.88E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
7	77714611	rs7791394	T	C	rs7791394	24262325	8.30E-04	NA	1.06	[1.02-1.09]	12,389 cases; 62,004 controls	NOPOP(74393)	ALL(74393)	NOPOP(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs7791394-T	Review	Research Support, N.I.H., Extramural	Meta-Analysis
7	77714611	rs7791394	T	C	rs7791394	24262325	9.91E-06	NA	1.17	[1.09-1.26]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	rs7791394-T
7	84737683	rs10486848	G	A	rs10486848	17434096	8.43E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
7	92807377	rs4727286	C	T	rs4727286	17434096	4.71E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
7	92836316	rs793	C	A	rs793	17434096	4.71E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
7	92857805	rs4729076	C	A,G,T	rs4729076	17434096	4.71E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
7	92881662	rs10488536	T	G	rs10488536	17434096	7.96E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
7	95102534	rs43061	C	T	rs43061	21957438	4.90E-06	Ischemic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
7	111518413	rs757036	G	A	rs757036	22384361	5.80E-06	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
7	111531648	rs10228638	T	C	rs10228638	22384361	5.40E-06	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
7	111535863	rs2074132	T	C	rs2074132	22384361	5.40E-06	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
7	135871947	rs10954517	T	C	rs10954517	17434096	2.76E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
7	135890568	rs6950690	G	A	rs6950690	17434096	9.08E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
7	143739539	rs7787537	T	G	rs7787537	22941190	5.76E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
7	147654381	rs2708252	C	T	rs2708252	22384361	6.70E-06	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
8	17483028	rs13259157	A	G	rs13259157	22384361	2.10E-06	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
8	20040712	rs1390939	T	C	rs1390939	22941190	8.22E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
8	23396101	rs17698981	C	A	rs17698981	17434096	7.98E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
8	34044529	rs2730003	G	A	rs2730003	17434096	3.93E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
8	34067018	rs10503957	A	C	rs10503957	17434096	8.08E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
8	64248381	rs7461453	G	A	rs7461453	17434096	7.63E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
8	64263770	rs4737639	G	A	rs4737639	17434096	7.63E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
8	70381561	rs2099800	A	G	rs2099800	17434096	3.41E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
8	74146766	rs2605877	A	G	rs2605877	22384361	3.00E-06	Ischemic stroke early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
8	112607588	rs13279316	T	C	rs13279316	17434096	2.75E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
8	112846250	rs1397370	T	C	rs1397370	17434096	8.93E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
8	112848267	rs1397374	G	A	rs1397374	17434096	8.93E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
8	112882444	rs320558	C	T	rs320558	17434096	1.38E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
8	112899056	rs10505164	G	C	rs10505164	17434096	7.66E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
8	112902124	rs3106198	A	G	rs3106198	17434096	5.83E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
8	112902645	rs320503	G	T	rs320503	17434096	5.16E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
8	112929032	rs186489	C	T	rs186489	17434096	1.57E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
8	112957484	rs3101275	C	A	rs3101275	17434096	1.34E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
8	112977188	rs1460592	A	G	rs1460592	17434096	2.82E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
8	113264960	rs2098455	C	T	rs2098455	17434096	3.19E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
8	113274853	rs990616	A	G	rs990616	17434096	6.05E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
8	116845863	rs2975509	C	T	rs2975509	22941190	5.78E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
8	132002334	rs3750889	C	T	rs3750889	17434096	3.68E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
8	132035562	rs1023096	C	T	rs1023096	17434096	6.74E-06	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
8	132074410	rs7008202	C	A	rs7008202	17434096	9.65E-06	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
8	133759318	rs74775484	A	G	rs74775484	21957438	8.10E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
8	133761844	rs80262555	T	C	rs80262555	21957438	8.17E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
8	133761895	rs113988259	T	G	rs113988259	21957438	7.91E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
8	133768658	rs2433057	T	A	rs2433057	21957438	8.77E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
8	133793270	rs56217800	T	A	rs56217800	21957438	4.80E-07	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
8	133876153	rs75188332	T	G	rs75188332	21957438	8.87E-07	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
8	133921014	rs75359268	C	T	rs75359268	21957438	1.29E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
8	133929138	rs79568178	C	T	rs79568178	21957438	1.35E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
8	133959399	rs28540916	T	C	rs28540916	21957438	2.34E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
8	133961011	rs4736614	T	C	rs4736614	21957438	2.27E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
8	133965936	rs7015805	T	C	rs7015805	21957438	2.57E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
8	133966348	rs9643296	A	C	rs9643296	21957438	2.49E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
8	133970345	rs1963138	G	A	rs1963138	21957438	5.97E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
8	133975183	rs76745731	A	G	rs76745731	21957438	4.12E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
8	133980451	rs6988193	A	G	rs6988193	21957438	7.20E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
8	144303418	rs10087900	G	A	rs10087900	22941190	5.36E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
9	2817887	rs10812738	A	G	rs10812738	17434096	8.76E-06	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
9	9183012	rs72696835	C	A	rs72696835	21957438	1.27E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
9	9984631	rs7040189	T	G	rs7040189	17434096	7.52E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
9	12570945	rs1325149	A	C	rs1325149	22941190	2.09E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
9	12573829	rs10738284	A	G	rs10738284	22941190	1.65E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
9	12585186	rs10124604	G	A	rs10124604	22941190	4.98E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
9	18285249	rs12353343	A	G	rs12353343	22941190	8.69E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
9	20283265	rs10511679	C	T	rs10511679	17434096	2.22E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
9	22124504	rs1333047	A	T	rs1333047	24262325	2.00E-07	NA	1.2	[1.11-1.29]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	rs1333047-T
9	22125503	rs1333049	G	C	rs1333049	24262325	3.70E-06	NA	1.19	[1.11-1.28]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	rs1333049-C
9	111520844	rs11789156	A	G	rs11789156	22384361	9.40E-06	Ischemic stroke (other known cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
9	118683862	rs10983013	C	T	rs10983013	21957438	9.90E-06	Ischemic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
9	118713227	rs9408887	G	A	rs9408887	21957438	9.78E-06	Ischemic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
9	118720418	rs7467015	T	C	rs7467015	21957438	9.88E-06	Ischemic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
9	136154168	rs579459	T	C	rs579459	24262325	2.60E-04	NA	1.08	[1.04-1.12]	12,389 cases; 62,004 controls	NOPOP(74393)	ALL(74393)	NOPOP(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs579459-C	Review	Research Support, N.I.H., Extramural	Meta-Analysis
10	6969816	rs2490689	T	C	rs2490689	22941190	1.52E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
10	8382503	rs2388712	A	G	rs2388712	22384361	9.10E-06	Cardioembolic stroke (lacunar stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
10	12976723	rs10906258	G	T	rs10906258	22941190	8.20E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
10	26520487	rs8190645	G	A	rs8190645	22941190	2.41E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
10	27569521	rs2483499	C	T	rs2483499	22941190	8.78E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
10	54531235	rs1800450	C	T	rs1800450	22941190	7.03E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
10	71392557	rs12020	C	T	rs12020	17434096	7.44E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
10	71393025	rs1132075	A	G	rs1132075	17434096	8.21E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
10	72735740	rs1471824	T	C	rs1471824	17434096	8.14E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
10	78688976	rs1865020	G	A	rs1865020	21957438	4.15E-06	Ischemic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
10	87744398	rs4393254	C	T	rs4393254	17434096	4.56E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
10	93050333	rs10509625	G	A	rs10509625	17434096	5.82E-06	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
10	104719096	rs12413409	G	A	rs12413409	24262325	4.90E-04	NA	1.25	[1.11-1.43]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	NA
10	111757674	rs10509906	G	C	rs10509906	21957438	2.36E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
10	112438525	rs1417633	T	C	rs1417633	17434096	6.44E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
10	112453917	rs11195266	G	A	rs11195266	17434096	3.47E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
10	112472103	rs10509928	C	A	rs10509928	17434096	9.07E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
10	122303500	rs7910507	G	A	rs7910507	17434096	1.61E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
10	122481088	rs11199512	C	T	rs11199512	22941190	2.67E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
10	123437453	rs2935718	C	T	rs2935718	17434096	8.56E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
10	123452085	rs10788197	G	A	rs10788197	17434096	1.46E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
10	131215389	rs1978392	T	G	rs1978392	22941190	9.36E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
11	11654893	rs11021961	G	A	rs11021961	21957438	8.11E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
11	17667439	rs11024357	G	C	rs11024357	17434096	2.48E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
11	17667561	rs11024358	G	T	rs11024358	17434096	2.48E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
11	17672112	rs869108	G	A	rs869108	17434096	2.48E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
11	24916152	rs11028255	T	C	rs11028255	21957438	7.85E-06	Ischemic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
11	26455531	rs11500182	T	G	rs11500182	22941190	9.71E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
11	36386755	rs10501153	C	T	rs10501153	22941190	7.14E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
11	63714930	rs12798491	A	C	rs12798491	22384361	1.90E-06	Ischemic stroke (other known cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
11	63723238	rs10897466	A	G	rs10897466	22384361	1.40E-06	Ischemic stroke (other known cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
11	68969808	rs12417971	C	T	rs12417971	22384361	5.90E-07	Ischemic stroke (other known cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
11	80682191	rs1498334	A	G	rs1498334	22941190	9.45E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
11	83580576	rs938536	C	T	rs938536	17434096	1.17E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
11	83580958	rs2138567	T	C	rs2138567	17434096	3.19E-06	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
11	83591243	rs11233774	G	A	rs11233774	17434096	4.44E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
11	107354312	rs7937106	T	C	rs7937106	24262325	6.00E-08	NA	1.69	[1.40-2.04]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	rs7937106-C
11	108859584	rs10890917	C	G	rs10890917	22941190	1.42E-07	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
11	113031696	rs11214521	A	G	rs11214521	22941190	4.54E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
11	113310681	rs7125415	C	T	rs7125415	22941190	9.44E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
12	3631368	rs11062697	C	A	rs11062697	22384361	8.50E-06	Cardioembolic stroke (lacunar stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
12	8995211	rs1344454	C	T	rs1344454	21957438	2.08E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
12	9345273	rs10771407	A	G	rs10771407	22941190	1.93E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
12	11750137	rs11054362	C	T	rs11054362	22941190	8.43E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
12	19164304	rs7973505	T	C	rs7973505	21957438	5.13E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
12	19168581	rs11044389	G	T	rs11044389	21957438	2.50E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
12	19169528	rs7979074	G	C	rs7979074	21957438	9.31E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
12	19170353	rs55825297	G	A	rs55825297	21957438	3.37E-07	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
12	19171407	rs56031230	T	G	rs56031230	21957438	3.01E-07	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
12	19182287	rs146997533	GAT	G	rs78429556	21957438	7.98E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
12	19182287	rs397781177	GAT	G	rs78429556	21957438	7.98E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
12	19182287	rs66648408	GAT	G	rs78429556	21957438	7.98E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
12	19182287	rs78429556	G	T	rs78429556	21957438	7.98E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
12	19182772	rs1018298	A	G	rs1018298	21957438	6.64E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
12	19186047	rs11044400	C	T	rs11044400	21957438	1.57E-07	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
12	23665984	rs10770998	A	T	rs10770998	22941190	3.63E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
12	23676440	rs1899919	G	A	rs1899919	22941190	3.55E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
12	23679273	rs9737974	T	C	rs9737974	22941190	4.70E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
12	24190988	rs1353793	T	G	rs1353793	17434096	7.20E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
12	45737956	rs11182988	T	C	rs11182988	17434096	2.22E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T,C
12	45763069	rs1863549	A	G	rs1863549	17434096	2.22E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
12	60864444	rs17608369	T	C	rs17608369	21957438	3.19E-06	Stroke (age at onset)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
12	63400709	rs771961	G	T	rs771961	17434096	8.57E-06	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
12	63411765	rs1273109	A	G	rs1273109	17434096	8.57E-06	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
12	78681923	rs10506777	C	A	rs10506777	17434096	6.76E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
12	89162115	rs10732643	T	G	rs10732643	22384361	8.30E-06	Cardioembolic stroke (ischemic stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
12	89369806	rs11608458	C	T	rs11608458	17434096	8.54E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
12	93922017	rs11107070	G	A	rs11107070	22384361	3.90E-06	Cardioembolic stroke (ischemic stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
12	111884608	rs3184504	T	C	rs3184504	24262325	1.01E-06	NA	1.08	[1.05-1.12]	12,389 cases; 62,004 controls	NOPOP(74393)	ALL(74393)	NOPOP(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs3184504-T	Review	Research Support, N.I.H., Extramural	Meta-Analysis
12	111884608	rs3184504	T	C	rs3184504	24262325	1.50E-04	NA	1.14	[1.06-1.22]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	rs3184504-T
12	112211833	rs2238151	T	C	rs2238151	23041239	1.00E-06	FS	1.13	[1.08-1.19]	12,389 European ancestry cases; 62,004 European ancestry controls	European(74393)	ALL(74393)	EUR(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs2238151-T	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
12	112486818	rs17696736	A	G	rs17696736	24262325	6.00E-08	NA	1.1	[1.06-1.14]	12,389 cases; 62,004 controls	NOPOP(74393)	ALL(74393)	NOPOP(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs17696736-G	Review	Research Support, N.I.H., Extramural	Meta-Analysis
13	25311694	rs80107111	G	A	rs80107111	21957438	7.35E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
13	25516775	rs75426593	C	T	rs75426593	21957438	8.61E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
13	32521086	rs7986448	C	A	rs7986448	17434096	1.53E-06	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
13	47194685	rs12429886	G	T	rs12429886	22941190	5.53E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
13	47195267	rs7983635	A	G	rs7983635	22941190	5.17E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
13	47203895	rs12427953	T	C	rs12427953	22941190	3.64E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
13	47240177	rs12430990	T	C	rs12430990	22941190	5.72E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
13	47240326	rs12429970	C	G	rs12429970	22941190	2.41E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
13	47244479	rs5013916	A	G	rs5013916	22941190	6.91E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
13	51254712	rs2540525	C	T	rs2540525	17434096	3.27E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
13	65229479	rs359349	A	G	rs359349	17434096	9.87E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
13	72855221	rs3909263	G	C	rs3909263	22384361	7.30E-07	Ischemic stroke early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
13	72872206	rs1146849	A	G	rs1146849	22384361	1.70E-06	Ischemic stroke early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
13	75344738	rs1927260	T	G	rs1927260	17434096	5.85E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
13	78036512	rs12429367	C	T	rs12429367	22384361	4.30E-06	Cardioembolic stroke (lacunar stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
13	78038808	rs17067774	C	A	rs17067774	22384361	1.90E-06	Cardioembolic stroke (lacunar stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
13	79238925	rs4304924	G	A	rs4304924	24262325	3.90E-05	NA	1.08	[1.03-1.10]	12,389 cases; 62,004 controls	NOPOP(74393)	ALL(74393)	NOPOP(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Review	Research Support, N.I.H., Extramural	Meta-Analysis
13	79238925	rs4304924	G	A	rs4304924	24262325	5.00E-06	NA	1.18	[1.10-1.27]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	rs4304924-G
13	96601679	rs35405829	C	T	rs35405829	22384361	5.70E-06	Cardioembolic stroke (large artery stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
13	97812638	rs4603415	G	A	rs4603415	22941190	1.88E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
13	97835876	rs9556688	C	T	rs9556688	22941190	2.37E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
13	97846187	rs9556690	C	T	rs9556690	22941190	2.50E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
13	105919056	rs4238241	C	A	rs4238241	22384361	2.30E-06	Ischemic stroke (other known cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
13	112577197	rs9604365	G	A	rs9604365	22384361	8.10E-07	Ischemic stroke early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
14	23780222	rs10149339	A	G	rs10149339	17434096	3.01E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
14	29198485	rs910313	A	G	rs910313	22384361	6.50E-06	Cardioembolic stroke (lacunar stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
14	51238416	rs61985512	T	A	rs61985512	21957438	9.71E-06	Coronary artery disesae (CAD), large artery atherosclerosis	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
14	62960755	rs9323410	C	T	rs9323410	17434096	6.62E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
14	63000758	rs9323416	G	A	rs9323416	17434096	9.64E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
14	65281944	rs229673	A	G	rs229673	17434096	6.70E-04	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
14	76173860	rs1005224	T	A	rs1005224	24262325	1.00E-07	NA	1.2	[1.11-1.30]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	rs1005224-T
14	77601819	rs1465330	T	A	rs1465330	24262325	4.00E-07	NA	1.19	[1.10-1.28]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	rs1465330-A
14	98898086	rs1952863	C	T	rs1952863	17434096	6.48E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
14	105642138	rs880616	C	T	rs880616	22941190	5.44E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
14	105643619	rs10139596	G	A	rs10139596	22941190	3.78E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
14	105644151	rs1882848	T	C	rs1882848	22941190	2.65E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
14	105644282	rs10140111	C	G	rs10140111	22941190	1.87E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
14	105644382	rs11625862	G	A	rs11625862	22941190	1.33E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
14	105644421	rs11625865	G	A	rs11625865	22941190	2.50E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
14	105646179	rs4983590	G	A	rs4983590	22941190	5.01E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
14	105648963	rs11160839	T	A	rs11160839	22941190	7.41E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
15	38670161	rs8030388	T	C	rs8030388	22941190	9.61E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
15	38674713	rs8023597	A	C	rs8023597	22941190	3.38E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
15	58060795	rs598729	T	C	rs598729	17434096	4.15E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
15	58062001	rs552702	G	T	rs552702	17434096	8.57E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
15	58686754	rs7164909	C	T	rs7164909	22384361	5.90E-06	Cardioembolic stroke (large artery stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
15	58688186	rs4238329	A	C	rs4238329	22384361	7.60E-06	Cardioembolic stroke (large artery stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
15	73650824	rs3826046	G	A	rs3826046	22941190	5.26E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
15	80718699	rs17315707	G	A	rs17315707	21957438	8.02E-06	Ischemic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
15	82346498	rs4778663	G	A	rs4778663	21957438	4.24E-06	Ischemic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
15	89731776	rs2283436	T	C	rs2283436	22384361	7.00E-07	Cardioembolic stroke (large artery stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
15	96402314	rs1369943	G	A	rs1369943	17434096	4.54E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
16	56997233	rs1864163	G	A	rs1864163	22941190	9.18E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
16	57418987	rs2239354	G	A	rs2239354	22384361	3.80E-06	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
16	65775170	rs4267307	T	C	rs4267307	22941190	2.75E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
16	73068678	rs879324	G	A	rs879324	23041239	2.00E-08	CS	1.25	[1.15-1.35]	12,389 European ancestry cases; 62,004 European ancestry controls	European(74393)	ALL(74393)	EUR(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs879324-A	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
16	83556281	rs4284623	A	C	rs4284623	21957438	7.29E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
16	83561866	rs7187172	C	A	rs7187172	21957438	3.90E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
16	83562213	rs11640777	T	C	rs11640777	21957438	7.49E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
16	85944439	rs391525	A	G	rs391525	17434096	6.21E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
16	88807338	rs750740	T	C	rs750740	21940970	4.63E-04	Ischemic stroke	NA	NA	223 cases; 248 stroke-affected siblings; 84 stroke-unaffected siblings	NOPOP(555)	ALL(555)	NOPOP(555)	ALL(555)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
17	11385890	rs4792143	C	T	rs4792143	24262325	5.00E-06	NA	1.1	[1.05-1.15]	12,389 cases; 62,004 controls	NOPOP(74393)	ALL(74393)	NOPOP(74393)	ALL(74393)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	rs4792143-T	Review	Research Support, N.I.H., Extramural	Meta-Analysis
17	12882789	rs2240570	A	G	rs2240570	17434096	4.68E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
17	12882816	rs2240569	T	C	rs2240569	17434096	4.68E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
17	13109450	rs2674952	C	T	rs2674952	17434096	4.01E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
17	17543722	rs12936587	G	A	rs12936587	24262325	2.70E-05	NA	1.16	[1.09-1.25]	2,167 cases; 49,159 controls	NOPOP(51326)	ALL(51326)	NOPOP(51326)	ALL(51326)	Large artery stroke	HPOID:0002140	Ischemic stroke	DOID:3393	DOID:6713	coronary artery disease	cerebrovascular disease	NA	NA	NA	NA	Cerebrovascular disorder	Vascular disease	NA
17	35249517	rs10512479	A	C	rs10512479	17434096	9.32E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T,G
17	35250149	rs8082436	G	A	rs8082436	17434096	4.41E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
17	47000993	rs145067756	A	AAGAAAGAATGTCAC	rs77149783	21957438	7.02E-07	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
17	47000993	rs77149783	A	C	rs77149783	21957438	7.02E-07	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
17	69035852	rs6501434	A	C	rs6501434	22941190	1.81E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
17	69038138	rs17765111	G	A	rs17765111	22941190	1.99E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
17	69039331	rs17765129	A	G	rs17765129	22941190	2.82E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
17	69040840	rs17177691	T	C	rs17177691	22941190	3.16E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
17	69041010	rs17177705	G	A	rs17177705	22941190	3.35E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
17	69042388	rs8068158	T	C	rs8068158	22941190	3.45E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
17	69043850	rs1990730	T	C	rs1990730	22941190	3.98E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
17	73565171	rs1671021	T	C	rs1671021	19403135	4.00E-04	Ischemic stroke	NA	NA	131 Japanese cases; 135 Japanese controls	Japanese(266)	ALL(266)	ASN(266)	ALL(266)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Multicenter Study	Research Support, Non-U.S. Gov't	G
18	10656460	rs11660660	G	T	rs11660660	22941190	6.65E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
18	55338656	rs317838	G	A	rs317838	22384361	2.20E-06	Cardioembolic stroke (ischemic stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
18	55339811	rs317835	C	A	rs317835	22384361	2.20E-06	Cardioembolic stroke (ischemic stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
18	72262042	rs7506112	T	C	rs7506112	22384361	1.70E-06	Cardioembolic stroke (large artery stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
19	34958931	rs1030216	G	A	rs1030216	22941190	3.31E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
19	48608598	rs2307279	C	G	rs2307279	17434096	7.68E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
19	48609715	rs380359	C	T	rs380359	17434096	7.68E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
19	56220444	rs2287831	T	G	rs2287831	17434096	1.18E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A
19	57573371	rs73058954	A	G	rs73058954	21957438	6.79E-06	Cardioembolic stroke	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
20	1009788	rs879012	C	T	rs879012	22384361	2.20E-06	Ischemic stroke early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
20	1009788	rs879012	C	T	rs879012	22384361	9.30E-06	Ischemic stroke (unknown cause) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
20	1689557	rs599837	A	G	rs599837	17434096	4.07E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
20	1693713	rs202493	T	C	rs202493	17434096	1.63E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
20	1714362	rs202456	C	T	rs202456	17434096	1.55E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
20	17488415	rs3828011	A	G	rs3828011	22941190	9.96E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
20	41415745	rs208250	T	C	rs208250	22941190	9.89E-05	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
20	41473735	rs8125304	A	G	rs8125304	21957438	6.72E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
20	48982515	rs7266895	G	A	rs7266895	22384361	1.20E-06	Cardioembolic stroke (large artery stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
20	48985871	rs6095892	T	C	rs6095892	22384361	6.40E-07	Cardioembolic stroke (large artery stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
21	19679960	rs7277309	G	C	rs7277309	22941190	4.85E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
21	33339340	rs2211678	T	C	rs2211678	17434096	8.26E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
21	42898366	rs2838046	A	G	rs2838046	17434096	2.46E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
21	43493756	rs220282	A	G	rs220282	22384361	8.10E-06	Cardioembolic stroke (ischemic stroke) early age of onset	NA	NA	466 European ancestry cases; 523 European ancestry controls; 377 African ancestry cases; 357 African ancestry controls; 46 cases; 47 controls	NOPOP(93)	African(734)	European(989)	ALL(1816)	NOPOP(93)	AFR(734)	EUR(989)	ALL(1816)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder
21	44448718	rs2839627	C	T	rs2839627	17434096	7.81E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
22	19098966	rs2525079	T	C	rs2525079	17434096	1.79E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	C
22	19099419	rs5993533	A	G	rs5993533	17434096	1.79E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
22	27893974	rs4822889	G	T	rs4822889	17434096	6.72E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	G
22	28071706	rs134100	C	T	rs134100	17434096	5.83E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T,C
22	32607057	rs1467388	A	G	rs1467388	22941190	6.87E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
22	32619091	rs5998319	T	G	rs5998319	22941190	1.69E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
22	32619215	rs5998320	T	C	rs5998320	22941190	1.50E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
22	32625210	rs5998322	C	T	rs5998322	22941190	3.91E-07	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
22	32634877	rs5998331	G	A	rs5998331	22941190	4.55E-07	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
22	35378256	rs73166096	T	C	rs73166096	21957438	8.74E-06	Stroke (small vessel stroke)	NA	NA	1070 cases; 1488 controls; 400 European ancestry cases; 444 European ancestry controls	NOPOP(2558)	European(844)	ALL(3402)	NOPOP(2558)	EUR(844)	ALL(3402)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural
22	36608205	rs9610448	A	G	rs9610448	22941190	5.27E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
22	36609739	rs4820222	C	T	rs4820222	22941190	4.66E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
22	36610386	rs8140086	A	G	rs8140086	22941190	4.17E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
22	36610571	rs8140384	C	T	rs8140384	22941190	3.94E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
22	36612966	rs4479522	A	G	rs4479522	22941190	3.23E-06	NA	NA	NA	421 European ancestry LAA cases; 741 European ancestry other stroke cases; 1,244 European ancestry controls	European(2406)	ALL(2406)	EUR(2406)	ALL(2406)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Meta-Analysis	Research Support, Non-U.S. Gov't
22	46780521	rs6007897	T	C	rs6007897	19403135	1.00E-04	Ischemic stroke	NA	NA	131 Japanese cases; 135 Japanese controls	Japanese(266)	ALL(266)	ASN(266)	ALL(266)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Multicenter Study	Research Support, Non-U.S. Gov't	C
22	46780521	rs6007897	T	C	rs6007897	19403135	8.00E-04	Glycated Hemoglobin (HbA1c)	NA	NA	131 Japanese cases; 135 Japanese controls	Japanese(266)	ALL(266)	ASN(266)	ALL(266)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Multicenter Study	Research Support, Non-U.S. Gov't	C
22	46786315	rs4044210	T	C	rs4044210	19403135	1.00E-04	Ischemic stroke	NA	NA	131 Japanese cases; 135 Japanese controls	Japanese(266)	ALL(266)	ASN(266)	ALL(266)	Stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Multicenter Study	Research Support, Non-U.S. Gov't	T
22	49783510	rs5770363	G	T	rs5770363	17434096	7.22E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T
X	11220077	rs5933866	T	C	rs5933866	17434096	9.19E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	T,C
X	149247783	rs6608310	A	C	rs6608310	17434096	1.84E-05	NA	NA	NA	259 cases; 269 controls	NOPOP(528)	ALL(528)	NOPOP(528)	ALL(528)	stroke (ischemic)	HPOID:0002140	Ischemic stroke	DOID:6713	cerebrovascular disease	D020521	Stroke	EFOID:0000712	stroke	Cerebrovascular disorder	NA	Research Support, N.I.H., Extramural	Research Support, N.I.H., Intramural	A

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:0)
(Waiting for update.)

Chemical(Total Drugs:0)
(Waiting for update.)

FDA approved drug and dosage information(Total Drugs:0)
(Waiting for update.)

FDA labeling changes(Total Drugs:0)
(Waiting for update.)