PedAM

Pediatric Disease Annotations & Medicines


	hyperhomocysteinemia

Disease ID	637
Disease	hyperhomocysteinemia
Definition	Condition in which the plasma levels of homocysteine and related metabolites are elevated (>13.9 μmol/l). Hyperhomocysteinemia can be familial or acquired. Development of the acquired hyperhomocysteinemia is mostly associated with vitamins B and/or folate deficiency (e.g., PERNICIOUS ANEMIA, vitamin malabsorption). Familial hyperhomocysteinemia often results in a more severe elevation of total homocysteine and excretion into the urine, resulting in HOMOCYSTINURIA. Hyperhomocysteinemia is a risk factor for cardiovascular and neurodegenerative diseases, osteoporotic fractures and complications during pregnancy.
Synonym	hyperhomocysteinaemia hyperhomocysteinemia (disorder) hyperhomocysteinemia [disease/finding] hyperhomocysteinemias
OMIM	OMIM:603174
DOID	DOID:9279
UMLS	C0598608
MeSH	D020138
SNOMED-CT	SNOMEDCT_US_2016_09_01:419503008
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:82) C0042373 \| vascular disease \| 18 C0007222 \| cardiovascular disease \| 9 C0042373 \| vascular diseases \| 7 C0040053 \| thrombosis \| 7 C0020538 \| hypertension \| 4 C0004153 \| atherosclerosis \| 4 C0007222 \| cardiovascular diseases \| 3 C0022658 \| kidney disease \| 3 C0016412 \| folate deficiency \| 2 C0524851 \| neurodegenerative disease \| 2 C0011847 \| diabetes \| 2 C0022661 \| chronic kidney disease \| 2 C1510471 \| vitamin deficiency \| 2 C0524851 \| neurodegenerative diseases \| 2 C0948265 \| metabolic syndrome \| 2 C0149931 \| migraine \| 2 C0011570 \| depression \| 2 C0011849 \| diabetes mellitus \| 2 C0000786 \| miscarriages \| 1 C0003850 \| arteriosclerosis \| 1 C0021831 \| bowel disease \| 1 C0022658 \| renal disease \| 1 C0018799 \| heart disease \| 1 C0338591 \| transient global amnesia \| 1 C0021053 \| immune disorder \| 1 C0042847 \| vitamin b12 deficiency \| 1 C0162565 \| acute intermittent porphyria \| 1 C1510471 \| hypovitaminosis \| 1 C0035078 \| kidney failure \| 1 C0002395 \| alzheimer's disease \| 1 C0018099 \| gout \| 1 C1561644 \| chronic kidney disease (ckd) \| 1 C0007282 \| carotid stenosis \| 1 C0016412 \| deficiency of folic acid \| 1 C0162429 \| dietary deficiency \| 1 C0007682 \| diseases of the central nervous system \| 1 C0030319 \| panic disorder \| 1 C0021390 \| inflammatory bowel disease \| 1 C0268583 \| methylmalonic aciduria \| 1 C0856761 \| budd-chiari syndrome \| 1 C0032051 \| placental insufficiency \| 1 C0020443 \| hypercholesterolemia \| 1 C0021053 \| immune disease \| 1 C0011882 \| diabetic neuropathy \| 1 C0013473 \| eating disorders \| 1 C0003486 \| aortic aneurysm \| 1 C0042847 \| cobalamin deficiency \| 1 C0041948 \| uremia \| 1 C0006111 \| brain disease \| 1 C0154841 \| central retinal vein occlusion \| 1 C0007570 \| celiac disease \| 1 C0022661 \| end-stage renal disease \| 1 C0442874 \| neuropathy \| 1 C0010346 \| crohn's disease \| 1 C0021053 \| immune disorders \| 1 C0035328 \| retinal vein occlusion \| 1 C0000809 \| recurrent miscarriage \| 1 C0013473 \| eating disorder \| 1 C0042847 \| vitamin b12 defic \| 1 C0268583 \| methylmalonic acidemia \| 1 C0027051 \| myocardial infarct \| 1 C0002965 \| unstable angina \| 1 C0010068 \| coronary heart disease \| 1 C0023890 \| cirrhosis \| 1 C0085580 \| primary hypertension \| 1 C0149521 \| chronic pancreatitis \| 1 C0022116 \| ischemia \| 1 C0035078 \| renal failure \| 1 C0011884 \| diabetic retinopathy \| 1 C0019880 \| homocystinuria \| 1 C0155626 \| acute myocardial infarction \| 1 C0035309 \| retinopathy \| 1 C0005586 \| bipolar disorder \| 1 C0036341 \| schizophrenia \| 1 C0027051 \| myocardial infarction \| 1 C0010674 \| cystic fibrosis \| 1 C0030305 \| pancreatitis \| 1 C0151311 \| cranial nerve palsy \| 1 C0034065 \| pulmonary embolism \| 1 C0002892 \| pernicious anemia \| 1 C0000809 \| recurrent miscarriages \| 1 C0004936 \| mental disorders \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:11) TNF \| 7124 \| CTD_human PON1 \| 5444 \| CTD_human DES \| 1674 \| CTD_human NPHS1 \| 4868 \| CTD_human MTHFR \| 4524 \| CTD_human GNMT \| 27232 \| CTD_human MTRR \| 4552 \| CTD_human CASP1 \| 834 \| CTD_human PYCARD \| 29108 \| CTD_human SLC46A1 \| 113235 \| CTD_human CBS \| 875 \| CTD_human
Inferring Gene	Entrez_id \| Symbol \| Resource(Total Genes:19) 191 \| AHCY \| infer 635 \| BHMT \| infer 23743 \| BHMT2 \| infer 875 \| CBS \| infer 1312 \| COMT \| infer 55556 \| ENOSF1 \| infer 2346 \| FOLH1 \| infer 4522 \| MTHFD1 \| infer 4524 \| MTHFR \| infer 4548 \| MTR \| infer 4552 \| MTRR \| infer 4837 \| NNMT \| infer 5444 \| PON1 \| infer 5445 \| PON2 \| infer 6470 \| SHMT1 \| infer 6573 \| SLC19A1 \| infer 6947 \| TCN1 \| infer 6948 \| TCN2 \| infer 7298 \| TYMS \| infer
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:214) 10048 \| RANBP9 \| DISEASES 11185 \| INMT \| DISEASES 1361 \| CPB2 \| DISEASES 513 \| ATP5D \| DISEASES 3053 \| SERPIND1 \| DISEASES 6948 \| TCN2 \| DISEASES 7494 \| XBP1 \| DISEASES 4792 \| NFKBIA \| DISEASES 191 \| AHCY \| DISEASES 27344 \| PCSK1N \| DISEASES 7076 \| TIMP1 \| DISEASES 4313 \| MMP2 \| DISEASES 51090 \| PLLP \| DISEASES 1666 \| DECR1 \| DISEASES 5327 \| PLAT \| DISEASES 83988 \| NCALD \| DISEASES 6511 \| SLC1A6 \| DISEASES 1155 \| TBCB \| DISEASES 5444 \| PON1 \| DISEASES 5445 \| PON2 \| DISEASES 5054 \| SERPINE1 \| DISEASES 6347 \| CCL2 \| DISEASES 2729 \| GCLC \| DISEASES 1432 \| MAPK14 \| DISEASES 4015 \| LOX \| DISEASES 3273 \| HRG \| DISEASES 338 \| APOB \| DISEASES 5624 \| PROC \| DISEASES 335 \| APOA1 \| DISEASES 7276 \| TTR \| DISEASES 847 \| CAT \| DISEASES 1315 \| COPB1 \| DISEASES 3630 \| INS \| DISEASES 2006 \| ELN \| DISEASES 348 \| APOE \| DISEASES 2056 \| EPO \| DISEASES 8431 \| NR0B2 \| DISEASES 1401 \| CRP \| DISEASES 23743 \| BHMT2 \| DISEASES 64328 \| XPO4 \| DISEASES 10400 \| PEMT \| DISEASES 2346 \| FOLH1 \| DISEASES 2694 \| GIF \| DISEASES 6947 \| TCN1 \| DISEASES 3569 \| IL6 \| DISEASES 7450 \| VWF \| DISEASES 1535 \| CYBA \| DISEASES 642 \| BLMH \| DISEASES 51156 \| SERPINA10 \| DISEASES 3690 \| ITGB3 \| DISEASES 4141 \| MARS \| DISEASES 23531 \| MMD \| DISEASES 50507 \| NOX4 \| DISEASES 3553 \| IL1B \| DISEASES 6403 \| SELP \| DISEASES 54431 \| DNAJC10 \| DISEASES 4552 \| MTRR \| DISEASES 3383 \| ICAM1 \| DISEASES 3827 \| KNG1 \| DISEASES 7078 \| TIMP3 \| DISEASES 126410 \| CYP4F22 \| DISEASES 6647 \| SOD1 \| DISEASES 207 \| AKT1 \| DISEASES 2702 \| GJA5 \| DISEASES 5972 \| REN \| DISEASES 635 \| BHMT \| DISEASES 4594 \| MUT \| DISEASES 3606 \| IL18 \| DISEASES 7082 \| TJP1 \| DISEASES 2697 \| GJA1 \| DISEASES 23250 \| ATP11A \| DISEASES 23576 \| DDAH1 \| DISEASES 4900 \| NRGN \| DISEASES 5018 \| OXA1L \| DISEASES 7079 \| TIMP4 \| DISEASES 5468 \| PPARG \| DISEASES 653361 \| NCF1 \| DISEASES 1636 \| ACE \| DISEASES 7412 \| VCAM1 \| DISEASES 213 \| ALB \| DISEASES 6853 \| SYN1 \| DISEASES 308 \| ANXA5 \| DISEASES 4846 \| NOS3 \| DISEASES 51700 \| CYB5R2 \| DISEASES 4837 \| NNMT \| DISEASES 197257 \| LDHD \| DISEASES 84064 \| HDHD2 \| DISEASES 51031 \| GLOD4 \| DISEASES 124935 \| SLC43A2 \| DISEASES 51293 \| CD320 \| DISEASES 8435 \| SOAT2 \| DISEASES 7001 \| PRDX2 \| DISEASES 10476 \| ATP5H \| DISEASES 27249 \| MMADHC \| DISEASES 2915 \| GRM5 \| DISEASES 160065 \| PATE1 \| DISEASES 5162 \| PDHB \| DISEASES 54205 \| CYCS \| DISEASES 2147 \| F2 \| DISEASES 6573 \| SLC19A1 \| DISEASES 5340 \| PLG \| DISEASES 4973 \| OLR1 \| DISEASES 836 \| CASP3 \| DISEASES 7298 \| TYMS \| DISEASES 4728 \| NDUFS8 \| DISEASES 9377 \| COX5A \| DISEASES 53905 \| DUOX1 \| DISEASES 23621 \| BACE1 \| DISEASES 6470 \| SHMT1 \| DISEASES 55349 \| CHDH \| DISEASES 4018 \| LPA \| DISEASES 26061 \| HACL1 \| DISEASES 3309 \| HSPA5 \| DISEASES 3927 \| LASP1 \| DISEASES 5366 \| PMAIP1 \| DISEASES 5663 \| PSEN1 \| DISEASES 4843 \| NOS2 \| DISEASES 842 \| CASP9 \| DISEASES 6401 \| SELE \| DISEASES 2903 \| GRIN2A \| DISEASES 2152 \| F3 \| DISEASES 468 \| ATF4 \| DISEASES 114548 \| NLRP3 \| DISEASES 445329 \| SULT1A4 \| DISEASES 23463 \| ICMT \| DISEASES 6818 \| SULT1A3 \| DISEASES 1003 \| CDH5 \| DISEASES 875 \| CBS \| DISEASES 55556 \| ENOSF1 \| DISEASES 302 \| ANXA2 \| DISEASES 2879 \| GPX4 \| DISEASES 100506658 \| OCLN \| DISEASES 6720 \| SREBF1 \| DISEASES 6288 \| SAA1 \| DISEASES 1822 \| ATN1 \| DISEASES 5826 \| ABCD4 \| DISEASES 5350 \| PLN \| DISEASES 2050 \| EPHB4 \| DISEASES 79694 \| MANEA \| DISEASES 1786 \| DNMT1 \| DISEASES 2157 \| F8 \| DISEASES 5599 \| MAPK8 \| DISEASES 6721 \| SREBF2 \| DISEASES 1312 \| COMT \| DISEASES 830 \| CAPZA2 \| DISEASES 23038 \| WDTC1 \| DISEASES 4548 \| MTR \| DISEASES 22796 \| COG2 \| DISEASES 25902 \| MTHFD1L \| DISEASES 5110 \| PCMT1 \| DISEASES 4688 \| NCF2 \| DISEASES 7827 \| NPHS2 \| DISEASES 462 \| SERPINC1 \| DISEASES 2153 \| F5 \| DISEASES 22926 \| ATF6 \| DISEASES 632 \| BGLAP \| DISEASES 57673 \| BEND3 \| DISEASES 158521 \| FMR1NB \| DISEASES 55788 \| LMBRD1 \| DISEASES 1491 \| CTH \| DISEASES 1573 \| CYP2J2 \| DISEASES 2902 \| GRIN1 \| DISEASES 7410 \| VAV2 \| DISEASES 7422 \| VEGFA \| DISEASES 4143 \| MAT1A \| DISEASES 4318 \| MMP9 \| DISEASES 27232 \| GNMT \| DISEASES 203 \| AK1 \| DISEASES 2739 \| GLO1 \| DISEASES 7295 \| TXN \| DISEASES 10919 \| EHMT2 \| DISEASES 2155 \| F7 \| DISEASES 23564 \| DDAH2 \| DISEASES 4524 \| MTHFR \| DISEASES 1471 \| CST3 \| DISEASES 7056 \| THBD \| DISEASES 8029 \| CUBN \| DISEASES 1536 \| CYBB \| DISEASES 4868 \| NPHS1 \| DISEASES 1906 \| EDN1 \| DISEASES 114899 \| C1QTNF3 \| DISEASES 2878 \| GPX3 \| DISEASES 50506 \| DUOX2 \| DISEASES 10840 \| ALDH1L1 \| DISEASES 10797 \| MTHFD2 \| DISEASES 816 \| CAMK2B \| DISEASES 4357 \| MPST \| DISEASES 1859 \| DYRK1A \| DISEASES 25974 \| MMACHC \| DISEASES 23198 \| PSME4 \| DISEASES 95 \| ACY1 \| DISEASES 4626 \| MYH8 \| DISEASES 7122 \| CLDN5 \| DISEASES 2160 \| F11 \| DISEASES 7018 \| TF \| DISEASES 2664 \| GDI1 \| DISEASES 113235 \| SLC46A1 \| DISEASES 7124 \| TNF \| DISEASES 2081 \| ERN1 \| DISEASES 2593 \| GAMT \| DISEASES 2876 \| GPX1 \| DISEASES 834 \| CASP1 \| DISEASES 441531 \| PGAM4 \| DISEASES 143662 \| MUC15 \| DISEASES 1849 \| DUSP7 \| DISEASES 846 \| CASR \| DISEASES 2649 \| NR6A1 \| DISEASES 100506742 \| CASP12 \| DISEASES 9948 \| WDR1 \| DISEASES 51366 \| UBR5 \| DISEASES 11075 \| STMN2 \| DISEASES 503542 \| SPRN \| DISEASES 1649 \| DDIT3 \| DISEASES 4522 \| MTHFD1 \| DISEASES
Locus	(Waiting for update.)

Disease ID	637
Disease	hyperhomocysteinemia
Integrated Phenotype	(Waiting for update.)
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:60) HP:0002621 \| Atherosclerosis \| 4 HP:0000822 \| Hypertension \| 3 HP:0100543 \| Cognitive deficits \| 3 HP:0001397 \| Hepatic steatosis \| 3 HP:0001268 \| Mental deterioration \| 3 HP:0002960 \| Autoimmune condition \| 2 HP:0012622 \| Chronic kidney disease \| 2 HP:0004936 \| Blood clot in vein \| 2 HP:0002180 \| Neurodegeneration \| 2 HP:0000819 \| Diabetes mellitus \| 2 HP:0002076 \| Migraine headaches \| 2 HP:0100507 \| Folate deficiency \| 2 HP:0001297 \| Cerebral vascular events \| 2 HP:0000855 \| Insulin resistance \| 2 HP:0012592 \| Albuminuria \| 2 HP:0000708 \| Behavioral problems \| 2 HP:0000716 \| Depression \| 2 HP:0001907 \| Thromboembolic disease \| 2 HP:0003219 \| Ethylmalonic aciduria \| 1 HP:0002912 \| Methylmalonic acidemia \| 1 HP:0000083 \| Renal insufficiency \| 1 HP:0001997 \| Gout \| 1 HP:0002140 \| Ischemic stroke \| 1 HP:0012120 \| Methymalonicaciduria \| 1 HP:0003658 \| Decreased serum methionine \| 1 HP:0004416 \| Precocious atherosclerosis \| 1 HP:0010534 \| Transient global amnesia \| 1 HP:0006280 \| Chronic pancreas inflammation \| 1 HP:0100502 \| Vitamin B12 deficiency \| 1 HP:0000488 \| Noninflammatory retina disease \| 1 HP:0001510 \| Growth deficiency \| 1 HP:0002500 \| Leukoaraiosis \| 1 HP:0004942 \| Aortic aneurysm \| 1 HP:0007868 \| ARMD \| 1 HP:0001394 \| Hepatic cirrhosis \| 1 HP:0100280 \| Morbus Crohn \| 1 HP:0002608 \| Celiac disease \| 1 HP:0012636 \| Retinal vein occlusion \| 1 HP:0100753 \| Schizophrenia \| 1 HP:0012531 \| Pain \| 1 HP:0002119 \| Ventricular dilatation \| 1 HP:0000938 \| Decreased bone mineral density \| 1 HP:0003774 \| End-stage renal failure \| 1 HP:0002204 \| Pulmonary embolism \| 1 HP:0007302 \| Bipolar disorder \| 1 HP:0000078 \| Genital abnormalities \| 1 HP:0002639 \| Budd-Chiari syndrome \| 1 HP:0100546 \| Narrowing of carotid artery \| 1 HP:0005305 \| Cerebral vein thrombosis \| 1 HP:0002634 \| Arteriosclerosis \| 1 HP:0003124 \| Elevated serum cholesterol \| 1 HP:0011675 \| Arrhythmias \| 1 HP:0001511 \| Prenatal onset growth retardation \| 1 HP:0001658 \| Myocardial infarction \| 1 HP:0012072 \| Aciduria \| 1 HP:0002156 \| High urine homocystine levels \| 1 HP:0001941 \| acidemia \| 1 HP:0002617 \| Aneurysmal dilatation \| 1 HP:0001733 \| Pancreatic inflammation \| 1 HP:0006824 \| Cranial nerve palsy \| 1

Disease ID	637
Disease	hyperhomocysteinemia
Manually Symptom	(Waiting for update.)
Text Mined Symptom	UMLS \| Name \| Sentences' Count(Total Symptoms:20) C0042373 \| vascular disease \| 14 C0040053 \| thrombosis \| 7 C0007222 \| cardiovascular disease \| 7 C0856169 \| endothelial dysfunction \| 5 C0042373 \| vascular diseases \| 4 C0004153 \| atherosclerosis \| 4 C0427008 \| stiffness \| 4 C0042487 \| venous thrombosis \| 2 C0007222 \| cardiovascular diseases \| 2 C0524851 \| neurodegenerative diseases \| 2 C0016412 \| folate deficiency \| 2 C0038454 \| stroke \| 2 C0040038 \| thromboembolism \| 2 C0032962 \| pregnancy complications \| 1 C1393529 \| vascular complications \| 1 C0003850 \| arteriosclerosis \| 1 C0023223 \| leg ulcers \| 1 C0264733 \| ventricular dilatation \| 1 C0034065 \| pulmonary embolism \| 1 C0010346 \| crohn's disease \| 1

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:74)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs1045642	23107763	4524	MTHFR	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.337316502	2013	ABCB1	7	87509329	A	T,G
rs1045642	23107763	3569	IL6	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.000542884	2013	ABCB1	7	87509329	A	T,G
rs1048943	23107763	4524	MTHFR	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.337316502	2013	CYP1A1	15	74720644	T	G,C,A
rs1048943	23107763	3569	IL6	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.000542884	2013	CYP1A1	15	74720644	T	G,C,A
rs1051266	18958479	6573	SLC19A1	umls:C0598608	BeFree	To the best of our knowledge, this is the first family with multiple AIS patients harboring homozygous MTHFR gene C677T (G80A-RFC1) mutations without associated hyperhomocysteinemia (the latter factor is usually considered as effector of vascular damage in patients with MTHFR C677T mutations).	0.003181358	2009	SLC19A1	21	45537880	T	C
rs1051266	18958479	4524	MTHFR	umls:C0598608	BeFree	To the best of our knowledge, this is the first family with multiple AIS patients harboring homozygous MTHFR gene C677T (G80A-RFC1) mutations without associated hyperhomocysteinemia (the latter factor is usually considered as effector of vascular damage in patients with MTHFR C677T mutations).	0.337316502	2009	SLC19A1	21	45537880	T	C
rs121964971	18454451	875	CBS	umls:C0598608	BeFree	Cystathionine beta-synthase p.S466L mutation causes hyperhomocysteinemia in mice.	0.2294228	2008	CBS	21	43058215	G	A
rs1477196	24023349	4524	MTHFR	umls:C0598608	BeFree	To analyze associations between homocysteine level, MTHFR and FTO rs1477196 polymorphisms and folate status in patients with breast cancer (BC) in order to clarify determinants of hyperhomocysteinemia.	0.337316502	2013	FTO	16	53774346	A	G
rs1799983	23107763	3569	IL6	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.000542884	2013	NOS3	7	150999023	T	G
rs1799983	14999203	4846	NOS3	umls:C0598608	BeFree	Influence of endothelial nitric oxide synthase gene polymorphisms (G894T, 4a4b, T-786C) and hyperhomocysteinemia on the predisposition to acute coronary syndromes.	0.004538567	2004	NOS3	7	150999023	T	G
rs1799983	16284093	4846	NOS3	umls:C0598608	BeFree	The G894T polymorphism of the eNOS gene is associated with the presence of CAD, and in conjunction with hyperhomocysteinemia, increased the risk of CAD severity in a Tunisian population.	0.004538567	2006	NOS3	7	150999023	T	G
rs1799983	23107763	4524	MTHFR	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.337316502	2013	NOS3	7	150999023	T	G
rs1799983	21607713	4524	MTHFR	umls:C0598608	BeFree	These data suggest that both MTHFR C677T and eNOS G894T variants should be regarded as genetic risk factors for hyperhomocysteinemia in patients with cognitive decline.	0.337316502	2011	NOS3	7	150999023	T	G
rs1799983	21607713	4846	NOS3	umls:C0598608	BeFree	These data suggest that both MTHFR C677T and eNOS G894T variants should be regarded as genetic risk factors for hyperhomocysteinemia in patients with cognitive decline.	0.004538567	2011	NOS3	7	150999023	T	G
rs1800562	14746432	5054	SERPINE1	umls:C0598608	BeFree	Assessment of the risk-factor profile revealed an absence of classic risk factors but the presence of the factor V Leiden mutation, the methylenetetrahydrofolate reductase AI298C mutation, the HFE C282Y mutation, plasminogen activator inhibitor-1 gene mutation, the -455 G/A fibrinogen gene polymorphism, the epsilon3/epsilon4 apolipoprotein E -675 4G gene polymorphism, and hyperhomocysteinemia.	0.000814326	2004	HFE	6	26092913	G	A
rs1800562	14746432	348	APOE	umls:C0598608	BeFree	Assessment of the risk-factor profile revealed an absence of classic risk factors but the presence of the factor V Leiden mutation, the methylenetetrahydrofolate reductase AI298C mutation, the HFE C282Y mutation, plasminogen activator inhibitor-1 gene mutation, the -455 G/A fibrinogen gene polymorphism, the epsilon3/epsilon4 apolipoprotein E -675 4G gene polymorphism, and hyperhomocysteinemia.	0.093821129	2004	HFE	6	26092913	G	A
rs1800562	14746432	4524	MTHFR	umls:C0598608	BeFree	Assessment of the risk-factor profile revealed an absence of classic risk factors but the presence of the factor V Leiden mutation, the methylenetetrahydrofolate reductase AI298C mutation, the HFE C282Y mutation, plasminogen activator inhibitor-1 gene mutation, the -455 G/A fibrinogen gene polymorphism, the epsilon3/epsilon4 apolipoprotein E -675 4G gene polymorphism, and hyperhomocysteinemia.	0.337316502	2004	HFE	6	26092913	G	A
rs1800629	23107763	4524	MTHFR	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.337316502	2013	TNF	6	31575254	G	A
rs1800629	23107763	3569	IL6	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.000542884	2013	TNF	6	31575254	G	A
rs1800795	23107763	3569	IL6	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.000542884	2013	IL6;LOC541472	7	22727026	C	G
rs1800795	23107763	4524	MTHFR	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.337316502	2013	IL6;LOC541472	7	22727026	C	G
rs1801133	23107763	3569	IL6	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.000542884	2013	MTHFR	1	11796321	G	A
rs1801133	23107763	4524	MTHFR	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.337316502	2013	MTHFR	1	11796321	G	A
rs1801198	16820193	6948	TCN2	umls:C0598608	BeFree	Our results, if confirmed in other populations, highlight the necessity for investigation of the transcobalamin II C776G polymorphism in the research for hyperhomocysteinemia risk factors.	0.008001298	2007	TCN2	22	30615623	G	A,C
rs1805087	12476935	875	CBS	umls:C0598608	BeFree	Mutations in methylenetetrahydrofolate reductase (C667T), cystathionine beta-synthase (T833C), and methionine synthase (A2756G) genes cause hyperhomocysteinemia, an independent risk factor for atherothrombosis.	0.2294228	2002	MTR	1	236885200	A	G
rs1805087	19263808	4548	MTR	umls:C0598608	BeFree	Further study is needed to confirm the role of HHcy and MS A2756G mutation in the development of hyperlipidemia.	0.021736551	2008	MTR	1	236885200	A	G
rs1805087	12476935	4524	MTHFR	umls:C0598608	BeFree	Mutations in methylenetetrahydrofolate reductase (C667T), cystathionine beta-synthase (T833C), and methionine synthase (A2756G) genes cause hyperhomocysteinemia, an independent risk factor for atherothrombosis.	0.337316502	2002	MTR	1	236885200	A	G
rs1805087	15820491	4548	MTR	umls:C0598608	BeFree	Prevalence of myocardial infarction is related to hyperhomocysteinemia but not influenced by C677T methylenetetrahydrofolate reductase and A2756G methionine synthase polymorphisms in diabetic and non-diabetic subjects.	0.021736551	2005	MTR	1	236885200	A	G
rs1805087	12476935	102724560	LOC102724560	umls:C0598608	BeFree	Mutations in methylenetetrahydrofolate reductase (C667T), cystathionine beta-synthase (T833C), and methionine synthase (A2756G) genes cause hyperhomocysteinemia, an independent risk factor for atherothrombosis.	0.008957582	2002	MTR	1	236885200	A	G
rs1805087	12476935	4548	MTR	umls:C0598608	BeFree	Mutations in methylenetetrahydrofolate reductase (C667T), cystathionine beta-synthase (T833C), and methionine synthase (A2756G) genes cause hyperhomocysteinemia, an independent risk factor for atherothrombosis.	0.021736551	2002	MTR	1	236885200	A	G
rs1805087	15820491	4524	MTHFR	umls:C0598608	BeFree	Prevalence of myocardial infarction is related to hyperhomocysteinemia but not influenced by C677T methylenetetrahydrofolate reductase and A2756G methionine synthase polymorphisms in diabetic and non-diabetic subjects.	0.337316502	2005	MTR	1	236885200	A	G
rs201372812	10208491	4524	MTHFR	umls:C0598608	BeFree	The T133C mutation in the CBS gene and the thermolabile C677T mutation in the MTHFR gene seem to play an important role in the subset of individuals with combined hyperhomocysteinemia.	0.337316502	1999	CBS	21	43072061	G	A
rs201372812	10208491	875	CBS	umls:C0598608	BeFree	The T133C mutation in the CBS gene and the thermolabile C677T mutation in the MTHFR gene seem to play an important role in the subset of individuals with combined hyperhomocysteinemia.	0.2294228	1999	CBS	21	43072061	G	A
rs2606345	23107763	3569	IL6	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.000542884	2013	CYP1A1	15	74724835	C	A
rs2606345	23107763	4524	MTHFR	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.337316502	2013	CYP1A1	15	74724835	C	A
rs333	23107763	3569	IL6	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.000542884	2013	CCR5;LOC102724297	3	46373456	GTCAGTATCAATTCTGGAAGAATTTCCAGACA	-
rs333	23107763	4524	MTHFR	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.337316502	2013	CCR5;LOC102724297	3	46373456	GTCAGTATCAATTCTGGAAGAATTTCCAGACA	-
rs368087026	18958479	4524	MTHFR	umls:C0598608	BeFree	To the best of our knowledge, this is the first family with multiple AIS patients harboring homozygous MTHFR gene C677T (G80A-RFC1) mutations without associated hyperhomocysteinemia (the latter factor is usually considered as effector of vascular damage in patients with MTHFR C677T mutations).	0.337316502	2009	SLC19A1	21	45530890	G	A
rs368087026	18958479	6573	SLC19A1	umls:C0598608	BeFree	To the best of our knowledge, this is the first family with multiple AIS patients harboring homozygous MTHFR gene C677T (G80A-RFC1) mutations without associated hyperhomocysteinemia (the latter factor is usually considered as effector of vascular damage in patients with MTHFR C677T mutations).	0.003181358	2009	SLC19A1	21	45530890	G	A
rs375752214	21607713	4524	MTHFR	umls:C0598608	BeFree	These data suggest that both MTHFR C677T and eNOS G894T variants should be regarded as genetic risk factors for hyperhomocysteinemia in patients with cognitive decline.	0.337316502	2011	NOS3	7	150998541	C	T
rs375752214	21607713	4846	NOS3	umls:C0598608	BeFree	These data suggest that both MTHFR C677T and eNOS G894T variants should be regarded as genetic risk factors for hyperhomocysteinemia in patients with cognitive decline.	0.004538567	2011	NOS3	7	150998541	C	T
rs386514057	18958479	4524	MTHFR	umls:C0598608	BeFree	To the best of our knowledge, this is the first family with multiple AIS patients harboring homozygous MTHFR gene C677T (G80A-RFC1) mutations without associated hyperhomocysteinemia (the latter factor is usually considered as effector of vascular damage in patients with MTHFR C677T mutations).	0.337316502	2009	NA	NA	NA	NA	NA
rs386514057	18958479	6573	SLC19A1	umls:C0598608	BeFree	To the best of our knowledge, this is the first family with multiple AIS patients harboring homozygous MTHFR gene C677T (G80A-RFC1) mutations without associated hyperhomocysteinemia (the latter factor is usually considered as effector of vascular damage in patients with MTHFR C677T mutations).	0.003181358	2009	NA	NA	NA	NA	NA
rs386545618	21854603	4524	MTHFR	umls:C0598608	BeFree	Hyperhomocysteinemia due to Methylenetetrahydrofolate Reductase (MTHFR) gene, in particular the C677T (Ala222Val) polymorphism were recently associated to steatosis and fibrosis.	0.337316502	2011	NA	NA	NA	NA	NA
rs386626619	22684349	3717	JAK2	umls:C0598608	BeFree	The aim of this study was to describe the prevalence of main hereditary thrombophilias, Janus kinase 2 (JAK2) V617F mutation, antiphospholipid antibody syndrome (APS), and hyperhomocysteinemia in Brazilian children and adolescents diagnosed with portal vein thrombosis (PVT) without associated hepatic disease.	0.000271442	2012	NA	NA	NA	NA	NA
rs397507444	16401615	4524	MTHFR	umls:C0598608	BeFree	The objectives of this study were: to determine plasma total homocysteine tHcy levels and the prevalence of hyperhomocysteinemia in children with type 1 diabetes, to determine correlates of plasma tHcy levels with nutritional factor such as serum folic acid and vitamin B12 levels, genetic factors as methylenetetrahydrofolate reductase MTHFR gene polymorphism (C677T and A1298C), to attempt to identify possible dependencies between tHcy and the degree of metabolic control, the duration of the disease and presence of complications, and also to determine the relationship between other coronary risk factors.	0.337316502	2006	MTHFR	1	11794407	T	G
rs397507444	23337711	4524	MTHFR	umls:C0598608	BeFree	All participants had a thrombotic workup that included the following: genetic markers: factor V Leiden G1691A and G20210A prothrombin mutations, methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms; protein assays: protein C, protein S and antithrombin; other tests: blood typing and screening for hyperhomocysteinemia.	0.337316502	2013	MTHFR	1	11794407	T	G
rs397507444	24923843	4524	MTHFR	umls:C0598608	BeFree	A thrombophilic evaluation was performed, revealing hyperhomocysteinemia and methylenetetrahydrofolate reductase (MTHFR) variants (C677T and A1298C).	0.337316502	2014	MTHFR	1	11794407	T	G
rs397507444	15970629	4524	MTHFR	umls:C0598608	BeFree	Screening for C677T and A1298C MTHFR polymorphisms in patients with epilepsy and risk of hyperhomocysteinemia.	0.337316502	2004	MTHFR	1	11794407	T	G
rs397507444	22377704	4524	MTHFR	umls:C0598608	BeFree	MTHFR polymorphisms C677T and A1298C are associated with reduced MTHFR enzyme activity and hyperhomocysteinemia, which has been associated with osteoporosis.	0.337316502	2012	MTHFR	1	11794407	T	G
rs397507444	19366086	4524	MTHFR	umls:C0598608	BeFree	Compound heterozygosity for the C677T and A1298C mutations of the MTHFR gene in a case of hyperhomocysteinemia with recurrent deep thrombosis at young age.	0.337316502	2008	MTHFR	1	11794407	T	G
rs397507444	24051448	4524	MTHFR	umls:C0598608	BeFree	Hyperhomocysteinemia is considered an independent risk factor for liver diseases, and the genetic polymorphisms C677T and A1298C in the MTHFR gene have been linked to hyperhomocysteinemia.	0.337316502	2013	MTHFR	1	11794407	T	G
rs397507444	12187094	4524	MTHFR	umls:C0598608	BeFree	The common mutations C677T and A1298C in the human methylenetetrahydrofolate reductase gene are associated with hyperhomocysteinemia and cardiovascular disease in hemodialysis patients.	0.337316502	2002	MTHFR	1	11794407	T	G
rs397507444	23337711	5554	PRH1	umls:C0598608	BeFree	All participants had a thrombotic workup that included the following: genetic markers: factor V Leiden G1691A and G20210A prothrombin mutations, methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms; protein assays: protein C, protein S and antithrombin; other tests: blood typing and screening for hyperhomocysteinemia.	0.004071628	2013	MTHFR	1	11794407	T	G
rs397507444	17563923	4524	MTHFR	umls:C0598608	BeFree	Hyperhomocysteinemia causes steatosis, and the methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms result in hyperhomocysteinemia.	0.337316502	2008	MTHFR	1	11794407	T	G
rs397507444	16629766	4524	MTHFR	umls:C0598608	BeFree	We investigated whether the MTHFR C677T and A1298C polymorphisms contribute to hyperhomocysteinemia and increase the risk factor for stroke.	0.337316502	2006	MTHFR	1	11794407	T	G
rs397507444	16828193	4524	MTHFR	umls:C0598608	BeFree	MTHFR C677T and A1298C gene polymorphisms and hyperhomocysteinemia as risk factors of diabetic nephropathy in type 2 diabetes patients.	0.337316502	2007	MTHFR	1	11794407	T	G
rs397507444	11274015	4524	MTHFR	umls:C0598608	BeFree	Two common polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene, the thermolabile C677T and a more recently reported A1298C polymorphism, may contribute to hyperhomocysteinemia.	0.337316502	2001	MTHFR	1	11794407	T	G
rs397507444	16244782	4524	MTHFR	umls:C0598608	BeFree	The fact that MTHFR A1298C polymorphism is significantly associated with homocysteine levels, and that the CC genotype is present at a higher frequency in the Indian population, makes it extremely relevant in terms of its potential impact on hyperhomocysteinemia.	0.337316502	2005	MTHFR	1	11794407	T	G
rs397507444	23337711	5555	PRH2	umls:C0598608	BeFree	All participants had a thrombotic workup that included the following: genetic markers: factor V Leiden G1691A and G20210A prothrombin mutations, methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms; protein assays: protein C, protein S and antithrombin; other tests: blood typing and screening for hyperhomocysteinemia.	0.004071628	2013	MTHFR	1	11794407	T	G
rs397507444	24488901	4524	MTHFR	umls:C0598608	BeFree	to investigate if NAFLD, in subjects referred for nutritional assessment and counselling, has any difference of prevalence and severity when associated with isolated MTHFR A1298C polymorphism and hyperhomocysteinemia.	0.337316502	2015	MTHFR	1	11794407	T	G
rs397507444	16452733	4524	MTHFR	umls:C0598608	BeFree	Because they have been described as strong risk factors for idiopathic recurrent pregnancy losses (RPLs), we assessed the association between the methylenetetrahydrofolate reductase (MTHFR) single-nucleotide polymorphisms (SNPs) C677T and A1298C and hyperhomocysteinemia in Tunisian women with idiopathic RPL.	0.337316502	2006	MTHFR	1	11794407	T	G
rs41322052	14999203	4846	NOS3	umls:C0598608	BeFree	Influence of endothelial nitric oxide synthase gene polymorphisms (G894T, 4a4b, T-786C) and hyperhomocysteinemia on the predisposition to acute coronary syndromes.	0.004538567	2004	NOS3	7	150993018	C	T
rs4340	23107763	3569	IL6	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.000542884	2013	NA	NA	NA	NA	NA
rs4340	23107763	4524	MTHFR	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.337316502	2013	NA	NA	NA	NA	NA
rs4646903	23107763	4524	MTHFR	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.337316502	2013	CYP1A1	15	74719300	A	T,G
rs4646903	23107763	3569	IL6	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.000542884	2013	CYP1A1	15	74719300	A	T,G
rs5742905	22186991	875	CBS	umls:C0598608	BeFree	Tg-I278T Cbs(-/-) mice exhibited severe hyperhomocysteinemia and endothelial dysfunction in cerebral arterioles.	0.2294228	2012	CBS	21	43063074	A	G
rs694539	21791160	4837	NNMT	umls:C0598608	BeFree	In an association study the rs694539 NNMT single nucleotide polymorphism (SNP) was found significantly associated with hyperhomocysteinaemia.	0.005005506	2012	NA	11	114262697	C	T
rs7096206	23107763	4524	MTHFR	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.337316502	2013	MBL2	10	52771925	G	C
rs7096206	23107763	3569	IL6	umls:C0598608	BeFree	All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification CYP1A1 (rs2606345, rs4646903, and rs1048943), GSTM1 (Ins/del), GSTT1 (Ins/del), ABCB1 rs1045642); immune and inflammation response IL-6 (rs1800795), TNF-a (rs1800629), MBL2 (rs7096206), CCR5 (rs333), NOS3 (rs1799983), angiotensin-converting enzyme ACE (rs4340), and occlusive vascular disease/hyperhomocysteinemia MTHFR (rs1801133).	0.000542884	2013	MBL2	10	52771925	G	C
rs77375493	22684349	3717	JAK2	umls:C0598608	BeFree	The aim of this study was to describe the prevalence of main hereditary thrombophilias, Janus kinase 2 (JAK2) V617F mutation, antiphospholipid antibody syndrome (APS), and hyperhomocysteinemia in Brazilian children and adolescents diagnosed with portal vein thrombosis (PVT) without associated hepatic disease.	0.000271442	2012	JAK2;INSL6	9	5073770	G	A,T
rs9001	20031640	55349	CHDH	umls:C0598608	BeFree	Single nucleotide polymorphisms in homocysteine metabolism pathway genes: association of CHDH A119C and MTHFR C677T with hyperhomocysteinemia.	0.000271442	2009	CHDH	3	53823890	T	G
rs9001	20031640	4524	MTHFR	umls:C0598608	BeFree	Single nucleotide polymorphisms in homocysteine metabolism pathway genes: association of CHDH A119C and MTHFR C677T with hyperhomocysteinemia.	0.337316502	2009	CHDH	3	53823890	T	G

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:0)
(Waiting for update.)

Chemical(Total Drugs:6)
CUI	ChemicalName	ChemicalID	CasRN	DiseaseName	DiseaseID	DirectEvidence	PubMedIDs
C0598608	carbamazepine	D002220	298-46-4	hyperhomocysteinemia	MESH:D020138	marker/mechanism	10459572
C0598608	folic acid	D005492	59-30-3	hyperhomocysteinemia	MESH:D020138	marker/mechanism	15493348
C0598608	folic acid	D005492	59-30-3	hyperhomocysteinemia	MESH:D020138	therapeutic	11598393
C0598608	glutathione	D005978	70-18-8	hyperhomocysteinemia	MESH:D020138	marker/mechanism	20413874
C0598608	methotrexate	D008727	1959/5/2	hyperhomocysteinemia	MESH:D020138	marker/mechanism	18551038
C0598608	phenytoin	D010672	57-41-0	hyperhomocysteinemia	MESH:D020138	marker/mechanism	10459572

FDA approved drug and dosage information(Total Drugs:0)
(Waiting for update.)

FDA labeling changes(Total Drugs:0)
(Waiting for update.)