All Snps(Total Genotypes:330) |
|---|
| snpId |
pubmedId |
geneId |
geneSymbol |
diseaseId |
sourceId |
sentence |
score |
Year |
geneSymbol_dbSNP |
CHROMOSOME |
POS |
REF |
ALT |
| rs1012068 | 25032264 | 3588 | IL10RB | umls:C2239176 | BeFree | Rs423058 upstream of PAPL, rs2834167 in IL10RB and rs1012068 in DEPDC5 were associated with chronic HBV status, HBV natural clearance and the presence of HCC (P = 0.0004–0.024), respectively. | 0.000271442 | 2015 | DEPDC5 | 22 | 31869917 | T | G |
| rs1012068 | 25032264 | 9681 | DEPDC5 | umls:C2239176 | BeFree | Rs423058 upstream of PAPL, rs2834167 in IL10RB and rs1012068 in DEPDC5 were associated with chronic HBV status, HBV natural clearance and the presence of HCC (P = 0.0004–0.024), respectively. | 0.121085767 | 2015 | DEPDC5 | 22 | 31869917 | T | G |
| rs1012068 | 25032264 | 390928 | PAPL | umls:C2239176 | BeFree | Rs423058 upstream of PAPL, rs2834167 in IL10RB and rs1012068 in DEPDC5 were associated with chronic HBV status, HBV natural clearance and the presence of HCC (P = 0.0004–0.024), respectively. | 0.000271442 | 2015 | DEPDC5 | 22 | 31869917 | T | G |
| rs10380 | 25318605 | 2618 | GART | umls:C2239176 | BeFree | Results showed that six SNPs (MTHFR rs1801133, MTRR rs2287780, MTRR rs10380, FTHFD rs1127717, GART rs8971, and SHMT rs1979277) were significantly associated with HCC risk in Chinese population, with P values range from 2.26 × 10(-4) to 0.035). | 0.000271442 | 2014 | MTRR | 5 | 7897078 | C | T |
| rs10380 | 25318605 | 6470 | SHMT1 | umls:C2239176 | BeFree | Results showed that six SNPs (MTHFR rs1801133, MTRR rs2287780, MTRR rs10380, FTHFD rs1127717, GART rs8971, and SHMT rs1979277) were significantly associated with HCC risk in Chinese population, with P values range from 2.26 × 10(-4) to 0.035). | 0.000271442 | 2014 | MTRR | 5 | 7897078 | C | T |
| rs1042522 | 23564481 | 7157 | TP53 | umls:C2239176 | BeFree | Association between the p53 codon 72 Arg/Pro polymorphism and hepatocellular carcinoma risk. | 0.511429968 | 2013 | TP53 | 17 | 7676154 | G | T,C |
| rs1042522 | 25889455 | 7157 | TP53 | umls:C2239176 | BeFree | TP53 R72P polymorphism modulates DNA methylation in hepatocellular carcinoma. | 0.511429968 | 2015 | TP53 | 17 | 7676154 | G | T,C |
| rs1042522 | 15633234 | 7157 | TP53 | umls:C2239176 | BeFree | Homozygosity for Pro of p53 Arg72Pro as a potential risk factor for hepatocellular carcinoma in Chinese population. | 0.511429968 | 2005 | TP53 | 17 | 7676154 | G | T,C |
| rs1042522 | 23167333 | 7157 | TP53 | umls:C2239176 | BeFree | Association between TP53 Arg72Pro polymorphism and hepatocellular carcinoma risk: a meta-analysis. | 0.511429968 | 2012 | TP53 | 17 | 7676154 | G | T,C |
| rs1042522 | 20309940 | 7157 | TP53 | umls:C2239176 | BeFree | However, we did not find any main effect of TP53 Arg72Pro on HCC risk in this population. | 0.511429968 | 2011 | TP53 | 17 | 7676154 | G | T,C |
| rs1042522 | 21607615 | 7157 | TP53 | umls:C2239176 | BeFree | Because our results suggest for the first time that the Pro/Pro homozygote of p53 Arg72Pro polymorphism may be a genetic susceptibility factor for HCC (especially in the male gender and HBV-infected patients) in the Turkish population, further independent studies are required to validate our findings in a larger series, as well as in patients of different ethnic origins. | 0.511429968 | 2012 | TP53 | 17 | 7676154 | G | T,C |
| rs1045642 | 23109454 | 5243 | ABCB1 | umls:C2239176 | BeFree | Evaluation of the C3435T polymorphism in the MDR1 gene in patients with hepatocellular carcinoma. | 0.143102354 | 2012 | ABCB1 | 7 | 87509329 | A | T,G |
| rs1047840 | 22205538 | 9156 | EXO1 | umls:C2239176 | BeFree | The significance of Exonuclease 1 K589E polymorphism on hepatocellular carcinoma susceptibility in the Turkish population: a case-control study. | 0.000542884 | 2012 | EXO1 | 1 | 241878999 | G | A |
| rs104886003 | 18181165 | 5290 | PIK3CA | umls:C2239176 | BeFree | PIK3CA missense mutations were found in one of 11 intrahepatic CCA (E545K, 9%), one of 23 gallbladder carcinomas (E542K, 4%), and one of 50 hepatocellular carcinomas (H1047R, 2%). | 0.376829396 | 2008 | PIK3CA | 3 | 179218303 | G | A |
| rs1051740 | 8944076 | 2052 | EPHX1 | umls:C2239176 | BeFree | Polymorphic forms of the human EPHX gene have been described that vary in enzymatic activity, and one, Tyr113His, has been associated with hepatocellular carcinoma susceptibility. | 0.135807099 | 1996 | EPHX1 | 1 | 225831932 | T | C |
| rs1052133 | 23577090 | 4968 | OGG1 | umls:C2239176 | BeFree | hOGG1 Ser326Cys polymorphism and risk of hepatocellular carcinoma among East Asians: a meta-analysis. | 0.007448483 | 2013 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 23271362 | 4968 | OGG1 | umls:C2239176 | BeFree | Polymorphisms of excision repair gene XPD Lys751Gln and hOGG1 Ser326Cys might not be associated with hepatocellular carcinoma risk: a meta-analysis. | 0.007448483 | 2013 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 17085873 | 4968 | OGG1 | umls:C2239176 | BeFree | hOGG1 Ser326Cys polymorphism and risk of hepatocellular carcinoma among Japanese. | 0.007448483 | 2006 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 23186590 | 4968 | OGG1 | umls:C2239176 | BeFree | No association between hOGG1 Ser326Cys polymorphism and hepatocellular carcinoma. | 0.007448483 | 2014 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1053133 | 22659345 | 4968 | OGG1 | umls:C2239176 | BeFree | In addition, SNP of OGG1 rs1053133 was significantly associated with postoperative recurrence (OR, 0.604; p=0.049), tumor differentiation (OR, 0.571; p=0.041), and improved survival of resected HCC (MST of 55 and 108 months for the GG and GC/CC genotypes, p=0.001). | 0.007448483 | 2012 | BYSL | 6 | 41932887 | C | T |
| rs1055806 | 16109524 | 842 | CASP9 | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.003267234 | 2005 | BNIP3L | 8 | 26391347 | G | T |
| rs1055806 | 16109524 | 4595 | MUTYH | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.000542884 | 2005 | BNIP3L | 8 | 26391347 | G | T |
| rs1057035 | 23868705 | 5901 | RAN | umls:C2239176 | BeFree | These findings indicated that DICER1 rs1057035, RAN rs3803012, and PIWIL1 rs10773771 might contribute to the risk of HBV-related HCC. | 0.000271442 | 2013 | DICER1 | 14 | 95087805 | T | C |
| rs1057035 | 23868705 | 9271 | PIWIL1 | umls:C2239176 | BeFree | These findings indicated that DICER1 rs1057035, RAN rs3803012, and PIWIL1 rs10773771 might contribute to the risk of HBV-related HCC. | 0.000542884 | 2013 | DICER1 | 14 | 95087805 | T | C |
| rs1057035 | 23868705 | 23405 | DICER1 | umls:C2239176 | BeFree | We observed that DICER1 rs1057035 CT/CC variant genotypes were associated with a significant decreased risk of HCC (adjusted OR = 0.79, 95% CI = 0.64-0.96) compared with wild-type TT and RAN rs3803012 AG/GG variant genotypes increased the risk of HBV persistent infection compared with AA genotype (adjusted OR = 1.35, 95% CI = 1.03-1.77). | 0.000814326 | 2013 | DICER1 | 14 | 95087805 | T | C |
| rs1061622 | 16109524 | 4595 | MUTYH | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.000542884 | 2005 | TNFRSF1B | 1 | 12192898 | T | G |
| rs1061622 | 16109524 | 842 | CASP9 | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.003267234 | 2005 | TNFRSF1B | 1 | 12192898 | T | G |
| rs10741657 | 23734184 | 120227 | CYP2R1 | umls:C2239176 | BeFree | The well-known associations between CYP2R1 (rs1993116, rs10741657), GC (rs2282679), and DHCR7 (rs7944926, rs12785878) genotypes and 25(OH)D3 serum levels were also apparent in patients with chronic hepatitis C. The same genotypes of these single nucleotide polymorphisms (SNPs) that are associated with reduced 25(OH)D3 serum levels were found to be associated with HCV-related HCC (P = 0.07 [OR = 1.13, 95% CI = 0.99-1.28] for CYP2R1, P = 0.007 [OR = 1.56, 95% CI = 1.12-2.15] for GC, P = 0.003 [OR = 1.42, 95% CI = 1.13-1.78] for DHCR7; ORs for risk genotypes). | 0.000271442 | 2013 | CYP2R1 | 11 | 14893332 | A | G |
| rs10741657 | 23734184 | 1717 | DHCR7 | umls:C2239176 | BeFree | The well-known associations between CYP2R1 (rs1993116, rs10741657), GC (rs2282679), and DHCR7 (rs7944926, rs12785878) genotypes and 25(OH)D3 serum levels were also apparent in patients with chronic hepatitis C. The same genotypes of these single nucleotide polymorphisms (SNPs) that are associated with reduced 25(OH)D3 serum levels were found to be associated with HCV-related HCC (P = 0.07 [OR = 1.13, 95% CI = 0.99-1.28] for CYP2R1, P = 0.007 [OR = 1.56, 95% CI = 1.12-2.15] for GC, P = 0.003 [OR = 1.42, 95% CI = 1.13-1.78] for DHCR7; ORs for risk genotypes). | 0.000271442 | 2013 | CYP2R1 | 11 | 14893332 | A | G |
| rs10773771 | 23868705 | 9271 | PIWIL1 | umls:C2239176 | BeFree | These findings indicated that DICER1 rs1057035, RAN rs3803012, and PIWIL1 rs10773771 might contribute to the risk of HBV-related HCC. | 0.000542884 | 2013 | PIWIL1 | 12 | 130371771 | C | T |
| rs10773771 | 23868705 | 5901 | RAN | umls:C2239176 | BeFree | These findings indicated that DICER1 rs1057035, RAN rs3803012, and PIWIL1 rs10773771 might contribute to the risk of HBV-related HCC. | 0.000271442 | 2013 | PIWIL1 | 12 | 130371771 | C | T |
| rs10789859 | 25894340 | 6392 | SDHD | umls:C2239176 | BeFree | Finally, the survival tree analysis revealed that SNP rs10789859 in SDHD gene was the primary factor contributing to HCC recurrence in our population. | 0.000271442 | 2015 | SDHD | 11 | 112089809 | T | C |
| rs10901425 | 18768525 | 4316 | MMP7 | umls:C2239176 | BeFree | Our findings suggest that the polymorphisms MMP-7 A-181G, MMP-8 C-799T, and MMP-21 C572T may not play a major role in mediating susceptibility to hepatocellular carcinoma. | 0.012711618 | 2008 | MMP21 | 10 | 125773956 | A | G |
| rs11077 | 24676133 | 57510 | XPO5 | umls:C2239176 | BeFree | This is the first study reporting that polymorphisms related to miRSNPs have prognostic value in hepatocellular carcinoma and identify the A/A genotype of rs11077 SNP site located in XPO5 3'UTR can help to predict worse prognosis in patients. | 0.000271442 | 2014 | POLR1C;XPO5 | 6 | 43523209 | T | G |
| rs11134527 | 22011248 | 7726 | TRIM26 | umls:C2239176 | BeFree | The AG genotype of pri-miR-218 rs11134527 A/G was associated with family history (p=0.018, odds ratio [OR]=2.96, 95% confidence interval [CI]: 1.16-7.56) and elevated serum α-fetoprotein (serum alpha-fetoprotein [AFP]) levels (≥20 ng/mL; p=0.009, OR=1.92, 95% CI: 1.17-3.14) in HCC patients. | 0.03040149 | 2012 | SLIT3;MIR218-2 | 5 | 168768351 | G | A |
| rs1127717 | 25318605 | 2618 | GART | umls:C2239176 | BeFree | Results showed that six SNPs (MTHFR rs1801133, MTRR rs2287780, MTRR rs10380, FTHFD rs1127717, GART rs8971, and SHMT rs1979277) were significantly associated with HCC risk in Chinese population, with P values range from 2.26 × 10(-4) to 0.035). | 0.000271442 | 2014 | ALDH1L1;ALDH1L1-AS1 | 3 | 126107216 | T | C |
| rs1127717 | 25318605 | 6470 | SHMT1 | umls:C2239176 | BeFree | Results showed that six SNPs (MTHFR rs1801133, MTRR rs2287780, MTRR rs10380, FTHFD rs1127717, GART rs8971, and SHMT rs1979277) were significantly associated with HCC risk in Chinese population, with P values range from 2.26 × 10(-4) to 0.035). | 0.000271442 | 2014 | ALDH1L1;ALDH1L1-AS1 | 3 | 126107216 | T | C |
| rs1140507 | 16109524 | 4595 | MUTYH | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.000542884 | 2005 | MUTYH | 1 | 45333454 | A | G |
| rs1140507 | 16109524 | 842 | CASP9 | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.003267234 | 2005 | MUTYH | 1 | 45333454 | A | G |
| rs1143627 | 21240526 | 6648 | SOD2 | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.128729747 | 2011 | IL1B | 2 | 112836810 | G | A |
| rs1143627 | 21240526 | 54577 | UGT1A7 | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.01717424 | 2011 | IL1B | 2 | 112836810 | G | A |
| rs1143627 | 21240526 | 3553 | IL1B | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.029608365 | 2011 | IL1B | 2 | 112836810 | G | A |
| rs114465251 | 22015712 | 3135 | HLA-G | umls:C2239176 | BeFree | Four SNPs (rs17875380, rs41557518, rs114465251, and rs115492845) were associated with altered susceptibility to HBV or HCC, and HLA-F*01:04, HLA-G*01:05N, and HLA-E*01:01 were associated with hepatitis B or hepatitis B complicated with HCC. | 0.001357209 | 2012 | NA | NA | NA | NA | NA |
| rs11540654 | 23167333 | 7157 | TP53 | umls:C2239176 | BeFree | Association between TP53 Arg72Pro polymorphism and hepatocellular carcinoma risk: a meta-analysis. | 0.511429968 | 2012 | TP53 | 17 | 7676040 | C | T,G,A |
| rs11540654 | 21607615 | 7157 | TP53 | umls:C2239176 | BeFree | Because our results suggest for the first time that the Pro/Pro homozygote of p53 Arg72Pro polymorphism may be a genetic susceptibility factor for HCC (especially in the male gender and HBV-infected patients) in the Turkish population, further independent studies are required to validate our findings in a larger series, as well as in patients of different ethnic origins. | 0.511429968 | 2012 | TP53 | 17 | 7676040 | C | T,G,A |
| rs11540654 | 20309940 | 7157 | TP53 | umls:C2239176 | BeFree | However, we did not find any main effect of TP53 Arg72Pro on HCC risk in this population. | 0.511429968 | 2011 | TP53 | 17 | 7676040 | C | T,G,A |
| rs11540654 | 25889455 | 7157 | TP53 | umls:C2239176 | BeFree | TP53 R72P polymorphism modulates DNA methylation in hepatocellular carcinoma. | 0.511429968 | 2015 | TP53 | 17 | 7676040 | C | T,G,A |
| rs11540654 | 15633234 | 7157 | TP53 | umls:C2239176 | BeFree | Homozygosity for Pro of p53 Arg72Pro as a potential risk factor for hepatocellular carcinoma in Chinese population. | 0.511429968 | 2005 | TP53 | 17 | 7676040 | C | T,G,A |
| rs11540654 | 23564481 | 7157 | TP53 | umls:C2239176 | BeFree | Association between the p53 codon 72 Arg/Pro polymorphism and hepatocellular carcinoma risk. | 0.511429968 | 2013 | TP53 | 17 | 7676040 | C | T,G,A |
| rs115492845 | 22015712 | 3135 | HLA-G | umls:C2239176 | BeFree | Four SNPs (rs17875380, rs41557518, rs114465251, and rs115492845) were associated with altered susceptibility to HBV or HCC, and HLA-F*01:04, HLA-G*01:05N, and HLA-E*01:01 were associated with hepatitis B or hepatitis B complicated with HCC. | 0.001357209 | 2012 | NA | NA | NA | NA | NA |
| rs11569017 | 23790025 | 1950 | EGF | umls:C2239176 | BeFree | Additionally, the haplotype T-G constructed by rs11569017 and rs4444903 of the EGF gene might increase the risk of HBV-related HCC (p=0.002, OR=1.44, 95% CI=1.15-1.82). | 0.144297742 | 2014 | EGF | 4 | 109980955 | A | T |
| rs11614913 | 22768213 | 406938 | MIR146A | umls:C2239176 | BeFree | It has been suggested that two common SNPs rs2910164 in miR-146a and rs11614913 in miR-196a2 are associated with susceptibility to hepatocellular carcinoma (HCC). | 0.01052022 | 2012 | MIR196A2 | 12 | 53991815 | C | T |
| rs116350678 | 12101426 | 8312 | AXIN1 | umls:C2239176 | UNIPROT | Mutational spectrum of beta-catenin, AXIN1, and AXIN2 in hepatocellular carcinomas and hepatoblastomas. | 0.362985861 | 2002 | AXIN1 | 16 | 298233 | C | T |
| rs11692021 | 21240526 | 3553 | IL1B | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.029608365 | 2011 | UGT1A10;UGT1A8;UGT1A7;UGT1A9 | 2 | 233682559 | T | C |
| rs11692021 | 21240526 | 54577 | UGT1A7 | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.01717424 | 2011 | UGT1A10;UGT1A8;UGT1A7;UGT1A9 | 2 | 233682559 | T | C |
| rs11692021 | 21240526 | 6648 | SOD2 | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.128729747 | 2011 | UGT1A10;UGT1A8;UGT1A7;UGT1A9 | 2 | 233682559 | T | C |
| rs117208012 | 12101426 | 8312 | AXIN1 | umls:C2239176 | UNIPROT | Mutational spectrum of beta-catenin, AXIN1, and AXIN2 in hepatocellular carcinomas and hepatoblastomas. | 0.362985861 | 2002 | AXIN1 | 16 | 297063 | C | T |
| rs11871275 | 25735330 | 31 | ACACA | umls:C2239176 | BeFree | Although we did not find any significant results in total analysis (all p>0.05), our stratified data showed that SNP rs9912300 in ACLY gene was significantly associated with overall survival of HCC patients with lower AFP level and SNP rs11871275 in ACACA gene was significantly associated with overall survival of HCC patients with higher AFP level. | 0.120271442 | 2015 | TADA2A | 17 | 37409002 | A | T |
| rs11871275 | 25735330 | 47 | ACLY | umls:C2239176 | BeFree | Although we did not find any significant results in total analysis (all p>0.05), our stratified data showed that SNP rs9912300 in ACLY gene was significantly associated with overall survival of HCC patients with lower AFP level and SNP rs11871275 in ACACA gene was significantly associated with overall survival of HCC patients with higher AFP level. | 0.120271442 | 2015 | TADA2A | 17 | 37409002 | A | T |
| rs11879293 | 24556940 | 6597 | SMARCA4 | umls:C2239176 | BeFree | Moreover, the decreased risk of HCC associated with SMARCA4 rs11879293 AG/AA was more evident among HBsAg positive individuals (OR = 0.47, 95% CI: 0.27-0.80) in combined analysis. | 0.000814326 | 2014 | SMARCA4 | 19 | 10961934 | G | A |
| rs12100561 | 21105107 | 90141 | EFCAB11 | umls:C2239176 | GAD | [Genetic variations at loci involved in the immune response are risk factors for hepatocellular carcinoma.] | 0.002638474 | 2010 | EFCAB11 | 14 | 89834691 | A | G |
| rs121434587 | NA | 3482 | IGF2R | umls:C2239176 | CLINVAR | NA | 0.251073035 | NA | IGF2R | 6 | 160069961 | G | T |
| rs121434588 | NA | 3482 | IGF2R | umls:C2239176 | CLINVAR | NA | 0.251073035 | NA | IGF2R | 6 | 160070006 | G | A |
| rs121434592 | 18392055 | 207 | AKT1 | umls:C2239176 | BeFree | This study demonstrated that the AKT1 E17K mutation occurs in breast cancers at a low frequency, and that it is rare in other common cancers, including colorectal, lung, gastric and hepatocellular carcinomas and acute leukaemias. | 0.014386419 | 2008 | AKT1 | 14 | 104780214 | C | T |
| rs121912654 | NA | 7157 | TP53 | umls:C2239176 | CLINVAR | NA | 0.511429968 | NA | TP53 | 17 | 7675143 | C | T,A |
| rs121913273 | 18181165 | 5290 | PIK3CA | umls:C2239176 | BeFree | PIK3CA missense mutations were found in one of 11 intrahepatic CCA (E545K, 9%), one of 23 gallbladder carcinomas (E542K, 4%), and one of 50 hepatocellular carcinomas (H1047R, 2%). | 0.376829396 | 2008 | PIK3CA | 3 | 179218294 | G | A |
| rs121913274 | NA | 5290 | PIK3CA | umls:C2239176 | CLINVAR | NA | 0.376829396 | NA | PIK3CA | 3 | 179218304 | A | C,G |
| rs121913279 | NA | 5290 | PIK3CA | umls:C2239176 | CLINVAR | NA | 0.376829396 | NA | PIK3CA | 3 | 179234297 | A | G,T |
| rs121913279 | 23167739 | 5290 | PIK3CA | umls:C2239176 | BeFree | Moreover, by analyzing primary HCC tissue samples we were able to demonstrate that a hotspot mutation (H1047R) of PI3KCA, the gene encoding the catalytic subunit of PI3K, was associated with increased in vitro kinase activity of all AKT isoforms in comparison to healthy liver tissue of the patient. | 0.376829396 | 2012 | PIK3CA | 3 | 179234297 | A | G,T |
| rs121913279 | 18181165 | 5290 | PIK3CA | umls:C2239176 | BeFree | PIK3CA missense mutations were found in one of 11 intrahepatic CCA (E545K, 9%), one of 23 gallbladder carcinomas (E542K, 4%), and one of 50 hepatocellular carcinomas (H1047R, 2%). | 0.376829396 | 2008 | PIK3CA | 3 | 179234297 | A | G,T |
| rs121913407 | NA | 1499 | CTNNB1 | umls:C2239176 | CLINVAR | NA | 0.282629813 | NA | CTNNB1 | 3 | 41224645 | T | C,G |
| rs121913409 | NA | 1499 | CTNNB1 | umls:C2239176 | CLINVAR | NA | 0.282629813 | NA | CTNNB1 | 3 | 41224646 | C | A,G,T |
| rs12338 | 25106406 | 1508 | CTSB | umls:C2239176 | BeFree | A4383C and C76G SNP in Cathepsin B is respectively associated with the high risk and tumor size of hepatocarcinoma. | 0.080542884 | 2014 | CTSB | 8 | 11853379 | G | T,C,A |
| rs12785878 | 23734184 | 1717 | DHCR7 | umls:C2239176 | BeFree | The well-known associations between CYP2R1 (rs1993116, rs10741657), GC (rs2282679), and DHCR7 (rs7944926, rs12785878) genotypes and 25(OH)D3 serum levels were also apparent in patients with chronic hepatitis C. The same genotypes of these single nucleotide polymorphisms (SNPs) that are associated with reduced 25(OH)D3 serum levels were found to be associated with HCV-related HCC (P = 0.07 [OR = 1.13, 95% CI = 0.99-1.28] for CYP2R1, P = 0.007 [OR = 1.56, 95% CI = 1.12-2.15] for GC, P = 0.003 [OR = 1.42, 95% CI = 1.13-1.78] for DHCR7; ORs for risk genotypes). | 0.000271442 | 2013 | NADSYN1 | 11 | 71456403 | G | T |
| rs12785878 | 23734184 | 120227 | CYP2R1 | umls:C2239176 | BeFree | The well-known associations between CYP2R1 (rs1993116, rs10741657), GC (rs2282679), and DHCR7 (rs7944926, rs12785878) genotypes and 25(OH)D3 serum levels were also apparent in patients with chronic hepatitis C. The same genotypes of these single nucleotide polymorphisms (SNPs) that are associated with reduced 25(OH)D3 serum levels were found to be associated with HCV-related HCC (P = 0.07 [OR = 1.13, 95% CI = 0.99-1.28] for CYP2R1, P = 0.007 [OR = 1.56, 95% CI = 1.12-2.15] for GC, P = 0.003 [OR = 1.42, 95% CI = 1.13-1.78] for DHCR7; ORs for risk genotypes). | 0.000271442 | 2013 | NADSYN1 | 11 | 71456403 | G | T |
| rs12979860 | 25837166 | 282617 | IFNL3 | umls:C2239176 | BeFree | IL28B genetic variations (rs12979860) were genotyped by pyrosequencing of DNA samples from 137 individuals with chronic HBV infection [50 inactive carriers (IC), 34 chronic hepatitis B (CHB), 27 cirrhosis, 26 hepatocellular carcinoma (HCC)], and 19 healthy controls. | 0.005971721 | 2015 | IFNL3;IFNL4 | 19 | 39248147 | C | T |
| rs12979860 | 21146242 | 282617 | IFNL3 | umls:C2239176 | BeFree | IL-28B rs12979860 C/T allele distribution in patients with liver cirrhosis: role in the course of chronic viral hepatitis and the development of HCC. | 0.005971721 | 2011 | IFNL3;IFNL4 | 19 | 39248147 | C | T |
| rs12979860 | 22666430 | 282617 | IFNL3 | umls:C2239176 | BeFree | We have determined the rs12979860 single nucleotide polymorphism (SNP) upstream IL28B gene in two groups of patients with HCV-induced chronic liver disease: 1) 268 patients (159 men) with biopsy-proven chronic hepatitis C, to analyse its relation with biochemical, virological and histological features; and 2) 134 patients (97 men) with HCV-related hepatocellular carcinoma. | 0.005971721 | 2012 | IFNL3;IFNL4 | 19 | 39248147 | C | T |
| rs12979860 | 25504078 | 80339 | PNPLA3 | umls:C2239176 | BeFree | Single nucleotide polymorphisms (SNPs) in the epidermal growth factor (EGF, rs4444903), patatin-like phospholipase domain-containing protein 3 (PNPLA3, rs738409) genes, and near the interleukin-28B (IL28B, rs12979860) gene are linked to treatment response, fibrosis, and hepatocellular carcinoma (HCC) in chronic hepatitis C. Whether these SNPs independently or in combination predict clinical deterioration in hepatitis C virus (HCV)-related cirrhosis is unknown. | 0.005700279 | 2014 | IFNL3;IFNL4 | 19 | 39248147 | C | T |
| rs12979860 | 24085431 | 282617 | IFNL3 | umls:C2239176 | BeFree | We examined the association of the interleukin-28B (IL-28B) gene rs12979860 T/C polymorphism with development of hepatitis virus-related hepatocellular carcinoma (HCC) and liver cirrhosis (LC). | 0.005971721 | 2014 | IFNL3;IFNL4 | 19 | 39248147 | C | T |
| rs12979860 | 25504078 | 282617 | IFNL3 | umls:C2239176 | BeFree | Single nucleotide polymorphisms (SNPs) in the epidermal growth factor (EGF, rs4444903), patatin-like phospholipase domain-containing protein 3 (PNPLA3, rs738409) genes, and near the interleukin-28B (IL28B, rs12979860) gene are linked to treatment response, fibrosis, and hepatocellular carcinoma (HCC) in chronic hepatitis C. Whether these SNPs independently or in combination predict clinical deterioration in hepatitis C virus (HCV)-related cirrhosis is unknown. | 0.005971721 | 2014 | IFNL3;IFNL4 | 19 | 39248147 | C | T |
| rs12979860 | 25460552 | 282617 | IFNL3 | umls:C2239176 | BeFree | Based on a retrospective study of patients treated for HCV infection, the IFNL3 rs12979860 CT and TT polymorphisms are associated with a risk for HCC, especially in patients without a SVR. | 0.005971721 | 2014 | IFNL3;IFNL4 | 19 | 39248147 | C | T |
| rs12979860 | 25504078 | 1950 | EGF | umls:C2239176 | BeFree | Single nucleotide polymorphisms (SNPs) in the epidermal growth factor (EGF, rs4444903), patatin-like phospholipase domain-containing protein 3 (PNPLA3, rs738409) genes, and near the interleukin-28B (IL28B, rs12979860) gene are linked to treatment response, fibrosis, and hepatocellular carcinoma (HCC) in chronic hepatitis C. Whether these SNPs independently or in combination predict clinical deterioration in hepatitis C virus (HCV)-related cirrhosis is unknown. | 0.144297742 | 2014 | IFNL3;IFNL4 | 19 | 39248147 | C | T |
| rs13181 | 25337275 | 7517 | XRCC3 | umls:C2239176 | BeFree | In this study, we investigated whether six polymorphisms (including rs25487, rs861539, rs7003908, rs28383151, rs13181, and rs2228001) in DNA repair genes (XPC, XRCC4, XRCC1, XRCC4, XPD, XRCC7, and XRCC3) interacted with AFB1, and the gene-environmental interactive role in the risk of HCC using hospital-based case-control study (including 1486 HCC cases and 1996 controls). | 0.007534359 | 2014 | ERCC2;KLC3 | 19 | 45351661 | T | A,G |
| rs13181 | 19919686 | 2068 | ERCC2 | umls:C2239176 | GAD | [XPD codon 312 and 751 polymorphisms, and AFB1 exposure, and hepatocellular carcinoma risk.] | 0.003995683 | 2009 | ERCC2;KLC3 | 19 | 45351661 | T | A,G |
| rs132770 | 25569644 | 2547 | XRCC6 | umls:C2239176 | BeFree | Sensitivity analyses were also performed.The rs2267437 polymorphism was associated with a significant increase in risks of overall cancers, breast cancer, renal cell carcinoma and hepatocellular carcinoma, and it could increase the cancer risk in Asian population; the rs5751129 polymorphism could increase the cancer risk in overall cancers; the rs132770 polymorphism was associated with the increased renal cell carcinoma risk; furthermore, the rs132793 polymorphism could decrease breast cancer risk and increase risks in other cancers.Overall, the results provided evidences that the single nucleotide polymorphisms in XRCC6 promoter region might play different roles in various cancers, indicating different cancers have different tumorigenesis mechanisms. | 0.000814326 | 2015 | XRCC6;DESI1 | 22 | 41621260 | A | G |
| rs132793 | 25569644 | 2547 | XRCC6 | umls:C2239176 | BeFree | Sensitivity analyses were also performed.The rs2267437 polymorphism was associated with a significant increase in risks of overall cancers, breast cancer, renal cell carcinoma and hepatocellular carcinoma, and it could increase the cancer risk in Asian population; the rs5751129 polymorphism could increase the cancer risk in overall cancers; the rs132770 polymorphism was associated with the increased renal cell carcinoma risk; furthermore, the rs132793 polymorphism could decrease breast cancer risk and increase risks in other cancers.Overall, the results provided evidences that the single nucleotide polymorphisms in XRCC6 promoter region might play different roles in various cancers, indicating different cancers have different tumorigenesis mechanisms. | 0.000814326 | 2015 | NA | 22 | 41667677 | A | G |
| rs13706 | 19101572 | 990 | CDC6 | umls:C2239176 | BeFree | Association analysis between the Cdc6 G1321A polymorphism and the risk for non-Hodgkin lymphoma and hepatocellular carcinoma. | 0.008001298 | 2009 | CDC6 | 17 | 40300899 | G | A,C |
| rs144479038 | 10987270 | 1033 | CDKN3 | umls:C2239176 | UNIPROT | Eight of 14 biopsy tissues obtained from advanced HCC, 6 of 13 surgically removed HCC tissues, and 2 of the adjacent noncancerous tissues contained aberrant KAP transcripts. | 0.122442977 | 2000 | CDKN3 | 14 | 54411612 | A | G |
| rs1501299 | 23740135 | 9370 | ADIPOQ | umls:C2239176 | BeFree | The adiponectin gene single-nucleotide polymorphism rs1501299 is associated with hepatocellular carcinoma risk. | 0.001085767 | 2013 | ADIPOQ;ADIPOQ-AS1 | 3 | 186853334 | G | T |
| rs1559931 | 26074057 | 29851 | ICOS | umls:C2239176 | BeFree | Our study found that ICOS rs1559931 SNP was associated with decreased HBV-related HCC risk in the studied Chinese Han population, except for patients with natural clearance of HBV. | 0.000271442 | 2015 | ICOS | 2 | 203961006 | G | A |
| rs157077 | 25835968 | 27306 | HPGDS | umls:C2239176 | BeFree | Glutathione S-transferase O2 gene rs157077 polymorphism predicts response to transarterial chemoembolization in hepatocellular carcinoma. | 0.007328931 | 2015 | GSTO2 | 10 | 104278136 | T | C |
| rs1695 | 23765758 | 2950 | GSTP1 | umls:C2239176 | BeFree | Quantitative assessment of the association between GSTP1 gene Ile105Val polymorphism and susceptibility to hepatocellular carcinoma. | 0.14780408 | 2013 | GSTP1 | 11 | 67585218 | A | G |
| rs1713449 | 23907815 | 7011 | TEP1 | umls:C2239176 | BeFree | A significantly increased risk of HCC development was identified for the telomerase-associated protein 1 (TEP1) rs1713449 SNP in both the discovery and replication phases (combined odds ratio = 1.42, P = 9.378 × 10(-5) ). | 0.000814326 | 2013 | TEP1 | 14 | 20373548 | C | T |
| rs17251221 | 25270285 | 846 | CASR | umls:C2239176 | BeFree | A genetic variant (rs17251221) in the calcium-sensing receptor relates to hepatocellular carcinoma susceptibility and clinical outcome treated by transcatheter hepatic arterial chemoembolization (TACE) therapy. | 0.001357209 | 2014 | CASR | 3 | 122274400 | A | G |
| rs17401966 | 20676096 | 23095 | KIF1B | umls:C2239176 | GAD | [Our findings provide evidence that the 1p36.22 locus confers susceptibility to HBV-related HCC, and suggest that KIF1B-, UBE4B- or PGD-related pathways might be involved in the pathogenesis of this malignancy.] | 0.123995683 | 2010 | KIF1B | 1 | 10325413 | A | G |
| rs17401966 | 24952890 | 23095 | KIF1B | umls:C2239176 | BeFree | Association between KIF1B rs17401966 polymorphism and hepatocellular carcinoma risk: a meta-analysis involving 17,210 subjects. | 0.123995683 | 2014 | KIF1B | 1 | 10325413 | A | G |
| rs17401966 | 20676096 | 23095 | KIF1B | umls:C2239176 | BeFree | We identified one intronic SNP (rs17401966) in KIF1B on chromosome 1p36.22 that was highly associated with HBV-related HCC and confirmed this association in five additional independent samples, consisting of 1,962 individuals with HCC, 1,430 control subjects and 159 family trios. | 0.123995683 | 2010 | KIF1B | 1 | 10325413 | A | G |
| rs17401966 | 22712471 | 23095 | KIF1B | umls:C2239176 | BeFree | A recent genome-wide association study (GWAS) using chronic HBV (hepatitis B virus) carriers with and without hepatocellular carcinoma (HCC) in five independent Chinese populations found that one SNP (rs17401966) in KIF1B was associated with susceptibility to HCC. | 0.123995683 | 2012 | KIF1B | 1 | 10325413 | A | G |
| rs17401966 | 20676096 | 23095 | KIF1B | umls:C2239176 | GWASCAT | Our findings provide evidence that the 1p36.22 locus confers susceptibility to HBV-related HCC, and suggest that KIF1B-, UBE4B- or PGD-related pathways might be involved in the pathogenesis of this malignancy. | 0.123995683 | 2010 | KIF1B | 1 | 10325413 | A | G |
| rs17592236 | 25739100 | 2308 | FOXO1 | umls:C2239176 | BeFree | Together, these results indicate that the rs17592236 polymorphism is associated with decreasing of HCC hereditary susceptibility likely through modulating the binding affinity of miR-137 to the 3'UTR in FOXO1 messenger RNA (mRNA). | 0.002442977 | 2015 | FOXO1 | 13 | 40557795 | C | T |
| rs17592236 | 25739100 | 406928 | MIR137 | umls:C2239176 | BeFree | Together, these results indicate that the rs17592236 polymorphism is associated with decreasing of HCC hereditary susceptibility likely through modulating the binding affinity of miR-137 to the 3'UTR in FOXO1 messenger RNA (mRNA). | 0.000542884 | 2015 | FOXO1 | 13 | 40557795 | C | T |
| rs17868323 | 21240526 | 54577 | UGT1A7 | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.01717424 | 2011 | UGT1A10;UGT1A8;UGT1A7;UGT1A9 | 2 | 233682324 | T | G |
| rs17868323 | 21240526 | 6648 | SOD2 | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.128729747 | 2011 | UGT1A10;UGT1A8;UGT1A7;UGT1A9 | 2 | 233682324 | T | G |
| rs17868323 | 21240526 | 3553 | IL1B | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.029608365 | 2011 | UGT1A10;UGT1A8;UGT1A7;UGT1A9 | 2 | 233682324 | T | G |
| rs17875380 | 22015712 | 3135 | HLA-G | umls:C2239176 | BeFree | Four SNPs (rs17875380, rs41557518, rs114465251, and rs115492845) were associated with altered susceptibility to HBV or HCC, and HLA-F*01:04, HLA-G*01:05N, and HLA-E*01:01 were associated with hepatitis B or hepatitis B complicated with HCC. | 0.001357209 | 2012 | HLA-F | 6 | 29723805 | C | A |
| rs1799945 | 20196837 | 3077 | HFE | umls:C2239176 | BeFree | Association between C282Y and H63D mutations of the HFE gene with hepatocellular carcinoma in European populations: a meta-analysis. | 0.04409193 | 2010 | HFE | 6 | 26090951 | C | G |
| rs1799945 | 21925577 | 3077 | HFE | umls:C2239176 | BeFree | Our aim was to estimate the frequency of hemochromatosis gene (HFE) mutant alleles (C282Y and H63D) and alpha-1 antitrypsin S/Z variants among Egyptian HCV cirrhotic patients and in hepatocellular carcinoma patients and to evaluate their effects on disease progression. | 0.04409193 | 2011 | HFE | 6 | 26090951 | C | G |
| rs1800206 | 19119483 | 5465 | PPARA | umls:C2239176 | BeFree | Peroxisome proliferator-activated receptor alpha L162V polymorphism tends to occur in HBV-induced hepatocellular carcinoma and is absent in HCV-related hepatocellular carcinoma. | 0.005710211 | 2008 | PPARA | 22 | 46218377 | C | G |
| rs1800562 | 21240526 | 6648 | SOD2 | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.128729747 | 2011 | HFE | 6 | 26092913 | G | A |
| rs1800562 | 21240526 | 3553 | IL1B | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.029608365 | 2011 | HFE | 6 | 26092913 | G | A |
| rs1800562 | 20673159 | 3077 | HFE | umls:C2239176 | BeFree | We assessed the influence of Ala16Val-superoxide dismutase 2, Pro198Leu-glutathione peroxidase 1, and -463G/A-myeloperoxidase genotypes (high activity for the Ala, Pro, and G alleles, respectively) on the risks of cirrhosis and hepatocellular carcinoma (HCC) in patients homozygous for the C282Y-hemochromatosis (HFE) gene mutation. | 0.04409193 | 2011 | HFE | 6 | 26092913 | G | A |
| rs1800562 | 21240526 | 3077 | HFE | umls:C2239176 | BeFree | Two SNPs (rs1800562 of HFE and rs2279744 of MDM2) were associated with HCC with moderate epidemiological evidence and deserve further study and additional biological and clinical assessment. | 0.04409193 | 2011 | HFE | 6 | 26092913 | G | A |
| rs1800562 | 20673159 | 2876 | GPX1 | umls:C2239176 | BeFree | We assessed the influence of Ala16Val-superoxide dismutase 2, Pro198Leu-glutathione peroxidase 1, and -463G/A-myeloperoxidase genotypes (high activity for the Ala, Pro, and G alleles, respectively) on the risks of cirrhosis and hepatocellular carcinoma (HCC) in patients homozygous for the C282Y-hemochromatosis (HFE) gene mutation. | 0.001085767 | 2011 | HFE | 6 | 26092913 | G | A |
| rs1800562 | 15929796 | 3077 | HFE | umls:C2239176 | BeFree | Hepatocellular carcinoma and the penetrance of HFE C282Y mutations: a cross sectional study. | 0.04409193 | 2005 | HFE | 6 | 26092913 | G | A |
| rs1800562 | 10845668 | 3077 | HFE | umls:C2239176 | BeFree | Increased incidence of HFE C282Y mutations in patients with iron overload and hepatocellular carcinoma developed in non-cirrhotic liver. | 0.04409193 | 2000 | HFE | 6 | 26092913 | G | A |
| rs1800562 | 21925577 | 3077 | HFE | umls:C2239176 | BeFree | Our aim was to estimate the frequency of hemochromatosis gene (HFE) mutant alleles (C282Y and H63D) and alpha-1 antitrypsin S/Z variants among Egyptian HCV cirrhotic patients and in hepatocellular carcinoma patients and to evaluate their effects on disease progression. | 0.04409193 | 2011 | HFE | 6 | 26092913 | G | A |
| rs1800562 | 20196837 | 3077 | HFE | umls:C2239176 | BeFree | Association between C282Y and H63D mutations of the HFE gene with hepatocellular carcinoma in European populations: a meta-analysis. | 0.04409193 | 2010 | HFE | 6 | 26092913 | G | A |
| rs1800562 | 21240526 | 54577 | UGT1A7 | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.01717424 | 2011 | HFE | 6 | 26092913 | G | A |
| rs1800562 | 20673159 | 4353 | MPO | umls:C2239176 | BeFree | We assessed the influence of Ala16Val-superoxide dismutase 2, Pro198Leu-glutathione peroxidase 1, and -463G/A-myeloperoxidase genotypes (high activity for the Ala, Pro, and G alleles, respectively) on the risks of cirrhosis and hepatocellular carcinoma (HCC) in patients homozygous for the C282Y-hemochromatosis (HFE) gene mutation. | 0.123452799 | 2011 | HFE | 6 | 26092913 | G | A |
| rs1800562 | 21240526 | 4193 | MDM2 | umls:C2239176 | BeFree | Two SNPs (rs1800562 of HFE and rs2279744 of MDM2) were associated with HCC with moderate epidemiological evidence and deserve further study and additional biological and clinical assessment. | 0.021507378 | 2011 | HFE | 6 | 26092913 | G | A |
| rs1800562 | 15017669 | 3077 | HFE | umls:C2239176 | BeFree | HFE C282Y heterozygosity in hepatocellular carcinoma: evidence for an increased prevalence. | 0.04409193 | 2003 | HFE | 6 | 26092913 | G | A |
| rs1800625 | 26313784 | 101669765 | LINC00914 | umls:C2239176 | BeFree | In conclusion, our data suggest a correlation of RAGE gene polymorphism rs1800625 with the early stage of liver tumorigenesis and implicate its protective role in the progression of HCC. | 0.000542884 | 2015 | AGER;PBX2 | 6 | 32184665 | A | G |
| rs1800682 | 25723590 | 355 | FAS | umls:C2239176 | BeFree | The CD95 rs1800682A/G site polymorphism may be associated with hepatocellular carcinoma susceptibility. | 0.012430244 | 2015 | ACTA2;FAS | 10 | 88990206 | A | G |
| rs1801133 | 25318605 | 6470 | SHMT1 | umls:C2239176 | BeFree | Results showed that six SNPs (MTHFR rs1801133, MTRR rs2287780, MTRR rs10380, FTHFD rs1127717, GART rs8971, and SHMT rs1979277) were significantly associated with HCC risk in Chinese population, with P values range from 2.26 × 10(-4) to 0.035). | 0.000271442 | 2014 | MTHFR | 1 | 11796321 | G | A |
| rs1801133 | 25318605 | 2618 | GART | umls:C2239176 | BeFree | Results showed that six SNPs (MTHFR rs1801133, MTRR rs2287780, MTRR rs10380, FTHFD rs1127717, GART rs8971, and SHMT rs1979277) were significantly associated with HCC risk in Chinese population, with P values range from 2.26 × 10(-4) to 0.035). | 0.000271442 | 2014 | MTHFR | 1 | 11796321 | G | A |
| rs1801955 | 16109524 | 4595 | MUTYH | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.000542884 | 2005 | PHGDH | 1 | 119743954 | T | A |
| rs1801955 | 16109524 | 842 | CASP9 | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.003267234 | 2005 | PHGDH | 1 | 119743954 | T | A |
| rs1805377 | 22659345 | 7518 | XRCC4 | umls:C2239176 | BeFree | The SNP of XRCC4 rs1805377 was significantly associated with decreased risk of HCC development (OR, 0.592; p=0.028) and improved overall survival of patients with HCC (median survival time (MST) of 48, 72, and 89 months for the AA, AG, and GG genotypes, respectively; p=0.044). | 0.000814326 | 2012 | XRCC4 | 5 | 83353124 | G | A |
| rs187103704 | 16650523 | 57509 | MTUS1 | umls:C2239176 | UNIPROT | Mutation analysis of the 8p22 candidate tumor suppressor gene ATIP/MTUS1 in hepatocellular carcinoma. | 0.120271442 | 2006 | MTUS1 | 8 | 17713220 | T | G |
| rs1979277 | 25318605 | 2618 | GART | umls:C2239176 | BeFree | Results showed that six SNPs (MTHFR rs1801133, MTRR rs2287780, MTRR rs10380, FTHFD rs1127717, GART rs8971, and SHMT rs1979277) were significantly associated with HCC risk in Chinese population, with P values range from 2.26 × 10(-4) to 0.035). | 0.000271442 | 2014 | SHMT1 | 17 | 18328782 | G | A |
| rs1979277 | 25318605 | 6470 | SHMT1 | umls:C2239176 | BeFree | Results showed that six SNPs (MTHFR rs1801133, MTRR rs2287780, MTRR rs10380, FTHFD rs1127717, GART rs8971, and SHMT rs1979277) were significantly associated with HCC risk in Chinese population, with P values range from 2.26 × 10(-4) to 0.035). | 0.000271442 | 2014 | SHMT1 | 17 | 18328782 | G | A |
| rs1993116 | 23734184 | 120227 | CYP2R1 | umls:C2239176 | BeFree | The well-known associations between CYP2R1 (rs1993116, rs10741657), GC (rs2282679), and DHCR7 (rs7944926, rs12785878) genotypes and 25(OH)D3 serum levels were also apparent in patients with chronic hepatitis C. The same genotypes of these single nucleotide polymorphisms (SNPs) that are associated with reduced 25(OH)D3 serum levels were found to be associated with HCV-related HCC (P = 0.07 [OR = 1.13, 95% CI = 0.99-1.28] for CYP2R1, P = 0.007 [OR = 1.56, 95% CI = 1.12-2.15] for GC, P = 0.003 [OR = 1.42, 95% CI = 1.13-1.78] for DHCR7; ORs for risk genotypes). | 0.000271442 | 2013 | CYP2R1 | 11 | 14888688 | A | G |
| rs1993116 | 23734184 | 1717 | DHCR7 | umls:C2239176 | BeFree | The well-known associations between CYP2R1 (rs1993116, rs10741657), GC (rs2282679), and DHCR7 (rs7944926, rs12785878) genotypes and 25(OH)D3 serum levels were also apparent in patients with chronic hepatitis C. The same genotypes of these single nucleotide polymorphisms (SNPs) that are associated with reduced 25(OH)D3 serum levels were found to be associated with HCV-related HCC (P = 0.07 [OR = 1.13, 95% CI = 0.99-1.28] for CYP2R1, P = 0.007 [OR = 1.56, 95% CI = 1.12-2.15] for GC, P = 0.003 [OR = 1.42, 95% CI = 1.13-1.78] for DHCR7; ORs for risk genotypes). | 0.000271442 | 2013 | CYP2R1 | 11 | 14888688 | A | G |
| rs199475623 | 17408607 | 5553 | PRG2 | umls:C2239176 | BeFree | Expression analysis of the D129G mutation was performed in E. coli (expression as fusion protein MBP-PAH) and in a human hepatoma cell line with an N-terminal FLAG epitope. | 0.000814326 | 2007 | PAH | 12 | 102877517 | T | C,A |
| rs199475623 | 17408607 | 5053 | PAH | umls:C2239176 | BeFree | Expression analysis of the D129G mutation was performed in E. coli (expression as fusion protein MBP-PAH) and in a human hepatoma cell line with an N-terminal FLAG epitope. | 0.001900093 | 2007 | PAH | 12 | 102877517 | T | C,A |
| rs199475623 | 17408607 | 4155 | MBP | umls:C2239176 | BeFree | Expression analysis of the D129G mutation was performed in E. coli (expression as fusion protein MBP-PAH) and in a human hepatoma cell line with an N-terminal FLAG epitope. | 0.000814326 | 2007 | PAH | 12 | 102877517 | T | C,A |
| rs199475623 | 17408607 | 4153 | MBL2 | umls:C2239176 | BeFree | Expression analysis of the D129G mutation was performed in E. coli (expression as fusion protein MBP-PAH) and in a human hepatoma cell line with an N-terminal FLAG epitope. | 0.009629949 | 2007 | PAH | 12 | 102877517 | T | C,A |
| rs1998056 | 25198130 | 866 | SERPINA6 | umls:C2239176 | BeFree | Integrative genomic analysis identifies that SERPINA6-rs1998056 regulated by FOXA/ERα is associated with female hepatocellular carcinoma. | 0.000542884 | 2014 | SERPINA6 | 14 | 94323158 | C | G |
| rs20417 | 25400773 | 5743 | PTGS2 | umls:C2239176 | BeFree | Associations between Cox-2 rs20417 and rs5275 polymorphisms and the risk of hepatocellular carcinoma: a meta analysis. | 0.228193736 | 2014 | PTGS2;PACERR | 1 | 186681189 | C | G |
| rs20575 | 22401174 | 8797 | TNFRSF10A | umls:C2239176 | BeFree | To determine if gene variants in the TRAIL receptor I (DR4) gene affect the risk of hepatitis C virus (HCV)-induced liver cancer (HCC), we analysed DR4 mutations C626G (rs20575) and A683C (rs20576) in HCV-infected patients with and without HCC. | 0.001900093 | 2012 | TNFRSF10A | 8 | 23201811 | C | G |
| rs20576 | 22401174 | 8797 | TNFRSF10A | umls:C2239176 | BeFree | To determine if gene variants in the TRAIL receptor I (DR4) gene affect the risk of hepatitis C virus (HCV)-induced liver cancer (HCC), we analysed DR4 mutations C626G (rs20575) and A683C (rs20576) in HCV-infected patients with and without HCC. | 0.001900093 | 2012 | TNFRSF10A | 8 | 23200707 | T | G |
| rs2073498 | 22394463 | 11186 | RASSF1 | umls:C2239176 | BeFree | RASSF1A Ala133Ser polymorphism is associated with increased susceptibility to hepatocellular carcinoma in a Turkish population. | 0.017130633 | 2012 | RASSF1 | 3 | 50332115 | C | A |
| rs2073658 | 22460558 | 3170 | FOXA2 | umls:C2239176 | BeFree | Functional studies in human hepatocellular carcinoma cells showed that rs2073658 is located in a forkhead box A2 (FOXA2) binding site and that major allele constructs displayed higher transcriptional activity than minor allele constructs. | 0.007077352 | 2012 | USF1;TSTD1 | 1 | 161040972 | C | T |
| rs2228001 | 25337275 | 7517 | XRCC3 | umls:C2239176 | BeFree | In this study, we investigated whether six polymorphisms (including rs25487, rs861539, rs7003908, rs28383151, rs13181, and rs2228001) in DNA repair genes (XPC, XRCC4, XRCC1, XRCC4, XPD, XRCC7, and XRCC3) interacted with AFB1, and the gene-environmental interactive role in the risk of HCC using hospital-based case-control study (including 1486 HCC cases and 1996 controls). | 0.007534359 | 2014 | XPC | 3 | 14145949 | G | T |
| rs2242241 | 16109524 | 842 | CASP9 | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.003267234 | 2005 | DOK2 | 8 | 21909370 | A | C |
| rs2242241 | 16109524 | 4595 | MUTYH | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.000542884 | 2005 | DOK2 | 8 | 21909370 | A | C |
| rs2244546 | 23665287 | 100507436 | MICA | umls:C2239176 | BeFree | Detailed fine-mapping analyses revealed a new SNP in HCP5 (rs2244546) upstream of MICA as strong predictor of HCV-related HCC in the SCCS (univariable p=0.027; multivariable p=0.0002, odds ratio=3.96, 95% confidence interval=1.90-8.27). | 0.243800186 | 2013 | NA | 6 | 31468056 | C | G |
| rs2267437 | 25569644 | 2547 | XRCC6 | umls:C2239176 | BeFree | Sensitivity analyses were also performed.The rs2267437 polymorphism was associated with a significant increase in risks of overall cancers, breast cancer, renal cell carcinoma and hepatocellular carcinoma, and it could increase the cancer risk in Asian population; the rs5751129 polymorphism could increase the cancer risk in overall cancers; the rs132770 polymorphism was associated with the increased renal cell carcinoma risk; furthermore, the rs132793 polymorphism could decrease breast cancer risk and increase risks in other cancers.Overall, the results provided evidences that the single nucleotide polymorphisms in XRCC6 promoter region might play different roles in various cancers, indicating different cancers have different tumorigenesis mechanisms. | 0.000814326 | 2015 | XRCC6;DESI1 | 22 | 41620695 | C | G |
| rs2275913 | 25429834 | 112744 | IL17F | umls:C2239176 | BeFree | Our results suggest that IL-17A rs4711998, IL-17A rs2275913, and IL-17F rs763780 polymorphisms do not contribute to HBV-related HCC susceptibility independently. | 0.000542884 | 2014 | IL17A | 6 | 52186235 | G | A |
| rs2279744 | 21240526 | 3077 | HFE | umls:C2239176 | BeFree | Two SNPs (rs1800562 of HFE and rs2279744 of MDM2) were associated with HCC with moderate epidemiological evidence and deserve further study and additional biological and clinical assessment. | 0.04409193 | 2011 | MDM2 | 12 | 68808800 | T | G |
| rs2279744 | 24061636 | 4193 | MDM2 | umls:C2239176 | BeFree | Thus, the findings from the meta-analysis support that MDM2 rs2279744 polymorphism is significantly associated with increased risk of hepatocellular carcinoma in East Asians. | 0.021507378 | 2013 | MDM2 | 12 | 68808800 | T | G |
| rs2279744 | 21240526 | 3553 | IL1B | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.029608365 | 2011 | MDM2 | 12 | 68808800 | T | G |
| rs2279744 | 21240526 | 6648 | SOD2 | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.128729747 | 2011 | MDM2 | 12 | 68808800 | T | G |
| rs2279744 | 21240526 | 54577 | UGT1A7 | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.01717424 | 2011 | MDM2 | 12 | 68808800 | T | G |
| rs2279744 | 21240526 | 4193 | MDM2 | umls:C2239176 | BeFree | Two SNPs (rs1800562 of HFE and rs2279744 of MDM2) were associated with HCC with moderate epidemiological evidence and deserve further study and additional biological and clinical assessment. | 0.021507378 | 2011 | MDM2 | 12 | 68808800 | T | G |
| rs2280235 | 20798561 | 6817 | SULT1A1 | umls:C2239176 | BeFree | Minor allele homozygous genotypes at rs867637 (9,046 bp 3' of STP A>G), rs3771300 (IVS24-153T>G), and rs2280235 (IVS20-103G>A), compared with their homozygote genotypes of common alleles, were associated with 1.6- (95% CI 1.1-2.3), 1.6- (95% CI 1.1-2.4), and 1.4-fold (95% CI 0.95-1.9) increased risk of HCC, respectively. | 0.000814326 | 2010 | STAT1 | 2 | 190979104 | A | G |
| rs2282679 | 23734184 | 1717 | DHCR7 | umls:C2239176 | BeFree | The well-known associations between CYP2R1 (rs1993116, rs10741657), GC (rs2282679), and DHCR7 (rs7944926, rs12785878) genotypes and 25(OH)D3 serum levels were also apparent in patients with chronic hepatitis C. The same genotypes of these single nucleotide polymorphisms (SNPs) that are associated with reduced 25(OH)D3 serum levels were found to be associated with HCV-related HCC (P = 0.07 [OR = 1.13, 95% CI = 0.99-1.28] for CYP2R1, P = 0.007 [OR = 1.56, 95% CI = 1.12-2.15] for GC, P = 0.003 [OR = 1.42, 95% CI = 1.13-1.78] for DHCR7; ORs for risk genotypes). | 0.000271442 | 2013 | GC | 4 | 71742666 | T | G |
| rs2282679 | 23734184 | 120227 | CYP2R1 | umls:C2239176 | BeFree | The well-known associations between CYP2R1 (rs1993116, rs10741657), GC (rs2282679), and DHCR7 (rs7944926, rs12785878) genotypes and 25(OH)D3 serum levels were also apparent in patients with chronic hepatitis C. The same genotypes of these single nucleotide polymorphisms (SNPs) that are associated with reduced 25(OH)D3 serum levels were found to be associated with HCV-related HCC (P = 0.07 [OR = 1.13, 95% CI = 0.99-1.28] for CYP2R1, P = 0.007 [OR = 1.56, 95% CI = 1.12-2.15] for GC, P = 0.003 [OR = 1.42, 95% CI = 1.13-1.78] for DHCR7; ORs for risk genotypes). | 0.000271442 | 2013 | GC | 4 | 71742666 | T | G |
| rs228669 | 25344870 | 1407 | CRY1 | umls:C2239176 | BeFree | Four individual SNPs, including rs3027178 in PER1, rs228669 and rs2640908 in PER3 and rs3809236 in CRY1, were significantly associated with overall survival (OS) of HCC patients, and three SNPs, including rs3027178 in PER1, rs228729 in PER3 and rs3809236 in CRY1, were significantly associated with recurrence-free survival (RFS). | 0.000271442 | 2014 | PER3 | 1 | 7809988 | T | C |
| rs228729 | 25344870 | 1407 | CRY1 | umls:C2239176 | BeFree | Four individual SNPs, including rs3027178 in PER1, rs228669 and rs2640908 in PER3 and rs3809236 in CRY1, were significantly associated with overall survival (OS) of HCC patients, and three SNPs, including rs3027178 in PER1, rs228729 in PER3 and rs3809236 in CRY1, were significantly associated with recurrence-free survival (RFS). | 0.000271442 | 2014 | PER3 | 1 | 7785635 | T | C |
| rs228729 | 25344870 | 8863 | PER3 | umls:C2239176 | BeFree | Survival tree analysis indicated that wild genotype of rs228729 in PER3 was the primary risk factor contributing to HCC patients' RFS. | 0.003810118 | 2014 | PER3 | 1 | 7785635 | T | C |
| rs2287780 | 25318605 | 6470 | SHMT1 | umls:C2239176 | BeFree | Results showed that six SNPs (MTHFR rs1801133, MTRR rs2287780, MTRR rs10380, FTHFD rs1127717, GART rs8971, and SHMT rs1979277) were significantly associated with HCC risk in Chinese population, with P values range from 2.26 × 10(-4) to 0.035). | 0.000271442 | 2014 | MTRR | 5 | 7889191 | C | T |
| rs2287780 | 25318605 | 2618 | GART | umls:C2239176 | BeFree | Results showed that six SNPs (MTHFR rs1801133, MTRR rs2287780, MTRR rs10380, FTHFD rs1127717, GART rs8971, and SHMT rs1979277) were significantly associated with HCC risk in Chinese population, with P values range from 2.26 × 10(-4) to 0.035). | 0.000271442 | 2014 | MTRR | 5 | 7889191 | C | T |
| rs2292832 | 25190221 | 406941 | MIR149 | umls:C2239176 | BeFree | Association study of miR‑149 rs2292832 and miR‑608 rs4919510 and the risk of hepatocellular carcinoma in a large‑scale population. | 0.000814326 | 2014 | GPC1;MIR149;PP14571 | 2 | 240456086 | T | C |
| rs2292832 | 25190221 | 693193 | MIR608 | umls:C2239176 | BeFree | Association study of miR‑149 rs2292832 and miR‑608 rs4919510 and the risk of hepatocellular carcinoma in a large‑scale population. | 0.000271442 | 2014 | GPC1;MIR149;PP14571 | 2 | 240456086 | T | C |
| rs2302427 | 24040354 | 5130 | PCYT1A | umls:C2239176 | BeFree | The CCCA or CCTA haplotype among the four EZH2 sites (rs6950683, rs2302427, rs3757441, and rs41277434), respectively, was also associated with a reduced risk of HCC. | 0.001357209 | 2013 | EZH2 | 7 | 148828812 | C | G |
| rs2302427 | 24040354 | 10544 | PROCR | umls:C2239176 | BeFree | The CCCA or CCTA haplotype among the four EZH2 sites (rs6950683, rs2302427, rs3757441, and rs41277434), respectively, was also associated with a reduced risk of HCC. | 0.000271442 | 2013 | EZH2 | 7 | 148828812 | C | G |
| rs2308938 | 16109524 | 842 | CASP9 | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.003267234 | 2005 | CASP9 | 1 | 15518212 | G | C,A |
| rs2308938 | 16109524 | 4595 | MUTYH | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.000542884 | 2005 | CASP9 | 1 | 15518212 | G | C,A |
| rs2308941 | 16109524 | 4595 | MUTYH | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.000542884 | 2005 | CASP9 | 1 | 15518223 | G | A |
| rs2308941 | 16109524 | 842 | CASP9 | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.003267234 | 2005 | CASP9 | 1 | 15518223 | G | A |
| rs2430561 | 23803376 | 771 | CA12 | umls:C2239176 | BeFree | Combined analysis using the genotype of rs2430561 and the number of microsatellites revealed that the frequencies of AT-CA12 and TT-CA12 increased significantly in hepatocellular carcinoma subjects (p<0.0001). | 0.000542884 | 2014 | IFNG | 12 | 68158742 | T | A |
| rs2430561 | 24719951 | 771 | CA12 | umls:C2239176 | BeFree | Combined analysis using the genotype of rs2430561 and the number of microsatellites revealed that the frequencies of AT-CA12, and TT-CA12 increased significantly in hepatocellular carcinoma subjects (p < 0.0001). | 0.000542884 | 2014 | IFNG | 12 | 68158742 | T | A |
| rs2516839 | 25480412 | 7391 | USF1 | umls:C2239176 | BeFree | Significant association between upstream transcription factor 1 rs2516839 polymorphism and hepatocellular carcinoma risk: a case-control study. | 0.001085767 | 2014 | USF1 | 1 | 161043331 | C | T |
| rs25487 | 21645210 | 7515 | XRCC1 | umls:C2239176 | BeFree | XRCC1 genetic polymorphism Arg399Gln and hepatocellular carcinoma risk: a meta-analysis. | 0.018154268 | 2011 | XRCC1 | 19 | 43551574 | T | C |
| rs25487 | 23780894 | 7515 | XRCC1 | umls:C2239176 | BeFree | Our meta-analysis of the available data did not find an obvious effect of XRCC1 Arg399Gln polymorphism on hepatitis-related hepatocellular carcinoma. | 0.018154268 | 2013 | XRCC1 | 19 | 43551574 | T | C |
| rs25487 | 23098440 | 7515 | XRCC1 | umls:C2239176 | BeFree | XRCC1 Arg399Gln gene polymorphism and hepatocellular carcinoma risk in the Chinese Han population: a meta-analysis. | 0.018154268 | 2012 | XRCC1 | 19 | 43551574 | T | C |
| rs25487 | 24289575 | 7515 | XRCC1 | umls:C2239176 | BeFree | The XRCC1 Arg399Gln genetic polymorphism contributes to hepatocellular carcinoma susceptibility: an updated meta-analysis. | 0.018154268 | 2015 | XRCC1 | 19 | 43551574 | T | C |
| rs25487 | 25337275 | 7517 | XRCC3 | umls:C2239176 | BeFree | In this study, we investigated whether six polymorphisms (including rs25487, rs861539, rs7003908, rs28383151, rs13181, and rs2228001) in DNA repair genes (XPC, XRCC4, XRCC1, XRCC4, XPD, XRCC7, and XRCC3) interacted with AFB1, and the gene-environmental interactive role in the risk of HCC using hospital-based case-control study (including 1486 HCC cases and 1996 controls). | 0.007534359 | 2014 | XRCC1 | 19 | 43551574 | T | C |
| rs25487 | 24969866 | 7515 | XRCC1 | umls:C2239176 | BeFree | This updated meta-analysis results suggest that XRCC1 Arg399Gln variants may contribute to HCC risk. | 0.018154268 | 2015 | XRCC1 | 19 | 43551574 | T | C |
| rs25487 | 24390232 | 7515 | XRCC1 | umls:C2239176 | BeFree | XRCC1 Arg399Gln genetic polymorphism and the risk of hepatocellular carcinoma: a meta-analysis. | 0.018154268 | 2013 | XRCC1 | 19 | 43551574 | T | C |
| rs25487 | 24815482 | 7515 | XRCC1 | umls:C2239176 | BeFree | An updated meta-analysis between the association of XRCC1 Arg399Gln polymorphism and hepatocellular carcinoma risk. | 0.018154268 | 2015 | XRCC1 | 19 | 43551574 | T | C |
| rs25489 | 23679314 | 7515 | XRCC1 | umls:C2239176 | BeFree | The XRCC1 Arg280His gene polymorphism and hepatocellular carcinoma risk: a meta-analysis. | 0.018154268 | 2014 | XRCC1 | 19 | 43552260 | C | T,G |
| rs25489 | 22919255 | 7515 | XRCC1 | umls:C2239176 | BeFree | More rigorous association studies are needed to verify the involvement of XRCC1 Arg280His polymorphism in HCC susceptibility. | 0.018154268 | 2012 | XRCC1 | 19 | 43552260 | C | T,G |
| rs2596542 | 21499248 | 100507436 | MICA | umls:C2239176 | GWASCAT | We also found that the risk allele of rs2596542 was associated with lower soluble MICA protein levels in individuals with HCV-induced HCC (P = 1.38 × 10(-13)). | 0.243800186 | 2011 | MICA;LOC101929072 | 6 | 31398818 | C | T |
| rs2596542 | 21499248 | 101929072 | LOC101929072 | umls:C2239176 | GWASCAT | Genome-wide association study identifies a susceptibility locus for HCV-induced hepatocellular carcinoma. | 0.12 | 2011 | MICA;LOC101929072 | 6 | 31398818 | C | T |
| rs2640908 | 25344870 | 1407 | CRY1 | umls:C2239176 | BeFree | Four individual SNPs, including rs3027178 in PER1, rs228669 and rs2640908 in PER3 and rs3809236 in CRY1, were significantly associated with overall survival (OS) of HCC patients, and three SNPs, including rs3027178 in PER1, rs228729 in PER3 and rs3809236 in CRY1, were significantly associated with recurrence-free survival (RFS). | 0.000271442 | 2014 | PER3 | 1 | 7829881 | C | T |
| rs2736098 | 25339005 | 174 | AFP | umls:C2239176 | BeFree | The TERT rs2736098 T allele was also significantly associated with the level of the HCC clinical indicator alpha-fetoprotein (P=0.026). | 0.240865254 | 2015 | TERT | 5 | 1293971 | C | T |
| rs2736098 | 23392802 | 7015 | TERT | umls:C2239176 | BeFree | This study attempts to clarify the genetic predisposition to hepatocellular carcinoma (HCC), focusing on the hTERT gene rs2736098 polymorphism. | 0.156724105 | 2013 | TERT | 5 | 1293971 | C | T |
| rs2834167 | 25032264 | 9681 | DEPDC5 | umls:C2239176 | BeFree | Rs423058 upstream of PAPL, rs2834167 in IL10RB and rs1012068 in DEPDC5 were associated with chronic HBV status, HBV natural clearance and the presence of HCC (P = 0.0004–0.024), respectively. | 0.121085767 | 2015 | IL10RB | 21 | 33268483 | A | G |
| rs2834167 | 25032264 | 390928 | PAPL | umls:C2239176 | BeFree | Rs423058 upstream of PAPL, rs2834167 in IL10RB and rs1012068 in DEPDC5 were associated with chronic HBV status, HBV natural clearance and the presence of HCC (P = 0.0004–0.024), respectively. | 0.000271442 | 2015 | IL10RB | 21 | 33268483 | A | G |
| rs2834167 | 25032264 | 3588 | IL10RB | umls:C2239176 | BeFree | Rs423058 upstream of PAPL, rs2834167 in IL10RB and rs1012068 in DEPDC5 were associated with chronic HBV status, HBV natural clearance and the presence of HCC (P = 0.0004–0.024), respectively. | 0.000271442 | 2015 | IL10RB | 21 | 33268483 | A | G |
| rs28383151 | 23390017 | 7518 | XRCC4 | umls:C2239176 | BeFree | Genetic polymorphisms in the coding region of XRCC4 may be risk and prognostic biomarkers of AFB1-related HCC, and rs28383151 is such a potential candidate. | 0.000814326 | 2013 | XRCC4 | 5 | 83111054 | G | A |
| rs28383151 | 25337275 | 7517 | XRCC3 | umls:C2239176 | BeFree | In this study, we investigated whether six polymorphisms (including rs25487, rs861539, rs7003908, rs28383151, rs13181, and rs2228001) in DNA repair genes (XPC, XRCC4, XRCC1, XRCC4, XPD, XRCC7, and XRCC3) interacted with AFB1, and the gene-environmental interactive role in the risk of HCC using hospital-based case-control study (including 1486 HCC cases and 1996 controls). | 0.007534359 | 2014 | XRCC4 | 5 | 83111054 | G | A |
| rs28934571 | 19376640 | 7157 | TP53 | umls:C2239176 | BeFree | Next, we discuss the significance of R249S as a biomarker to study the natural history of HCC and as a target for therapeutic approaches aimed at restoring wild-type p53 activity. | 0.511429968 | 2009 | TP53 | 17 | 7674216 | C | A |
| rs28934571 | 19366907 | 7157 | TP53 | umls:C2239176 | BeFree | TP53 R249S mutations, exposure to aflatoxin, and occurrence of hepatocellular carcinoma in a cohort of chronic hepatitis B virus carriers from Qidong, China. | 0.511429968 | 2009 | TP53 | 17 | 7674216 | C | A |
| rs28934571 | 23200676 | 7157 | TP53 | umls:C2239176 | BeFree | Association between HBX status, aflatoxin-induced R249S TP53 mutation and risk of hepatocellular carcinoma in a case-control study from Thailand. | 0.511429968 | 2013 | TP53 | 17 | 7674216 | C | A |
| rs28934571 | 20538734 | 7157 | TP53 | umls:C2239176 | BeFree | Effects of the TP53 p.R249S mutant on proliferation and clonogenic properties in human hepatocellular carcinoma cell lines: interaction with hepatitis B virus X protein. | 0.511429968 | 2010 | TP53 | 17 | 7674216 | C | A |
| rs28934571 | 21768053 | 7157 | TP53 | umls:C2239176 | BeFree | HCC often harbors a TP53 (tumor protein p53) mutation at codon 249 (R249S). | 0.511429968 | 2011 | TP53 | 17 | 7674216 | C | A |
| rs28934571 | 20538734 | 183 | AGT | umls:C2239176 | BeFree | Although its metabolites bind at several positions in TP53, a mutation at codon 249 (AGG to AGT, arginine to serine, p.R249S) accounts for 90% of TP53 mutations in AFB(1)-related HCC. | 0.004071628 | 2010 | TP53 | 17 | 7674216 | C | A |
| rs28934571 | 22759751 | 7157 | TP53 | umls:C2239176 | BeFree | TP53 R249S mutation, genetic variations in HBX and risk of hepatocellular carcinoma in The Gambia. | 0.511429968 | 2012 | TP53 | 17 | 7674216 | C | A |
| rs28934571 | NA | 7157 | TP53 | umls:C2239176 | CLINVAR | NA | 0.511429968 | NA | TP53 | 17 | 7674216 | C | A |
| rs28934571 | 20538734 | 189 | AGXT | umls:C2239176 | BeFree | Although its metabolites bind at several positions in TP53, a mutation at codon 249 (AGG to AGT, arginine to serine, p.R249S) accounts for 90% of TP53 mutations in AFB(1)-related HCC. | 0.002442977 | 2010 | TP53 | 17 | 7674216 | C | A |
| rs28934571 | 22675488 | 7157 | TP53 | umls:C2239176 | BeFree | Aflatoxin-induced TP53 R249S mutation in hepatocellular carcinoma in Thailand: association with tumors developing in the absence of liver cirrhosis. | 0.511429968 | 2012 | TP53 | 17 | 7674216 | C | A |
| rs28934571 | 23836507 | 7157 | TP53 | umls:C2239176 | BeFree | Association between TP53 R249S mutation and polymorphisms in TP53 intron 1 in hepatocellular carcinoma. | 0.511429968 | 2013 | TP53 | 17 | 7674216 | C | A |
| rs28934571 | 23886144 | 7157 | TP53 | umls:C2239176 | BeFree | Hepatitis B virus genetic variation and TP53 R249S mutation in patients with hepatocellular carcinoma in Thailand. | 0.511429968 | 2014 | TP53 | 17 | 7674216 | C | A |
| rs2910164 | 21807077 | 406938 | MIR146A | umls:C2239176 | BeFree | No association of pre-microRNA-146a rs2910164 polymorphism and risk of hepatocellular carcinoma development in Turkish population: a case-control study. | 0.01052022 | 2011 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 22768213 | 406938 | MIR146A | umls:C2239176 | BeFree | It has been suggested that two common SNPs rs2910164 in miR-146a and rs11614913 in miR-196a2 are associated with susceptibility to hepatocellular carcinoma (HCC). | 0.01052022 | 2012 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 23437296 | 406938 | MIR146A | umls:C2239176 | BeFree | This meta-analysis suggests that miR-146a rs2910164 and miR-499 rs3746444 polymorphisms may not be associated with the risk of HCC, especially for Asian population. | 0.01052022 | 2013 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 23437296 | 574501 | MIR499A | umls:C2239176 | BeFree | This meta-analysis suggests that miR-146a rs2910164 and miR-499 rs3746444 polymorphisms may not be associated with the risk of HCC, especially for Asian population. | 0.003257302 | 2013 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 25108400 | 406938 | MIR146A | umls:C2239176 | BeFree | We conclude that rs2910164 in miR-146a may confer susceptibility to HCC, especially in the Chinese population. | 0.01052022 | 2014 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 22893469 | 406938 | MIR146A | umls:C2239176 | BeFree | A common G/C polymorphism (rs2910164) in the precursor (pre-) miR-146a gene engaged in NF-κB signaling and apoptosis pathways has been reported to modulate the genetic risk of hepatocellular carcinoma by increased G-allelic production of mature miR-146a. | 0.01052022 | 2012 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs3027178 | 25344870 | 1407 | CRY1 | umls:C2239176 | BeFree | Four individual SNPs, including rs3027178 in PER1, rs228669 and rs2640908 in PER3 and rs3809236 in CRY1, were significantly associated with overall survival (OS) of HCC patients, and three SNPs, including rs3027178 in PER1, rs228729 in PER3 and rs3809236 in CRY1, were significantly associated with recurrence-free survival (RFS). | 0.000271442 | 2014 | PER1 | 17 | 8149767 | T | G |
| rs3077 | 25365208 | 3115 | HLA-DPB1 | umls:C2239176 | BeFree | HLA-DP/DQ polymorphisms (rs3077, rs9277535, rs7453920) did not associate with HCC development, but did correlate with HBV susceptibility and HBV natural clearance. | 0.003995683 | 2014 | HLA-DPA1 | 6 | 33065245 | A | G |
| rs3218170 | 16109524 | 842 | CASP9 | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.003267234 | 2005 | NA | NA | NA | NA | NA |
| rs3218170 | 16109524 | 4595 | MUTYH | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.000542884 | 2005 | NA | NA | NA | NA | NA |
| rs361525 | 20953524 | 7124 | TNF | umls:C2239176 | GAD | [Tumor necrosis factor rs361525 (-238G>A) polymorphism contributes to hepatocellular carcinoma susceptibility.] | 0.058001479 | 2010 | TNF | 6 | 31575324 | G | A |
| rs361525 | 20953524 | 7124 | TNF | umls:C2239176 | BeFree | Tumor necrosis factor rs361525 (-238G>A) polymorphism contributes to hepatocellular carcinoma susceptibility. | 0.058001479 | 2010 | TNF | 6 | 31575324 | G | A |
| rs374585139 | 20699378 | 5708 | PSMD2 | umls:C2239176 | BeFree | The pre-S deletion and 12 point mutations, namely, the pre-S2 start codon mutation, T53C in the pre-S2 gene, T766A in the S gene, G1613A, C1653T, A1762T, G1764A in the X gene, and G1899A, C2002T, A2159G, A2189C, and G2203W (A or T) in the pre-C/C gene, showed close associations with HCC. | 0.000542884 | 2010 | PSMD2 | 3 | 184307365 | T | C |
| rs374585139 | 20699378 | 3577 | CXCR1 | umls:C2239176 | BeFree | The pre-S deletion and 12 point mutations, namely, the pre-S2 start codon mutation, T53C in the pre-S2 gene, T766A in the S gene, G1613A, C1653T, A1762T, G1764A in the X gene, and G1899A, C2002T, A2159G, A2189C, and G2203W (A or T) in the pre-C/C gene, showed close associations with HCC. | 0.000542884 | 2010 | PSMD2 | 3 | 184307365 | T | C |
| rs3746444 | 25108400 | 574501 | MIR499A | umls:C2239176 | BeFree | No significant association was found between miR-499 rs3746444 and HCC, but subgroup study showed that subjects with CC genotype are more vulnerable to HCC than TT genotype in the Chinese population. | 0.003257302 | 2014 | MYH7B;MIR499A;MIR499B | 20 | 34990448 | A | G |
| rs3746444 | 23437296 | 574501 | MIR499A | umls:C2239176 | BeFree | This meta-analysis suggests that miR-146a rs2910164 and miR-499 rs3746444 polymorphisms may not be associated with the risk of HCC, especially for Asian population. | 0.003257302 | 2013 | MYH7B;MIR499A;MIR499B | 20 | 34990448 | A | G |
| rs3746444 | 23679271 | 790 | CAD | umls:C2239176 | BeFree | In conclusion, the MiR-499A>G rs3746444 polymorphism is associated with HCC risk in the Chinese population, and may be useful predictive marker for CAD susceptibility. | 0.080814326 | 2014 | MYH7B;MIR499A;MIR499B | 20 | 34990448 | A | G |
| rs3746444 | 23437296 | 406938 | MIR146A | umls:C2239176 | BeFree | This meta-analysis suggests that miR-146a rs2910164 and miR-499 rs3746444 polymorphisms may not be associated with the risk of HCC, especially for Asian population. | 0.01052022 | 2013 | MYH7B;MIR499A;MIR499B | 20 | 34990448 | A | G |
| rs3757441 | 24040354 | 10544 | PROCR | umls:C2239176 | BeFree | The CCCA or CCTA haplotype among the four EZH2 sites (rs6950683, rs2302427, rs3757441, and rs41277434), respectively, was also associated with a reduced risk of HCC. | 0.000271442 | 2013 | EZH2 | 7 | 148827660 | C | T |
| rs3757441 | 24040354 | 5130 | PCYT1A | umls:C2239176 | BeFree | The CCCA or CCTA haplotype among the four EZH2 sites (rs6950683, rs2302427, rs3757441, and rs41277434), respectively, was also associated with a reduced risk of HCC. | 0.001357209 | 2013 | EZH2 | 7 | 148827660 | C | T |
| rs3771300 | 20798561 | 6817 | SULT1A1 | umls:C2239176 | BeFree | Minor allele homozygous genotypes at rs867637 (9,046 bp 3' of STP A>G), rs3771300 (IVS24-153T>G), and rs2280235 (IVS20-103G>A), compared with their homozygote genotypes of common alleles, were associated with 1.6- (95% CI 1.1-2.3), 1.6- (95% CI 1.1-2.4), and 1.4-fold (95% CI 0.95-1.9) increased risk of HCC, respectively. | 0.000814326 | 2010 | STAT1 | 2 | 190970870 | T | G |
| rs3775290 | 26024592 | 7098 | TLR3 | umls:C2239176 | BeFree | The results indicated that genetic variant in TLR3 gene rs3775290 polymorphisms may be a protective factor for CHB, HBV-related LC, and HCC in the Chinese population. | 0.004895885 | 2015 | TLR3 | 4 | 186083063 | C | T,A |
| rs3783553 | 19917630 | 3552 | IL1A | umls:C2239176 | BeFree | These findings suggest that functional polymorphism rs3783553 in IL1A could contribute to HCC susceptibility. | 0.007524428 | 2009 | IL1A | 2 | 112774138 | - | TGAA |
| rs3794186 | 22972156 | 174 | AFP | umls:C2239176 | BeFree | Association of CHKA polymorphism (rs3794186) with α-fetoprotein levels in hepatocellular carcinoma. | 0.240865254 | 2012 | CHKA | 11 | 68053569 | G | A |
| rs3803012 | 23868705 | 5901 | RAN | umls:C2239176 | BeFree | These findings indicated that DICER1 rs1057035, RAN rs3803012, and PIWIL1 rs10773771 might contribute to the risk of HBV-related HCC. | 0.000271442 | 2013 | RAN | 12 | 130876170 | A | C,G |
| rs3803012 | 23868705 | 23405 | DICER1 | umls:C2239176 | BeFree | We observed that DICER1 rs1057035 CT/CC variant genotypes were associated with a significant decreased risk of HCC (adjusted OR = 0.79, 95% CI = 0.64-0.96) compared with wild-type TT and RAN rs3803012 AG/GG variant genotypes increased the risk of HBV persistent infection compared with AA genotype (adjusted OR = 1.35, 95% CI = 1.03-1.77). | 0.000814326 | 2013 | RAN | 12 | 130876170 | A | C,G |
| rs3803012 | 23868705 | 9271 | PIWIL1 | umls:C2239176 | BeFree | These findings indicated that DICER1 rs1057035, RAN rs3803012, and PIWIL1 rs10773771 might contribute to the risk of HBV-related HCC. | 0.000542884 | 2013 | RAN | 12 | 130876170 | A | C,G |
| rs3809236 | 25344870 | 1407 | CRY1 | umls:C2239176 | BeFree | Four individual SNPs, including rs3027178 in PER1, rs228669 and rs2640908 in PER3 and rs3809236 in CRY1, were significantly associated with overall survival (OS) of HCC patients, and three SNPs, including rs3027178 in PER1, rs228729 in PER3 and rs3809236 in CRY1, were significantly associated with recurrence-free survival (RFS). | 0.000271442 | 2014 | CRY1 | 12 | 107093269 | G | A |
| rs3811647 | 23588470 | 7018 | TF | umls:C2239176 | BeFree | Intronic SNP rs3811647 of the human transferrin gene modulates its expression in hepatoma cells. | 0.000542884 | 2012 | TF | 3 | 133765185 | G | A |
| rs386493716 | 24969866 | 7515 | XRCC1 | umls:C2239176 | BeFree | This updated meta-analysis results suggest that XRCC1 Arg399Gln variants may contribute to HCC risk. | 0.018154268 | 2015 | NA | NA | NA | NA | NA |
| rs386493716 | 23780894 | 7515 | XRCC1 | umls:C2239176 | BeFree | Our meta-analysis of the available data did not find an obvious effect of XRCC1 Arg399Gln polymorphism on hepatitis-related hepatocellular carcinoma. | 0.018154268 | 2013 | NA | NA | NA | NA | NA |
| rs386493716 | 24390232 | 7515 | XRCC1 | umls:C2239176 | BeFree | XRCC1 Arg399Gln genetic polymorphism and the risk of hepatocellular carcinoma: a meta-analysis. | 0.018154268 | 2013 | NA | NA | NA | NA | NA |
| rs386493716 | 24815482 | 7515 | XRCC1 | umls:C2239176 | BeFree | An updated meta-analysis between the association of XRCC1 Arg399Gln polymorphism and hepatocellular carcinoma risk. | 0.018154268 | 2015 | NA | NA | NA | NA | NA |
| rs386493716 | 23098440 | 7515 | XRCC1 | umls:C2239176 | BeFree | XRCC1 Arg399Gln gene polymorphism and hepatocellular carcinoma risk in the Chinese Han population: a meta-analysis. | 0.018154268 | 2012 | NA | NA | NA | NA | NA |
| rs386493716 | 24289575 | 7515 | XRCC1 | umls:C2239176 | BeFree | The XRCC1 Arg399Gln genetic polymorphism contributes to hepatocellular carcinoma susceptibility: an updated meta-analysis. | 0.018154268 | 2015 | NA | NA | NA | NA | NA |
| rs386493716 | 21645210 | 7515 | XRCC1 | umls:C2239176 | BeFree | XRCC1 genetic polymorphism Arg399Gln and hepatocellular carcinoma risk: a meta-analysis. | 0.018154268 | 2011 | NA | NA | NA | NA | NA |
| rs386545044 | 23107771 | 11200 | CHEK2 | umls:C2239176 | BeFree | Our results demonstrate for the first time that CHK2 1100delC, IVS2+1G>A and I157T mutations have not been a genetic susceptibility factor for HCC in the Turkish population. | 0.000814326 | 2013 | NA | NA | NA | NA | NA |
| rs386555427 | 22401174 | 8797 | TNFRSF10A | umls:C2239176 | BeFree | To determine if gene variants in the TRAIL receptor I (DR4) gene affect the risk of hepatitis C virus (HCV)-induced liver cancer (HCC), we analysed DR4 mutations C626G (rs20575) and A683C (rs20576) in HCV-infected patients with and without HCC. | 0.001900093 | 2012 | NA | NA | NA | NA | NA |
| rs386596107 | 25894370 | 847 | CAT | umls:C2239176 | BeFree | No significant associations were observed between three other polymorphisms (MnSOD Ala16Val, CAT-262C/T, GPx Pro198Leu) and HCC susceptibility in both HBV carriers and non-HBV carriers. | 0.009424521 | 2015 | NA | NA | NA | NA | NA |
| rs386596107 | 19731237 | 847 | CAT | umls:C2239176 | BeFree | Our aim was to determine whether Ala16Val-superoxide dismutase 2 (SOD2), G-463A-MPO, or T-262C-CAT dimorphisms modulate the risks of hepatocellular carcinoma (HCC) and death in alcoholic cirrhosis. | 0.009424521 | 2009 | NA | NA | NA | NA | NA |
| rs386596107 | 25894370 | 6648 | SOD2 | umls:C2239176 | BeFree | No significant associations were observed between three other polymorphisms (MnSOD Ala16Val, CAT-262C/T, GPx Pro198Leu) and HCC susceptibility in both HBV carriers and non-HBV carriers. | 0.128729747 | 2015 | NA | NA | NA | NA | NA |
| rs391957 | 23416888 | 3309 | HSPA5 | umls:C2239176 | BeFree | The rs391957 variant cis-regulating oncogene GRP78 expression contributes to the risk of hepatocellular carcinoma. | 0.13052022 | 2013 | HSPA5;GAPVD1 | 9 | 125241745 | T | C |
| rs391957 | 23416888 | 2114 | ETS2 | umls:C2239176 | BeFree | These findings provided new insights into the pathogenesis of HCC and an unexpected effect of the interaction between rs391957 and Ets-2 on hepatocarcinogenesis, and especially supported the hypothesis that stress-related and evolutionarily conserved genetic variant(s) influencing transcriptional regulation could predict susceptibilities. | 0.001085767 | 2013 | HSPA5;GAPVD1 | 9 | 125241745 | T | C |
| rs397507444 | 17503006 | 4524 | MTHFR | umls:C2239176 | BeFree | Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms and the risk of primary hepatocellular carcinoma (HCC) in a Chinese population. | 0.029823725 | 2007 | MTHFR | 1 | 11794407 | T | G |
| rs397507444 | 24316043 | 4524 | MTHFR | umls:C2239176 | BeFree | Meta-analysis of MTHFR C677T and A1298C gene polymorphisms: association with the risk of hepatocellular carcinoma. | 0.029823725 | 2013 | MTHFR | 1 | 11794407 | T | G |
| rs397514032 | NA | 324 | APC | umls:C2239176 | CLINVAR | NA | 0.328067311 | NA | APC | 5 | 112828924 | A | - |
| rs4074 | 24260493 | 2919 | CXCL1 | umls:C2239176 | BeFree | Influence of the CXCL1 rs4074 A allele on alcohol induced cirrhosis and HCC in patients of European descent. | 0.000542884 | 2013 | CXCL1 | 4 | 73870427 | A | G |
| rs41277434 | 24040354 | 5130 | PCYT1A | umls:C2239176 | BeFree | The CCCA or CCTA haplotype among the four EZH2 sites (rs6950683, rs2302427, rs3757441, and rs41277434), respectively, was also associated with a reduced risk of HCC. | 0.001357209 | 2013 | EZH2;LOC105375558 | 7 | 148809304 | A | C,G |
| rs41277434 | 24040354 | 10544 | PROCR | umls:C2239176 | BeFree | The CCCA or CCTA haplotype among the four EZH2 sites (rs6950683, rs2302427, rs3757441, and rs41277434), respectively, was also associated with a reduced risk of HCC. | 0.000271442 | 2013 | EZH2;LOC105375558 | 7 | 148809304 | A | C,G |
| rs4147581 | 25892883 | 119391 | GSTO2 | umls:C2239176 | BeFree | Two SNPs (GSTO2: rs7085725 and GSTP1: rs4147581) were significantly associated with overall survival in HCC patients (P = 0.035 and 0.042, respectively). | 0.002909916 | 2014 | GSTP1 | 11 | 67584114 | C | G |
| rs4149963 | 22296401 | 9156 | EXO1 | umls:C2239176 | BeFree | No association of the exonuclease 1 T439M polymorphism and risk of hepatocellular carcinoma development in the Turkish population: a case-control study. | 0.000542884 | 2011 | EXO1 | 1 | 241872080 | C | T |
| rs41557518 | 22015712 | 3135 | HLA-G | umls:C2239176 | BeFree | Four SNPs (rs17875380, rs41557518, rs114465251, and rs115492845) were associated with altered susceptibility to HBV or HCC, and HLA-F*01:04, HLA-G*01:05N, and HLA-E*01:01 were associated with hepatitis B or hepatitis B complicated with HCC. | 0.001357209 | 2012 | HLA-G | 6 | 29828658 | C | - |
| rs430397 | 19533686 | 3309 | HSPA5 | umls:C2239176 | GAD | [Single nucleotide polymorphism of rs430397 in the fifth intron of GRP78 gene and clinical relevance of primary hepatocellular carcinoma in Han Chinese: risk and prognosis.] | 0.13052022 | 2009 | HSPA5 | 9 | 125238840 | C | T |
| rs430397 | 19533686 | 3309 | HSPA5 | umls:C2239176 | BeFree | Single nucleotide polymorphism of rs430397 in the fifth intron of GRP78 gene and clinical relevance of primary hepatocellular carcinoma in Han Chinese: risk and prognosis. | 0.13052022 | 2009 | HSPA5 | 9 | 125238840 | C | T |
| rs430397 | 21779363 | 3309 | HSPA5 | umls:C2239176 | BeFree | Our previous study indicated that a common variant (rs430397 G>A) in the intron 5 of glucose-regulated protein 78 (GRP78) gene was associated with risk and prognosis of primary hepatocellular carcinoma (HCC), including HBV- and cirrhosis-related HCC. | 0.13052022 | 2011 | HSPA5 | 9 | 125238840 | C | T |
| rs4444903 | 25504078 | 282617 | IFNL3 | umls:C2239176 | BeFree | Single nucleotide polymorphisms (SNPs) in the epidermal growth factor (EGF, rs4444903), patatin-like phospholipase domain-containing protein 3 (PNPLA3, rs738409) genes, and near the interleukin-28B (IL28B, rs12979860) gene are linked to treatment response, fibrosis, and hepatocellular carcinoma (HCC) in chronic hepatitis C. Whether these SNPs independently or in combination predict clinical deterioration in hepatitis C virus (HCV)-related cirrhosis is unknown. | 0.005971721 | 2014 | EGF | 4 | 109912954 | A | G |
| rs4444903 | 25504078 | 80339 | PNPLA3 | umls:C2239176 | BeFree | Single nucleotide polymorphisms (SNPs) in the epidermal growth factor (EGF, rs4444903), patatin-like phospholipase domain-containing protein 3 (PNPLA3, rs738409) genes, and near the interleukin-28B (IL28B, rs12979860) gene are linked to treatment response, fibrosis, and hepatocellular carcinoma (HCC) in chronic hepatitis C. Whether these SNPs independently or in combination predict clinical deterioration in hepatitis C virus (HCV)-related cirrhosis is unknown. | 0.005700279 | 2014 | EGF | 4 | 109912954 | A | G |
| rs4444903 | 23790025 | 1950 | EGF | umls:C2239176 | BeFree | Additionally, the haplotype T-G constructed by rs11569017 and rs4444903 of the EGF gene might increase the risk of HBV-related HCC (p=0.002, OR=1.44, 95% CI=1.15-1.82). | 0.144297742 | 2014 | EGF | 4 | 109912954 | A | G |
| rs4444903 | 25504078 | 1950 | EGF | umls:C2239176 | BeFree | Single nucleotide polymorphisms (SNPs) in the epidermal growth factor (EGF, rs4444903), patatin-like phospholipase domain-containing protein 3 (PNPLA3, rs738409) genes, and near the interleukin-28B (IL28B, rs12979860) gene are linked to treatment response, fibrosis, and hepatocellular carcinoma (HCC) in chronic hepatitis C. Whether these SNPs independently or in combination predict clinical deterioration in hepatitis C virus (HCV)-related cirrhosis is unknown. | 0.144297742 | 2014 | EGF | 4 | 109912954 | A | G |
| rs455804 | 22807686 | 2897 | GRIK1 | umls:C2239176 | GWASCAT | GWAS identifies novel susceptibility loci on 6p21.32 and 21q21.3 for hepatocellular carcinoma in chronic hepatitis B virus carriers. | 0.12 | 2012 | GRIK1 | 21 | 29773850 | A | C |
| rs4678680 | 21105107 | 1233 | CCR4 | umls:C2239176 | GAD | [Genetic variations at loci involved in the immune response are risk factors for hepatocellular carcinoma.] | 0.002367032 | 2010 | NA | 3 | 32978543 | G | T |
| rs4711998 | 25429834 | 112744 | IL17F | umls:C2239176 | BeFree | Our results suggest that IL-17A rs4711998, IL-17A rs2275913, and IL-17F rs763780 polymorphisms do not contribute to HBV-related HCC susceptibility independently. | 0.000542884 | 2014 | IL17A | 6 | 52185555 | A | G |
| rs4880 | 21240526 | 54577 | UGT1A7 | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.01717424 | 2011 | SOD2 | 6 | 159692840 | A | G |
| rs4880 | 19731237 | 847 | CAT | umls:C2239176 | BeFree | Our aim was to determine whether Ala16Val-superoxide dismutase 2 (SOD2), G-463A-MPO, or T-262C-CAT dimorphisms modulate the risks of hepatocellular carcinoma (HCC) and death in alcoholic cirrhosis. | 0.009424521 | 2009 | SOD2 | 6 | 159692840 | A | G |
| rs4880 | 25894370 | 847 | CAT | umls:C2239176 | BeFree | No significant associations were observed between three other polymorphisms (MnSOD Ala16Val, CAT-262C/T, GPx Pro198Leu) and HCC susceptibility in both HBV carriers and non-HBV carriers. | 0.009424521 | 2015 | SOD2 | 6 | 159692840 | A | G |
| rs4880 | 25894370 | 6648 | SOD2 | umls:C2239176 | BeFree | No significant associations were observed between three other polymorphisms (MnSOD Ala16Val, CAT-262C/T, GPx Pro198Leu) and HCC susceptibility in both HBV carriers and non-HBV carriers. | 0.128729747 | 2015 | SOD2 | 6 | 159692840 | A | G |
| rs4880 | 21240526 | 6648 | SOD2 | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.128729747 | 2011 | SOD2 | 6 | 159692840 | A | G |
| rs4880 | 21240526 | 3553 | IL1B | umls:C2239176 | BeFree | Six SNPs of five genes (rs1800562 of HFE, rs17868323 and rs11692021 of UGT1A7, rs2279744 of MDM2, rs1143627 of IL-1B, and rs4880 of MnSOD) showed overall significant associations with HCC. | 0.029608365 | 2011 | SOD2 | 6 | 159692840 | A | G |
| rs4919510 | 25190221 | 406941 | MIR149 | umls:C2239176 | BeFree | Association study of miR‑149 rs2292832 and miR‑608 rs4919510 and the risk of hepatocellular carcinoma in a large‑scale population. | 0.000814326 | 2014 | SEMA4G;MIR608 | 10 | 100975021 | C | G |
| rs4919510 | 25190221 | 693193 | MIR608 | umls:C2239176 | BeFree | Association study of miR‑149 rs2292832 and miR‑608 rs4919510 and the risk of hepatocellular carcinoma in a large‑scale population. | 0.000271442 | 2014 | SEMA4G;MIR608 | 10 | 100975021 | C | G |
| rs5275 | 25400773 | 5743 | PTGS2 | umls:C2239176 | BeFree | Associations between Cox-2 rs20417 and rs5275 polymorphisms and the risk of hepatocellular carcinoma: a meta analysis. | 0.228193736 | 2014 | PTGS2 | 1 | 186673926 | A | G |
| rs568408 | 20521253 | 3592 | IL12A | umls:C2239176 | BeFree | Our findings indicate that IL12A rs568408 may contribute to the risk of HCC and modify HCC risk associated with HBV infection. | 0.002638474 | 2011 | IL12A;IL12A-AS1 | 3 | 159995680 | G | A |
| rs5751129 | 25569644 | 2547 | XRCC6 | umls:C2239176 | BeFree | Sensitivity analyses were also performed.The rs2267437 polymorphism was associated with a significant increase in risks of overall cancers, breast cancer, renal cell carcinoma and hepatocellular carcinoma, and it could increase the cancer risk in Asian population; the rs5751129 polymorphism could increase the cancer risk in overall cancers; the rs132770 polymorphism was associated with the increased renal cell carcinoma risk; furthermore, the rs132793 polymorphism could decrease breast cancer risk and increase risks in other cancers.Overall, the results provided evidences that the single nucleotide polymorphisms in XRCC6 promoter region might play different roles in various cancers, indicating different cancers have different tumorigenesis mechanisms. | 0.000814326 | 2015 | XRCC6;DESI1 | 22 | 41619761 | C | T |
| rs587776627 | NA | 8312 | AXIN1 | umls:C2239176 | CLINVAR | NA | 0.362985861 | NA | AXIN1 | 16 | 309973 | GGGAATGTGAGGTAGGGGCACCCGCCCATTGA | - |
| rs587776665 | NA | 841 | CASP8 | umls:C2239176 | CLINVAR | NA | 0.250334654 | NA | CASP8 | 2 | 201285241 | GT | - |
| rs587776802 | NA | 5290 | PIK3CA | umls:C2239176 | CLINVAR | NA | 0.376829396 | NA | PIK3CA | 3 | 179234360 | - | A |
| rs6147150 | 22294845 | 406885 | MIRLET7C | umls:C2239176 | BeFree | rs6147150 may be associated with HCC risk, in part through let-7c-mediated regulation, and may be involved in the pathogenesis of HCC in Chinese populations. | 0.001628651 | 2012 | ERBB4 | 2 | 211380367 | - | AAAATAGGATTG |
| rs61733703 | 16650523 | 57509 | MTUS1 | umls:C2239176 | UNIPROT | Mutation analysis of the 8p22 candidate tumor suppressor gene ATIP/MTUS1 in hepatocellular carcinoma. | 0.120271442 | 2006 | MTUS1 | 8 | 17755585 | G | A,T |
| rs62508577 | 19629656 | 5053 | PAH | umls:C2239176 | BeFree | We analyzed p.S231F PAH protein in prokaryotic (Escherichia coli) and eukaryotic expression system (hepatoma cells). | 0.001900093 | 2009 | PAH | 12 | 102855150 | G | A |
| rs6684439 | 24668548 | 3569 | IL6 | umls:C2239176 | BeFree | The present study supports the view that variants in the rs6684439 SNP of IL-6R is associated with a lower risk of HBV-related HCC, and this could provide valuable clues to understanding the mechanisms underlying susceptibility to this malignant disease. | 0.167012983 | 2014 | IL6R | 1 | 154423363 | C | T |
| rs6950683 | 24040354 | 5130 | PCYT1A | umls:C2239176 | BeFree | The CCCA or CCTA haplotype among the four EZH2 sites (rs6950683, rs2302427, rs3757441, and rs41277434), respectively, was also associated with a reduced risk of HCC. | 0.001357209 | 2013 | EZH2 | 7 | 148884496 | T | C |
| rs6950683 | 24040354 | 10544 | PROCR | umls:C2239176 | BeFree | The CCCA or CCTA haplotype among the four EZH2 sites (rs6950683, rs2302427, rs3757441, and rs41277434), respectively, was also associated with a reduced risk of HCC. | 0.000271442 | 2013 | EZH2 | 7 | 148884496 | T | C |
| rs7003908 | 25337275 | 7517 | XRCC3 | umls:C2239176 | BeFree | In this study, we investigated whether six polymorphisms (including rs25487, rs861539, rs7003908, rs28383151, rs13181, and rs2228001) in DNA repair genes (XPC, XRCC4, XRCC1, XRCC4, XPD, XRCC7, and XRCC3) interacted with AFB1, and the gene-environmental interactive role in the risk of HCC using hospital-based case-control study (including 1486 HCC cases and 1996 controls). | 0.007534359 | 2014 | PRKDC | 8 | 47858141 | C | A |
| rs7085725 | 25892883 | 119391 | GSTO2 | umls:C2239176 | BeFree | Two SNPs (GSTO2: rs7085725 and GSTP1: rs4147581) were significantly associated with overall survival in HCC patients (P = 0.035 and 0.042, respectively). | 0.002909916 | 2014 | GSTO2 | 10 | 104300451 | T | C |
| rs738409 | 24114809 | 80339 | PNPLA3 | umls:C2239176 | BeFree | Association between the PNPLA3 (rs738409 C>G) variant and hepatocellular carcinoma: Evidence from a meta-analysis of individual participant data. | 0.005700279 | 2013 | PNPLA3 | 22 | 43928847 | C | G |
| rs738409 | 25273282 | 80339 | PNPLA3 | umls:C2239176 | BeFree | In end-stage liver disease patients, we identified ALD to be predominantly affected by the PNPLA3 I148M variant resulting in an increased risk of HCC and reduced transplantation free survival. | 0.005700279 | 2014 | PNPLA3 | 22 | 43928847 | C | G |
| rs738409 | 22704398 | 80339 | PNPLA3 | umls:C2239176 | BeFree | PNPLA3 I148M (rs738409) genetic variant is associated with hepatocellular carcinoma in obese individuals. | 0.005700279 | 2012 | PNPLA3 | 22 | 43928847 | C | G |
| rs738409 | 23333103 | 80339 | PNPLA3 | umls:C2239176 | BeFree | PNPLA3 I148M variant and hepatocellular carcinoma: a common genetic variant for a rare disease. | 0.005700279 | 2012 | PNPLA3 | 22 | 43928847 | C | G |
| rs738409 | 25504078 | 282617 | IFNL3 | umls:C2239176 | BeFree | Single nucleotide polymorphisms (SNPs) in the epidermal growth factor (EGF, rs4444903), patatin-like phospholipase domain-containing protein 3 (PNPLA3, rs738409) genes, and near the interleukin-28B (IL28B, rs12979860) gene are linked to treatment response, fibrosis, and hepatocellular carcinoma (HCC) in chronic hepatitis C. Whether these SNPs independently or in combination predict clinical deterioration in hepatitis C virus (HCV)-related cirrhosis is unknown. | 0.005971721 | 2014 | PNPLA3 | 22 | 43928847 | C | G |
| rs738409 | 24607626 | 80339 | PNPLA3 | umls:C2239176 | BeFree | Carriage of the PNPLA3 rs738409 C >G polymorphism confers an increased risk of non-alcoholic fatty liver disease associated hepatocellular carcinoma. | 0.005700279 | 2014 | PNPLA3 | 22 | 43928847 | C | G |
| rs738409 | 25171251 | 80339 | PNPLA3 | umls:C2239176 | BeFree | The PNPLA3 I148M sequence variant favors hepatic lipid accumulation and confers susceptibility to hepatic fibrosis and hepatocellular carcinoma. | 0.005700279 | 2014 | PNPLA3 | 22 | 43928847 | C | G |
| rs738409 | 21745286 | 80339 | PNPLA3 | umls:C2239176 | BeFree | PNPLA3 rs738409C/G polymorphism in cirrhosis: relationship with the aetiology of liver disease and hepatocellular carcinoma occurrence. | 0.005700279 | 2011 | PNPLA3 | 22 | 43928847 | C | G |
| rs738409 | 25278690 | 80339 | PNPLA3 | umls:C2239176 | BeFree | In particular, the common I148M variant of the PNPLA3 gene influencing hepatic lipid metabolism influences HCC risk independently of its effect on the progression of liver fibrosis. | 0.005700279 | 2014 | PNPLA3 | 22 | 43928847 | C | G |
| rs738409 | 21319195 | 80339 | PNPLA3 | umls:C2239176 | BeFree | The rs738409 PNPLA3 genotype influences steatosis development in CHC and is independently associated with cirrhosis and other steatosis-related clinical outcomes, such as lack of response to antiviral treatment and possibly HCC. | 0.005700279 | 2011 | PNPLA3 | 22 | 43928847 | C | G |
| rs738409 | 25504078 | 80339 | PNPLA3 | umls:C2239176 | BeFree | Single nucleotide polymorphisms (SNPs) in the epidermal growth factor (EGF, rs4444903), patatin-like phospholipase domain-containing protein 3 (PNPLA3, rs738409) genes, and near the interleukin-28B (IL28B, rs12979860) gene are linked to treatment response, fibrosis, and hepatocellular carcinoma (HCC) in chronic hepatitis C. Whether these SNPs independently or in combination predict clinical deterioration in hepatitis C virus (HCV)-related cirrhosis is unknown. | 0.005700279 | 2014 | PNPLA3 | 22 | 43928847 | C | G |
| rs738409 | 25964223 | 80339 | PNPLA3 | umls:C2239176 | BeFree | PNPLA3 genetic polymorphism (rs738409 C>G) is associated with increased risk for the entire spectrum of ALD among drinkers including ALI, AC, and HCC. | 0.005700279 | 2015 | PNPLA3 | 22 | 43928847 | C | G |
| rs738409 | 25504078 | 1950 | EGF | umls:C2239176 | BeFree | Single nucleotide polymorphisms (SNPs) in the epidermal growth factor (EGF, rs4444903), patatin-like phospholipase domain-containing protein 3 (PNPLA3, rs738409) genes, and near the interleukin-28B (IL28B, rs12979860) gene are linked to treatment response, fibrosis, and hepatocellular carcinoma (HCC) in chronic hepatitis C. Whether these SNPs independently or in combination predict clinical deterioration in hepatitis C virus (HCV)-related cirrhosis is unknown. | 0.144297742 | 2014 | PNPLA3 | 22 | 43928847 | C | G |
| rs738409 | 24155878 | 80339 | PNPLA3 | umls:C2239176 | BeFree | PNPLA3 I148M polymorphism, clinical presentation, and survival in patients with hepatocellular carcinoma. | 0.005700279 | 2013 | PNPLA3 | 22 | 43928847 | C | G |
| rs7453920 | 25365208 | 3115 | HLA-DPB1 | umls:C2239176 | BeFree | HLA-DP/DQ polymorphisms (rs3077, rs9277535, rs7453920) did not associate with HCC development, but did correlate with HBV susceptibility and HBV natural clearance. | 0.003995683 | 2014 | HLA-DQB2 | 6 | 32762235 | A | G |
| rs7536540 | 22658643 | 406893 | MIR101-1 | umls:C2239176 | BeFree | We find that the rs7536540 polymorphism in miR-101-1 is significantly associated with development of liver cirrhosis and hepatocellular carcinoma occurrence. | 0.000271442 | 2012 | MIR101-1;MIR3671 | 1 | 65058899 | C | G |
| rs7574865 | 23242368 | 6775 | STAT4 | umls:C2239176 | GWASCAT | We also found significantly lower mRNA expression of STAT4 in HCC tumor tissues compared with paired adjacent nontumor tissues (P = 2.33 × 10(-14)). | 0.241900093 | 2013 | STAT4 | 2 | 191099907 | T | G |
| rs763780 | 25429834 | 112744 | IL17F | umls:C2239176 | BeFree | Our results suggest that IL-17A rs4711998, IL-17A rs2275913, and IL-17F rs763780 polymorphisms do not contribute to HBV-related HCC susceptibility independently. | 0.000542884 | 2014 | IL17F;LOC105375088 | 6 | 52236941 | T | C |
| rs7944926 | 23734184 | 1717 | DHCR7 | umls:C2239176 | BeFree | The well-known associations between CYP2R1 (rs1993116, rs10741657), GC (rs2282679), and DHCR7 (rs7944926, rs12785878) genotypes and 25(OH)D3 serum levels were also apparent in patients with chronic hepatitis C. The same genotypes of these single nucleotide polymorphisms (SNPs) that are associated with reduced 25(OH)D3 serum levels were found to be associated with HCV-related HCC (P = 0.07 [OR = 1.13, 95% CI = 0.99-1.28] for CYP2R1, P = 0.007 [OR = 1.56, 95% CI = 1.12-2.15] for GC, P = 0.003 [OR = 1.42, 95% CI = 1.13-1.78] for DHCR7; ORs for risk genotypes). | 0.000271442 | 2013 | NADSYN1 | 11 | 71454579 | A | G |
| rs7944926 | 23734184 | 120227 | CYP2R1 | umls:C2239176 | BeFree | The well-known associations between CYP2R1 (rs1993116, rs10741657), GC (rs2282679), and DHCR7 (rs7944926, rs12785878) genotypes and 25(OH)D3 serum levels were also apparent in patients with chronic hepatitis C. The same genotypes of these single nucleotide polymorphisms (SNPs) that are associated with reduced 25(OH)D3 serum levels were found to be associated with HCV-related HCC (P = 0.07 [OR = 1.13, 95% CI = 0.99-1.28] for CYP2R1, P = 0.007 [OR = 1.56, 95% CI = 1.12-2.15] for GC, P = 0.003 [OR = 1.42, 95% CI = 1.13-1.78] for DHCR7; ORs for risk genotypes). | 0.000271442 | 2013 | NADSYN1 | 11 | 71454579 | A | G |
| rs80356482 | 12373566 | 2538 | G6PC | umls:C2239176 | BeFree | Some genotype-phenotype correlations exist, for example, homozygosity for one G6PC mutation, G188R, seems to be associated with a glycogen storage disease type I non-a phenotype and homozygosity for the 727G>T mutation may be associated with a milder phenotype but an increased risk for hepatocellular carcinoma. | 0.005981653 | 2002 | G6PC | 17 | 42909418 | G | A,C |
| rs8099917 | 24026885 | 282617 | IFNL3 | umls:C2239176 | BeFree | The results showed that the IL28B rs8099917 AA genotype (AA vs AC + CC: odds ratio (OR) = 0.63, 95 % confidence interval (CI) = 0.46-0.87) was associated with a decreased risk of hepatocellular carcinoma (HCC). | 0.005971721 | 2013 | NA | 19 | 39252525 | T | G |
| rs8099917 | 23689989 | 3447 | IFNA13 | umls:C2239176 | BeFree | We genotyped the rs8099917 single-nucleotide polymorphism in 351 hepatitis C-associated HCC patients without history of IFN-based treatment, and correlated the age at onset of HCC in patients with each genotype. | 0.005971721 | 2013 | NA | 19 | 39252525 | T | G |
| rs8099917 | 25664396 | 282617 | IFNL3 | umls:C2239176 | BeFree | In conclusion, these results suggested a IL28B rs8099917T allele predispose for susceptibility to chronic HBV infection but not leading to HCC in Thai population. | 0.005971721 | 2014 | NA | 19 | 39252525 | T | G |
| rs861539 | 23558966 | 7517 | XRCC3 | umls:C2239176 | BeFree | XRCC3 T241M polymorphism is associated risk of hepatocellular carcinoma in the Chinese. | 0.007534359 | 2013 | KLC1;XRCC3 | 14 | 103699416 | G | A |
| rs861539 | 25337275 | 7517 | XRCC3 | umls:C2239176 | BeFree | In this study, we investigated whether six polymorphisms (including rs25487, rs861539, rs7003908, rs28383151, rs13181, and rs2228001) in DNA repair genes (XPC, XRCC4, XRCC1, XRCC4, XPD, XRCC7, and XRCC3) interacted with AFB1, and the gene-environmental interactive role in the risk of HCC using hospital-based case-control study (including 1486 HCC cases and 1996 controls). | 0.007534359 | 2014 | KLC1;XRCC3 | 14 | 103699416 | G | A |
| rs861539 | 23824570 | 7517 | XRCC3 | umls:C2239176 | BeFree | DNA repair gene XRCC3 Thr241Met polymorphism and hepatocellular carcinoma risk. | 0.007534359 | 2013 | KLC1;XRCC3 | 14 | 103699416 | G | A |
| rs867637 | 20798561 | 6817 | SULT1A1 | umls:C2239176 | BeFree | Minor allele homozygous genotypes at rs867637 (9,046 bp 3' of STP A>G), rs3771300 (IVS24-153T>G), and rs2280235 (IVS20-103G>A), compared with their homozygote genotypes of common alleles, were associated with 1.6- (95% CI 1.1-2.3), 1.6- (95% CI 1.1-2.4), and 1.4-fold (95% CI 0.95-1.9) increased risk of HCC, respectively. | 0.000814326 | 2010 | GLS | 2 | 190961656 | A | G |
| rs8971 | 25318605 | 6470 | SHMT1 | umls:C2239176 | BeFree | Results showed that six SNPs (MTHFR rs1801133, MTRR rs2287780, MTRR rs10380, FTHFD rs1127717, GART rs8971, and SHMT rs1979277) were significantly associated with HCC risk in Chinese population, with P values range from 2.26 × 10(-4) to 0.035). | 0.000271442 | 2014 | GART | 21 | 33511311 | T | C |
| rs8971 | 25318605 | 2618 | GART | umls:C2239176 | BeFree | Results showed that six SNPs (MTHFR rs1801133, MTRR rs2287780, MTRR rs10380, FTHFD rs1127717, GART rs8971, and SHMT rs1979277) were significantly associated with HCC risk in Chinese population, with P values range from 2.26 × 10(-4) to 0.035). | 0.000271442 | 2014 | GART | 21 | 33511311 | T | C |
| rs9267673 | 21105107 | 717 | C2 | umls:C2239176 | GAD | [Genetic variations at loci involved in the immune response are risk factors for hepatocellular carcinoma.] | 0.002367032 | 2010 | C2 | 6 | 31915902 | C | T |
| rs9267673 | 21105107 | 221527 | ZBTB12 | umls:C2239176 | GAD | [Genetic variations at loci involved in the immune response are risk factors for hepatocellular carcinoma.] | 0.002367032 | 2010 | C2 | 6 | 31915902 | C | T |
| rs9275572 | 21499248 | 3119 | HLA-DQB1 | umls:C2239176 | GAD | [Genome-wide association study identifies a susceptibility locus for HCV-induced hepatocellular carcinoma.] | 0.015731154 | 2011 | NA | 6 | 32711222 | A | G |
| rs9277535 | 25365208 | 3115 | HLA-DPB1 | umls:C2239176 | BeFree | HLA-DP/DQ polymorphisms (rs3077, rs9277535, rs7453920) did not associate with HCC development, but did correlate with HBV susceptibility and HBV natural clearance. | 0.003995683 | 2014 | HLA-DPB1 | 6 | 33087084 | A | G |
| rs947345 | 16109524 | 4595 | MUTYH | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.000542884 | 2005 | MEGF6 | 1 | 3507824 | G | A |
| rs947345 | 16109524 | 842 | CASP9 | umls:C2239176 | BeFree | Seven polymorphisms of caspase 9 (rs2308941)C-->T and DOK2(rs2242241) T-->G, 6 of polymorphisms of EGFL3 (rs947345)A -->G, caspase 9 ( rs2308938) C-->G and PHGDH(rs1801955)T-->A, 5 of polymorphisms of E2F2(rs3218170) G-->A,4 of polymorphisms of MUTYH(rs1140507)T-->C and BNIP3L(rs1055806)G-->T, and 1 of polymorphism of TNFRSF1B (rs1061622)T-->G were detected by the chip in the tissues of 10 HCC. | 0.003267234 | 2005 | MEGF6 | 1 | 3507824 | G | A |
| rs9679162 | 21635146 | 79623 | GALNT14 | umls:C2239176 | BeFree | The rs9679162 GALNT14 genotype is potentially associated with the objective response of the first course of FMP chemotherapy in patients with far advanced hepatocellular carcinoma. | 0.000542884 | 2011 | GALNT14 | 2 | 31024648 | G | T |
| rs9912300 | 25735330 | 47 | ACLY | umls:C2239176 | BeFree | Although we did not find any significant results in total analysis (all p>0.05), our stratified data showed that SNP rs9912300 in ACLY gene was significantly associated with overall survival of HCC patients with lower AFP level and SNP rs11871275 in ACACA gene was significantly associated with overall survival of HCC patients with higher AFP level. | 0.120271442 | 2015 | ACLY | 17 | 41869011 | G | T |
| rs9912300 | 25735330 | 31 | ACACA | umls:C2239176 | BeFree | Although we did not find any significant results in total analysis (all p>0.05), our stratified data showed that SNP rs9912300 in ACLY gene was significantly associated with overall survival of HCC patients with lower AFP level and SNP rs11871275 in ACACA gene was significantly associated with overall survival of HCC patients with higher AFP level. | 0.120271442 | 2015 | ACLY | 17 | 41869011 | G | T |
