PedAM

Pediatric Disease Annotations & Medicines


	glycogen storage disease ii

Disease ID	345
Disease	glycogen storage disease ii
Definition	An autosomal recessively inherited glycogen storage disease caused by GLUCAN 1,4-ALPHA-GLUCOSIDASE deficiency. Large amounts of GLYCOGEN accumulate in the LYSOSOMES of skeletal muscle (MUSCLE, SKELETAL); HEART; LIVER; SPINAL CORD; and BRAIN. Three forms have been described: infantile, childhood, and adult. The infantile form is fatal in infancy and presents with hypotonia and a hypertrophic cardiomyopathy (CARDIOMYOPATHY, HYPERTROPHIC). The childhood form usually presents in the second year of life with proximal weakness and respiratory symptoms. The adult form consists of a slowly progressive proximal myopathy. (From Muscle Nerve 1995;3:S61-9; Menkes, Textbook of Child Neurology, 5th ed, pp73-4)
Synonym	2 glycogenosis acid alpha glucosidase deficiency acid alpha-glucosidase deficiencies acid alpha-glucosidase deficiency acid maltase defic dis acid maltase deficiency acid maltase deficiency disease alpha 1,4 glucosidase deficiency alpha glucosidase deficiency alpha-1,4-glucosidase deficiency alpha-glucosidase deficiencies alpha-glucosidase deficiencies, acid alpha-glucosidase deficiency alpha-glucosidase deficiency, acid amd amd - acid maltase deficiency defic dis acid maltase defic dis lysosomal alpha 1 4 glucosidase deficiencies, acid alpha-glucosidase deficiencies, gaa deficiency disease, acid maltase deficiency disease, lysosomal alpha-1,4-glucosidase deficiency of acid maltase deficiency of alpha glucosidase deficiency of alpha-glucosidase deficiency of alpha-glucosidase (disorder) deficiency of amyloglucosidase deficiency of exo-1,4-alpha-glucosidase deficiency of gamma-amylase deficiency of glucan 1,4-alpha-glucosidase deficiency of glucan 1,4-alpha-glucosidase (disorder) deficiency of glucoamylase deficiency of glucoinvertase deficiency of glucosidosucrase deficiency of lysosomal alpha-glucosidase deficiency of maltase deficiency of maltase-glucoamylase deficiency, acid alpha-glucosidase deficiency, gaa disease pompe's disease, pompe disease, pompe's gaa gaa deficiencies gaa deficiency generalised glycogenosis generalized glycogenoses generalized glycogenosis generalized glycogenosis (disorder) glycogen heart disease glycogen storage dis ii glycogen storage disease type 2 glycogen storage disease type ii glycogen storage disease type ii [disease/finding] glycogen storage disease, type ii glycogen storage disease, type ii (disorder) glycogen storage disease, type ii [ambiguous] glycogenoses, generalized glycogenosis 02 glycogenosis 2 glycogenosis type ii glycogenosis, generalized glycogenosis, type 2 glycogenosis, type ii glycogenosis: [generalised] or [pompe's disease] or [type 2] glycogenosis: [generalised] or [pompe's disease] or [type 2] (disorder) glycogenosis: [generalized] or [pompe's disease] or [type 2] gsd ii gsd2 gsd2s lysosomal alpha 1 4 glucosidase defic dis lysosomal alpha 1,4 glucosidase deficiency disease lysosomal alpha glucosidase deficiency disease 01 04 lysosomal alpha-1,4-glucosidase deficiency lysosomal alpha-1,4-glucosidase deficiency (disorder) lysosomal alpha-1,4-glucosidase deficiency disease lysosomal glucosidase deficiency maltase acid deficiency maltase deficiency pompe dis pompe disease pompe's disease pompes dis pompes disease type ii, glycogenosis type iis, glycogenosis
OMIM	OMIM:232300 OMIM:606800
DOID	DOID:2752
ICD10	ICD10CM:E74.02
UMLS	C0017921
MeSH	D006009
SNOMED-CT	SNOMEDCT_US_2016_09_01:124454007;SNOMEDCT_US_2016_09_01:237967002;SNOMEDCT_US_2016_09_01:124462004;SNOMEDCT_US_2016_09_01:274864009;SNOMEDCT_US_2016_09_01:267424007
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:1) C0010068 \| coronary artery disease \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:1) GAA \| 2548 \| CLINVAR;CTD_human;OMIM;UNIPROT;GHR
Inferring Gene	Entrez_id \| Symbol \| Resource(Total Genes:2) 1636 \| ACE \| infer 2548 \| GAA \| infer
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:76) 4074 \| M6PR \| DISEASES 1774 \| DNASE1L1 \| DISEASES 55808 \| ST6GALNAC1 \| DISEASES 5837 \| PYGM \| DISEASES 7414 \| VCL \| DISEASES 49 \| ACR \| DISEASES 8106 \| PABPN1 \| DISEASES 5106 \| PCK2 \| DISEASES 55734 \| ZFP64 \| DISEASES 1158 \| CKM \| DISEASES 3945 \| LDHB \| DISEASES 7942 \| TFEB \| DISEASES 53632 \| PRKAG3 \| DISEASES 1509 \| CTSD \| DISEASES 7276 \| TTR \| DISEASES 1446 \| CSN1S1 \| DISEASES 1160 \| CKMT2 \| DISEASES 53 \| ACP2 \| DISEASES 6426 \| SRSF1 \| DISEASES 7528 \| YY1 \| DISEASES 57192 \| MCOLN1 \| DISEASES 8540 \| AGPS \| DISEASES 5286 \| PIK3C2A \| DISEASES 7168 \| TPM1 \| DISEASES 2588 \| GALNS \| DISEASES 5868 \| RAB5A \| DISEASES 3948 \| LDHC \| DISEASES 55079 \| FEZF2 \| DISEASES 51422 \| PRKAG2 \| DISEASES 5224 \| PGAM2 \| DISEASES 1152 \| CKB \| DISEASES 6901 \| TAZ \| DISEASES 1159 \| CKMT1B \| DISEASES 2548 \| GAA \| DISEASES 11338 \| U2AF2 \| DISEASES 2997 \| GYS1 \| DISEASES 10498 \| CARM1 \| DISEASES 2595 \| GANC \| DISEASES 6906 \| SERPINA7 \| DISEASES 1180 \| CLCN1 \| DISEASES 23193 \| GANAB \| DISEASES 2992 \| GYG1 \| DISEASES 859 \| CAV3 \| DISEASES 378884 \| NHLRC1 \| DISEASES 8733 \| GPAA1 \| DISEASES 26503 \| SLC17A5 \| DISEASES 30849 \| PIK3R4 \| DISEASES 56980 \| PRDM10 \| DISEASES 9782 \| MATR3 \| DISEASES 4519 \| MT-CYB \| DISEASES 1756 \| DMD \| DISEASES 7402 \| UTRN \| DISEASES 55811 \| ADCY10 \| DISEASES 55170 \| PRMT6 \| DISEASES 4534 \| MTM1 \| DISEASES 5563 \| PRKAA2 \| DISEASES 6342 \| SCP2 \| DISEASES 6429 \| SRSF4 \| DISEASES 3399 \| ID3 \| DISEASES 160897 \| GPR180 \| DISEASES 387755 \| INSC \| DISEASES 4926 \| NUMA1 \| DISEASES 10020 \| GNE \| DISEASES 387836 \| CLEC2A \| DISEASES 6329 \| SCN4A \| DISEASES 3908 \| LAMA2 \| DISEASES 3276 \| PRMT1 \| DISEASES 548596 \| CKMT1A \| DISEASES 3920 \| LAMP2 \| DISEASES 7555 \| CNBP \| DISEASES 389549 \| FEZF1 \| DISEASES 4671 \| NAIP \| DISEASES 270 \| AMPD1 \| DISEASES 6207 \| RPS13 \| DISEASES 3939 \| LDHA \| DISEASES 4850 \| CNOT4 \| DISEASES
Locus	(Waiting for update.)

Disease ID	345
Disease	glycogen storage disease ii
Integrated Phenotype	HPO \| Name(Total Integrated Phenotypes:20) HP:0001945 \| Fever HP:0001640 \| Increased heart size HP:0005165 \| Shortened PR interval on EKG HP:0001716 \| Wolff-Parkinson-White syndrome HP:0004944 \| Cerebral artery aneurysm HP:0001284 \| Areflexia HP:0002747 \| Respiratory distress due to muscle weakness HP:0011400 \| Abnormal CNS myelination HP:0001252 \| Hypotonia HP:0001744 \| Splenomegaly HP:0002240 \| Enlarged liver HP:0002093 \| progressive respiratory failure HP:0000158 \| Abnormally large tongue HP:0006597 \| Paralyzed diaphragm HP:0003725 \| Firm muscles HP:0003701 \| Proximal limb muscle weakness HP:0002205 \| Frequent respiratory infections HP:0000365 \| Hearing impairment HP:0003236 \| Elevated creatine kinase HP:0002094 \| Dyspnea
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:2) HP:0005181 \| Premature coronary artery disease \| 1 HP:0001677 \| Coronary artery disease \| 1

Disease ID	345
Disease	glycogen storage disease ii
Manually Symptom	(Waiting for update.)
Text Mined Symptom	(Waiting for update.)

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:61)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs121907937	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110950	G	A
rs121907938	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113350	C	T
rs121907940	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80107837	T	C,G
rs121907942	7881422	2548	GAA	umls:C0017921	BeFree	The effect of a single base pair deletion (delta T525) and a C1634T missense mutation (pro545leu) on the expression of lysosomal alpha-glucosidase in patients with glycogen storage disease type II.	0.499337114	1994	GAA	17	80111023	C	T
rs121907943	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80118271	C	T
rs140826989	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110837	G	A
rs147804176	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110726	G	C,T
rs200210219	22644586	2548	GAA	umls:C0017921	UNIPROT	Update of the pompe disease mutation database with 60 novel GAA sequence variants and additional studies on the functional effect of 34 previously reported variants.	0.499337114	2012	GAA	17	80105873	G	A
rs200856561	20080426	2548	GAA	umls:C0017921	UNIPROT	Therefore, newborn screening for Pompe disease could be successfully conducted by including genotyping and lymphocyte GAA assay, even in a population with mutation heterozygosity and pseudodeficiency.	0.499337114	2010	GAA	17	80107616	C	T
rs201185475	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80104758	C	T
rs201896815	20080426	2548	GAA	umls:C0017921	UNIPROT	Therefore, newborn screening for Pompe disease could be successfully conducted by including genotyping and lymphocyte GAA assay, even in a population with mutation heterozygosity and pseudodeficiency.	0.499337114	2010	GAA	17	80107648	G	A
rs201896815	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80107648	G	A
rs28937909	18429042	2548	GAA	umls:C0017921	UNIPROT	Molecular and functional characterization of eight novel GAA mutations in Italian infants with Pompe disease.	0.499337114	2008	GAA	17	80112914	G	A,T
rs28939100	8401535	2548	GAA	umls:C0017921	UNIPROT	Two mutations affecting the transport and maturation of lysosomal alpha-glucosidase in an adult case of glycogen storage disease type II.	0.499337114	1993	NA	NA	NA	NA	NA
rs28940868	20080426	2548	GAA	umls:C0017921	UNIPROT	Therefore, newborn screening for Pompe disease could be successfully conducted by including genotyping and lymphocyte GAA assay, even in a population with mutation heterozygosity and pseudodeficiency.	0.499337114	2010	GAA	17	80112922	C	A,T
rs28940868	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112922	C	A,T
rs368438393	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112920	G	A,C
rs369532274	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80118223	C	T
rs370950728	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80105857	G	A
rs374143224	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112966	G	A
rs374470794	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112625	C	G
rs386834235	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80105111	T	-
rs386834236	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80104542	T	G
rs398123169	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110754	G	A
rs398123170	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112999	T	C,G
rs398123171	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113247	-	AGCCG
rs398123172	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113282	G	A,T
rs398123173	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80118255	C	-
rs398123174	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80104893	T	G
rs528367092	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80105771	G	A,T
rs536906561	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112929	G	A
rs536906561	9535769	2548	GAA	umls:C0017921	UNIPROT	Glycogen storage disease type II (GSDII), an autosomal recessive myopathic disorder, results from deficiency of lysosomal acid alpha-glucosidase.	0.499337114	1998	GAA	17	80112929	G	A
rs543300039	16917947	2548	GAA	umls:C0017921	UNIPROT	Mutation profile of the GAA gene in 40 Italian patients with late onset glycogen storage disease type II.	0.499337114	2006	GAA	17	80107866	G	A
rs543300039	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80107866	G	A
rs549029029	20080426	2548	GAA	umls:C0017921	UNIPROT	Therefore, newborn screening for Pompe disease could be successfully conducted by including genotyping and lymphocyte GAA assay, even in a population with mutation heterozygosity and pseudodeficiency.	0.499337114	2010	GAA	17	80112666	G	A
rs549029029	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112666	G	A
rs577915581	20080426	2548	GAA	umls:C0017921	UNIPROT	Therefore, newborn screening for Pompe disease could be successfully conducted by including genotyping and lymphocyte GAA assay, even in a population with mutation heterozygosity and pseudodeficiency.	0.499337114	2010	GAA	17	80107625	C	T
rs730880022	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80108338	G	A
rs730880372	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113255	-	A
rs757111744	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113001	C	T
rs757700700	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80105872	C	T
rs767882689	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80105111	TG	-
rs770276275	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110029	GAGA	-
rs770610356	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80108811	C	T
rs772883420	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110730	T	C
rs780321415	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80118319	C	T
rs781088002	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112650	C	-
rs786204467	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80104587	A	G
rs786204507	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80108385	G	-
rs786204517	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80108569	C	T
rs786204532	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80107630	TATATCACAGGCCTCGCCGA	C
rs786204549	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113317	C	-
rs786204561	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80118359	T	A
rs786204614	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80104929	C	T
rs786204621	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113011	ACA	-
rs786204645	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80113281	C	T
rs786204646	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80108541	GG	C
rs786204661	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80104951	T	-
rs786204720	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110945	T	C
rs786204727	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80112649	-	A
rs796051877	NA	2548	GAA	umls:C0017921	CLINVAR	NA	0.499337114	NA	GAA	17	80110055	G	A

GWASdb Annotation(Total Genotypes:1)
Chr	Pos	SNP_Id	RefGene	EnsemblGene	ENCODE_Factor	ENCODE_TFBS	Chromosome_interaction	GTEx_eQTL	SNP_TFBS_affinity_GWAS3D	SNP_miRNA_target_affinity_PolymiRTS	SNP_splicing_effect_Skippy	SNP_splicing_effect_MutPred_Splice	SNP_ns_protein_effect_dbNSFP	SNP_syn_effect_Silva	SNP_phosphorylation_effect_PhosSNP	PhastCons_score	PhyloP_score	GERP++_RS	Segway_state	Ancestral_allele	ESP_AF	ESP_AFR	ESP_AFR	ESP_EUR	TG_ASN	TG_AMR	TG_AFR	TG_EUR	Type	Consequence	bStatistic	EncH3K27Ac	EncH3K4Me1	EncH3K4Me3	EncNucleo	OMIM	Clinvar
17	78077714	rs12600845	NM_000152,GAA	NM_001079803,GAA	NM_001079804,GAA	ENST00000414495,ENSG00000171298	ENST00000390015,ENSG00000171298	ENST00000302262,ENSG00000171298	NA	NA	chr17,78070001,78080000,chr17,79560001,79570000,28,Hi-C	chr17,78070001,78080000,chr17,78190001,78200000,5,Hi-C	chr17,78070001,78080000,chr17,77840001,77850000,5,Hi-C	chr17,78070001,78080000,chr16,11080001,11090000,10,Hi-C	chr17,78070001,78080000,chr17,77890001,77900000,8,Hi-C	NA	LM129,1.8972	LM213,3.8592	at_AC_acceptor,1.2746	at_AC_acceptor,1.9911	STAT1,1.3976	NA	NA	NA	NA	NA	NA	0.000	-0.129	-0.433	R5	T	NA	NA	NA	NA	NA

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:0)
(Waiting for update.)

Chemical(Total Drugs:0)
(Waiting for update.)

FDA approved drug and dosage information(Total Drugs:0)
(Waiting for update.)

FDA labeling changes(Total Drugs:0)
(Waiting for update.)