All Snps(Total Genotypes:413) |
|---|
| snpId |
pubmedId |
geneId |
geneSymbol |
diseaseId |
sourceId |
sentence |
score |
Year |
geneSymbol_dbSNP |
CHROMOSOME |
POS |
REF |
ALT |
| rs10052016 | 23901064 | 7015 | TERT | umls:C0024623 | BeFree | After combining these two studies, we found that the G allele of rs10052016 (at 132 kb upstream of TERT) was significantly associated with a decreased risk of gastric cancer (OR = 0.76, 95% CI = 0.67-0.87, P = 5.35 × 10(-5)). | 0.004614512 | 2014 | SLC6A3 | 5 | 1427996 | A | G |
| rs10421916 | 23028900 | 3640 | INSL3 | umls:C0024623 | BeFree | INSL3 rs10421916 and rs11088680 had both a 0.8-fold decreased OR for gastric cancer (95% CIs = 0.7-0.97; and 0.7-0.9, respectively). | 0.000271442 | 2012 | INSL3 | 19 | 17818178 | A | G |
| rs1042522 | 25190020 | 7157 | TP53 | umls:C0024623 | BeFree | However, no overall association was found between the TP53 Arg72Pro polymorphism and gastric cancer risk. | 0.084277802 | 2014 | TP53 | 17 | 7676154 | G | T,C |
| rs1042522 | 22631671 | 7157 | TP53 | umls:C0024623 | BeFree | Pro variant of TP53 Arg72Pro contributes to gastric cancer risk in Asians: evidence from a meta-analysis. | 0.084277802 | 2012 | TP53 | 17 | 7676154 | G | T,C |
| rs1042522 | 21376265 | 7157 | TP53 | umls:C0024623 | BeFree | This meta-analysis suggests that Pro allele in P53 Arg72Pro is significantly associated with the increased risks of digestive tract cancers, especially for Asians, and for gastric cancer, colorectal cancer and gallbladder and pancreatic cancer. | 0.084277802 | 2011 | TP53 | 17 | 7676154 | G | T,C |
| rs1042522 | 22780299 | 7157 | TP53 | umls:C0024623 | BeFree | Association of p53 Arg72Pro polymorphism with gastric cancer: a meta-analysis. | 0.084277802 | 2012 | TP53 | 17 | 7676154 | G | T,C |
| rs1042522 | 22901123 | 7157 | TP53 | umls:C0024623 | BeFree | Updated meta-analysis of the TP53 Arg72Pro polymorphism and gastric cancer risk. | 0.084277802 | 2012 | TP53 | 17 | 7676154 | G | T,C |
| rs1045642 | 24815441 | 5243 | ABCB1 | umls:C0024623 | BeFree | Lack of association of the MDR1 C3435T polymorphism with susceptibility to gastric cancer and peptic ulcer: a systemic review and meta-analysis. | 0.014505971 | 2015 | ABCB1 | 7 | 87509329 | A | T,G |
| rs1045642 | 22296392 | 5243 | ABCB1 | umls:C0024623 | BeFree | MDR1 gene C3435T polymorphism is associated with clinical outcomes in gastric cancer patients treated with postoperative adjuvant chemotherapy. | 0.014505971 | 2011 | ABCB1 | 7 | 87509329 | A | T,G |
| rs1045642 | 22641402 | 5243 | ABCB1 | umls:C0024623 | BeFree | No correlation was observed between the C3435T polymorphism of the MDR1 gene and GC risk or prognosis in the population studied. | 0.014505971 | 2012 | ABCB1 | 7 | 87509329 | A | T,G |
| rs1045642 | 18644389 | 5243 | ABCB1 | umls:C0024623 | BeFree | MDR1 C3435T polymorphism has no influence on developing Helicobacter pylori infection-related gastric cancer and peptic ulcer in Japanese. | 0.014505971 | 2008 | ABCB1 | 7 | 87509329 | A | T,G |
| rs10499563 | 24460320 | 3569 | IL6 | umls:C0024623 | BeFree | IL-6-6331 (T/C, rs10499563) is associated with decreased risk of gastric cancer in Northern Chinese. | 0.013496149 | 2014 | NA | 7 | 22720869 | T | C |
| rs10505477 | 25046748 | 5462 | POU5F1B | umls:C0024623 | BeFree | Our preliminary study indicates for the first time that POU5F1P1 rs10505477 is correlated with survival of gastric cancer patients who receving cisplatin-based chemotherapy after gastrectomy. | 0.000542884 | 2014 | CASC8 | 8 | 127395198 | A | G |
| rs10509670 | 26554163 | 596 | BCL2 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.015200745 | 2016 | PLCE1 | 10 | 94308190 | A | G |
| rs10509670 | 26554163 | 8000 | PSCA | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.009771907 | 2016 | PLCE1 | 10 | 94308190 | A | G |
| rs10509670 | 26554163 | 51196 | PLCE1 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.124071628 | 2016 | PLCE1 | 10 | 94308190 | A | G |
| rs10509670 | 26554163 | 252969 | NEIL2 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.000542884 | 2016 | PLCE1 | 10 | 94308190 | A | G |
| rs10511729 | 25239644 | 1993 | ELAVL2 | umls:C0024623 | BeFree | ASSET analyses identified four SNPs significantly associated with multiple cancers: rs3731239 (CDKN2A intronic) with ESCC, GC and BC (P = 3.96 × 10(-) (4)); rs10811474 (3' of IFNW1) with RCC and BrC (P = 0.001); rs12683422 (LINGO2 intronic) with RCC and BC (P = 5.93 × 10(-) (4)) and rs10511729 (3' of ELAVL2) with LC and BrC (P = 8.63 × 10(-) (4)). | 0.000814326 | 2015 | LOC101929563 | 9 | 23557229 | T | G |
| rs1051740 | 17164366 | 2052 | EPHX1 | umls:C0024623 | BeFree | We found an increased risk of gastric cancer for homozygotes for C (histidine) variant in Y113H of EPHX1 (odds ratio, 1.91; 95% confidence interval, 1.19-3.07) compared with subjects with TC/TT. | 0.002909916 | 2006 | EPHX1 | 1 | 225831932 | T | C |
| rs1051740 | 23580125 | 2052 | EPHX1 | umls:C0024623 | BeFree | Association of microsomal epoxide hydrolase exon 3 Tyr113His and exon 4 His139Arg polymorphisms with gastric cancer in India. | 0.002909916 | 2013 | EPHX1 | 1 | 225831932 | T | C |
| rs1052133 | 22799296 | 4968 | OGG1 | umls:C0024623 | BeFree | Lack of association between the hOGG1 Ser326Cys polymorphism and gastric cancer risk: a meta-analysis. | 0.012529933 | 2012 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 22296498 | 4968 | OGG1 | umls:C0024623 | BeFree | Lack of association between Human Oxoguanine Glycosylase 1 (hOGG1) S326C polymorphism and the risk of gastric cancer: a meta-analysis. | 0.012529933 | 2012 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 20817763 | 4255 | MGMT | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.006710102 | 2010 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 19147860 | 328 | APEX1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.002442977 | 2009 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 15596047 | 4968 | OGG1 | umls:C0024623 | BeFree | hOGG1 Ser326Cys polymorphism, interaction with environmental exposures, and gastric cancer risk in Japanese populations. | 0.012529933 | 2004 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 20817763 | 4968 | OGG1 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.012529933 | 2010 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 20817763 | 2067 | ERCC1 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.010434343 | 2010 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 22114677 | 4968 | OGG1 | umls:C0024623 | BeFree | The significant effects of hOGG1 Ser326Cys polymorphism on colorectal, breast, bladder, prostate, esophageal, and gastric cancer were not detected. | 0.012529933 | 2011 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 22343785 | 4968 | OGG1 | umls:C0024623 | BeFree | The functional Ser326Cys polymorphism in hOGG1 is associated with gastric cancer risk: evidence from 1180 cases and 2444 controls. | 0.012529933 | 2012 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 20817763 | 2068 | ERCC2 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.011911105 | 2010 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 19147860 | 7515 | XRCC1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.017611384 | 2009 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 20817763 | 7517 | XRCC3 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.007448483 | 2010 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 19147860 | 4968 | OGG1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.012529933 | 2009 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 22294108 | 4968 | OGG1 | umls:C0024623 | BeFree | Association of hOGG1 Ser326Cys polymorphism with gastric cancer risk: a meta-analysis. | 0.012529933 | 2012 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1052133 | 22471492 | 4968 | OGG1 | umls:C0024623 | BeFree | Lack of association between the 8-oxoguanine DNA glycosylase gene Ser326Cys polymorphism and gastric cancer: evidence from a meta-analysis. | 0.012529933 | 2011 | OGG1;CAMK1 | 3 | 9757089 | C | G |
| rs1062935 | 23423739 | 64223 | MLST8 | umls:C0024623 | BeFree | In this study, we examined the associations between eight potential functional single nucleotide polymorphisms in the mTORC1 genes (rs2536T>C and rs1883965G>A for mTOR, rs3160T>C, and rs26865A>G for mLST8, rs3751934C>A, rs1062935T>C, rs3751932T>C, and rs12602885G>A for Raptor, not included in published gastric cancer genome-wide association studies) and gastric cancer risk in 1125 gastric cancer cases and 1196 cancer-free controls. | 0.000271442 | 2013 | RPTOR | 17 | 80966057 | T | C |
| rs10739971 | 24586594 | 406881 | MIRLET7A1 | umls:C0024623 | BeFree | An interaction effect of pri-let-7a-1 rs10739971 polymorphism with ERCC6 rs1917799 polymorphism was observed for the risk of gastric cancer (P interaction = 0.026); and interaction effects of pri-let-7a-1 rs10739971 polymorphism with PGC rs6458238 polymorphism (P interaction = 0.012) and PGC rs9471643 polymorphism (P interaction = 0.039) were observed for the risk of atrophic gastritis. | 0.000271442 | 2014 | MIRLET7A1;MIRLET7F1 | 9 | 94175398 | G | A |
| rs10739971 | 24586594 | 2074 | ERCC6 | umls:C0024623 | BeFree | The interaction effects of pri-let-7a-1 rs10739971 with PGC and ERCC6 gene polymorphisms in gastric cancer and atrophic gastritis. | 0.000542884 | 2014 | MIRLET7A1;MIRLET7F1 | 9 | 94175398 | G | A |
| rs10739971 | 24586594 | 5225 | PGC | umls:C0024623 | BeFree | The interaction effects of pri-let-7a-1 rs10739971 with PGC and ERCC6 gene polymorphisms in gastric cancer and atrophic gastritis. | 0.009815515 | 2014 | MIRLET7A1;MIRLET7F1 | 9 | 94175398 | G | A |
| rs10811474 | 25239644 | 1993 | ELAVL2 | umls:C0024623 | BeFree | ASSET analyses identified four SNPs significantly associated with multiple cancers: rs3731239 (CDKN2A intronic) with ESCC, GC and BC (P = 3.96 × 10(-) (4)); rs10811474 (3' of IFNW1) with RCC and BrC (P = 0.001); rs12683422 (LINGO2 intronic) with RCC and BC (P = 5.93 × 10(-) (4)) and rs10511729 (3' of ELAVL2) with LC and BrC (P = 8.63 × 10(-) (4)). | 0.000814326 | 2015 | NA | 9 | 21114238 | A | G |
| rs10983755 | 25084512 | 7099 | TLR4 | umls:C0024623 | BeFree | Effect of the -2081G/A polymorphism of the TLR4 gene and its interaction with Helicobacter pylori infection on the risk of gastric cancer in Chinese individuals. | 0.008881637 | 2015 | TLR4 | 9 | 117702392 | G | A |
| rs11066280 | 25661349 | 57103 | C12orf5 | umls:C0024623 | BeFree | C12orf5 rs11066280 could be useful marker of survival assessment and individualized clinical therapy for gastric cancer, particularly among the intestinal-type gastric cancer. | 0.000271442 | 2014 | HECTD4 | 12 | 112379979 | T | A |
| rs11088680 | 23028900 | 3640 | INSL3 | umls:C0024623 | BeFree | INSL3 rs10421916 and rs11088680 had both a 0.8-fold decreased OR for gastric cancer (95% CIs = 0.7-0.97; and 0.7-0.9, respectively). | 0.000271442 | 2012 | NA | 21 | 13514758 | A | G |
| rs11170877 | 25261463 | 442892 | MIR148B | umls:C0024623 | BeFree | Polymorphisms of miR-148b rs11170877 and 12231393 and their haplotypes were predictive factors of susceptibility to GC. | 0.000542884 | 2015 | COPZ1 | 12 | 54340505 | A | G |
| rs11209026 | 25666505 | 149233 | IL23R | umls:C0024623 | BeFree | Variants of IL23R gene were investigated for association with many diseases like chronic inflammatory disorders, RA, inflammatory bowel diseases and the susceptibility to the development of gastric cancer but no data are available concerning the association of IL23R gene (rs11209026) polymorphism with HCC development in HCV patients. | 0.000814326 | 2015 | IL23R | 1 | 67240275 | G | A |
| rs11209026 | 25666505 | 84668 | FAM126A | umls:C0024623 | BeFree | Variants of IL23R gene were investigated for association with many diseases like chronic inflammatory disorders, RA, inflammatory bowel diseases and the susceptibility to the development of gastric cancer but no data are available concerning the association of IL23R gene (rs11209026) polymorphism with HCC development in HCV patients. | 0.001628651 | 2015 | IL23R | 1 | 67240275 | G | A |
| rs1130409 | 19147860 | 4968 | OGG1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.012529933 | 2009 | APEX1;OSGEP | 14 | 20456995 | T | A,G |
| rs1130409 | 24349526 | 328 | APEX1 | umls:C0024623 | BeFree | Our findings suggest that APEX1 Asp148Glu polymorphism might be a genetic risk factor for the development of gastric cancer. | 0.002442977 | 2013 | APEX1;OSGEP | 14 | 20456995 | T | A,G |
| rs1130409 | 19147860 | 7515 | XRCC1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.017611384 | 2009 | APEX1;OSGEP | 14 | 20456995 | T | A,G |
| rs1130409 | 25945024 | 328 | APEX1 | umls:C0024623 | BeFree | This meta-analysis suggests that the APE1 Asp148Glu polymorphism G allele is associated with an increased GI cancer risk, especially in gastric cancer. | 0.002442977 | 2014 | APEX1;OSGEP | 14 | 20456995 | T | A,G |
| rs1130409 | 19147860 | 328 | APEX1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.002442977 | 2009 | APEX1;OSGEP | 14 | 20456995 | T | A,G |
| rs1136201 | 23844533 | 2064 | ERBB2 | umls:C0024623 | BeFree | Analysis of the polymorphisms EGFR-r521K and ERBB2-I655V in Mexican patients with gastric cancer and premalignant gastric lesions. | 0.070151555 | 2013 | ERBB2 | 17 | 39723335 | A | G,T |
| rs1136201 | 23844533 | 1956 | EGFR | umls:C0024623 | BeFree | Our data suggest that the EGFR-R521K and ERBB2-I655V polymorphisms are not suitable as markers for identifying individuals with a higher risk for developing gastric cancer in our population. | 0.03009771 | 2013 | ERBB2 | 17 | 39723335 | A | G,T |
| rs1136410 | 18716896 | 142 | PARP1 | umls:C0024623 | BeFree | PARP-1 Val762Ala polymorphism, CagA+ H. pylori infection and risk for gastric cancer in Han Chinese population. | 0.002714419 | 2009 | PARP1 | 1 | 226367601 | A | G |
| rs1136410 | 22901183 | 142 | PARP1 | umls:C0024623 | BeFree | ADPRT Val762Ala and XRCC1 Arg194Trp polymorphisms and risk of gastric cancer in Sichuan of China. | 0.002714419 | 2012 | PARP1 | 1 | 226367601 | A | G |
| rs1136410 | 22901183 | 7515 | XRCC1 | umls:C0024623 | BeFree | ADPRT Val762Ala and XRCC1 Arg194Trp polymorphisms and risk of gastric cancer in Sichuan of China. | 0.017611384 | 2012 | PARP1 | 1 | 226367601 | A | G |
| rs1136410 | 21612407 | 4313 | MMP2 | umls:C0024623 | BeFree | Epistasis between PARP1 rs1136410 and MMP2 rs243865 increased the risk of LNM of GC. | 0.013420204 | 2011 | PARP1 | 1 | 226367601 | A | G |
| rs1143623 | 21649724 | 5743 | PTGS2 | umls:C0024623 | BeFree | In the Chinese subgroup, nominally significant associations were shown between (i) EBBR2+1963G (rs1801200) and H. pylori infection (per-allele OR: 0.48, 95% CI 0.23, 0.98, P = 0.04), (ii) PTGS2-1195G (rs689466) and an increased risk of GC on adjusting for H. pylori status (OR: 1.53, 95% CI 0.99, 2.37, P = 0.05), and (iii) IL1B-1473C (rs1143623) and a decreased risk of GC (OR: 0.64, 95% CI 0.41, 0.99, P = 0.05). | 0.036959702 | 2011 | IL1B | 2 | 112838252 | C | G |
| rs1143623 | 21649724 | 3553 | IL1B | umls:C0024623 | BeFree | In the Chinese subgroup, nominally significant associations were shown between (i) EBBR2+1963G (rs1801200) and H. pylori infection (per-allele OR: 0.48, 95% CI 0.23, 0.98, P = 0.04), (ii) PTGS2-1195G (rs689466) and an increased risk of GC on adjusting for H. pylori status (OR: 1.53, 95% CI 0.99, 2.37, P = 0.05), and (iii) IL1B-1473C (rs1143623) and a decreased risk of GC (OR: 0.64, 95% CI 0.41, 0.99, P = 0.05). | 0.064669312 | 2011 | IL1B | 2 | 112838252 | C | G |
| rs11536889 | 20721625 | 7099 | TLR4 | umls:C0024623 | BeFree | This study aimed to examine the associations of the miR-146a G/C (rs2910164) and TLR4 +3725 G/C (rs11536889) polymorphisms with the risk of Helicobacter pylori (H. pylori) infection, gastric atrophy, and gastric cancer in a Japanese population. | 0.008881637 | 2011 | TLR4 | 9 | 117715853 | G | C |
| rs11536889 | 24929142 | 7099 | TLR4 | umls:C0024623 | BeFree | In multivariate analyses, TLR4 rs11536889 remained a risk factor for GC (OR: 3.58, 95% CI: 1.20-10.65). | 0.008881637 | 2014 | TLR4 | 9 | 117715853 | G | C |
| rs11536889 | 20721625 | 406938 | MIR146A | umls:C0024623 | BeFree | This study aimed to examine the associations of the miR-146a G/C (rs2910164) and TLR4 +3725 G/C (rs11536889) polymorphisms with the risk of Helicobacter pylori (H. pylori) infection, gastric atrophy, and gastric cancer in a Japanese population. | 0.005157396 | 2011 | TLR4 | 9 | 117715853 | G | C |
| rs11536889 | 23565226 | 4695 | NDUFA2 | umls:C0024623 | BeFree | TLR4 rs11536889 and CD14 -260 C/T are associated with non-cardia GC in Chinese. | 0.002171535 | 2013 | TLR4 | 9 | 117715853 | G | C |
| rs11540654 | 22631671 | 7157 | TP53 | umls:C0024623 | BeFree | Pro variant of TP53 Arg72Pro contributes to gastric cancer risk in Asians: evidence from a meta-analysis. | 0.084277802 | 2012 | TP53 | 17 | 7676040 | C | T,G,A |
| rs11540654 | 25190020 | 7157 | TP53 | umls:C0024623 | BeFree | However, no overall association was found between the TP53 Arg72Pro polymorphism and gastric cancer risk. | 0.084277802 | 2014 | TP53 | 17 | 7676040 | C | T,G,A |
| rs11540654 | 21376265 | 7157 | TP53 | umls:C0024623 | BeFree | This meta-analysis suggests that Pro allele in P53 Arg72Pro is significantly associated with the increased risks of digestive tract cancers, especially for Asians, and for gastric cancer, colorectal cancer and gallbladder and pancreatic cancer. | 0.084277802 | 2011 | TP53 | 17 | 7676040 | C | T,G,A |
| rs11540654 | 22901123 | 7157 | TP53 | umls:C0024623 | BeFree | Updated meta-analysis of the TP53 Arg72Pro polymorphism and gastric cancer risk. | 0.084277802 | 2012 | TP53 | 17 | 7676040 | C | T,G,A |
| rs11540654 | 22780299 | 7157 | TP53 | umls:C0024623 | BeFree | Association of p53 Arg72Pro polymorphism with gastric cancer: a meta-analysis. | 0.084277802 | 2012 | TP53 | 17 | 7676040 | C | T,G,A |
| rs11614913 | 25202115 | 406938 | MIR146A | umls:C0024623 | BeFree | We evaluated the associations of three selected SNPs (rs11614913, rs2910164, and rs3746444) in pre-miRNAs (hsa-mir-196a2, hsa-mir-146a and hsa-mir-499) with the prognosis of advanced gastric cancers (GCs) treated by chemotherapy. | 0.005157396 | 2014 | MIR196A2 | 12 | 53991815 | C | T |
| rs11614913 | 21073609 | 574501 | MIR499A | umls:C0024623 | BeFree | We evaluated the associations of three SNPs (rs11614913, rs2910164, and rs3746444) in pre-miRNAs (miR-196a2, miR-146a, and miR-499) with the risk of gastric cancer (GC) and peptic ulcer diseases, and with the severity of Helicobacter pylori-induced gastritis in Japanese population. | 0.001085767 | 2010 | MIR196A2 | 12 | 53991815 | C | T |
| rs11614913 | 25795117 | 406938 | MIR146A | umls:C0024623 | BeFree | In the stratified analysis, in some subgroup, heterozygous miR-146a rs2910164 was associated with a decreased risk of gastric cancer; and the variant genotype of miR-196a-2 rs11614913 was associated with an increased risk. | 0.005157396 | 2014 | MIR196A2 | 12 | 53991815 | C | T |
| rs11614913 | 24379078 | 406941 | MIR149 | umls:C0024623 | BeFree | We found that the risk for GC was significantly higher for the carriers of miR-149 rs2292832CC (p = 0.009) and miR-196a2 rs11614913CC (p < 0.0001) genotypes, as well as for the carriers of the rs2910164/rs2292832/rs11614913 CCC and GTC haplotype (p < 0.0001 and p = 0.03, respectively). | 0.001085767 | 2013 | MIR196A2 | 12 | 53991815 | C | T |
| rs11614913 | 24379078 | 406938 | MIR146A | umls:C0024623 | BeFree | The aim of the study was to investigated whether three common miRNA polymorphisms [miR-146a C>G (rs2910164), miR-149 T>C (rs2292832), and miR-196a2 T>C (rs11614913)] are associated with the susceptibility and prognosis of gastric cancer (GC) in the Greek population. | 0.005157396 | 2013 | MIR196A2 | 12 | 53991815 | C | T |
| rs11614913 | 25202115 | 574501 | MIR499A | umls:C0024623 | BeFree | We evaluated the associations of three selected SNPs (rs11614913, rs2910164, and rs3746444) in pre-miRNAs (hsa-mir-196a2, hsa-mir-146a and hsa-mir-499) with the prognosis of advanced gastric cancers (GCs) treated by chemotherapy. | 0.001085767 | 2014 | MIR196A2 | 12 | 53991815 | C | T |
| rs11615 | 25542228 | 2067 | ERCC1 | umls:C0024623 | BeFree | By the Cox analysis, the CC genotype of ERCC1 rs11615, AA genotype of ERCC2 rs1799793, and CC genotype of NBN rs1805794 were significantly associated with a longer overall survival (OS) of gastric cancer. | 0.010434343 | 2014 | ERCC1 | 19 | 45420395 | A | G |
| rs11615 | 25542228 | 2068 | ERCC2 | umls:C0024623 | BeFree | In conclusion, our results suggest that ERCC1 rs11615, ERCC2 rs1799793, and NBN rs1805794 polymorphisms in the DNA repair pathways may influence the response to chemotherapy and OS of gastric cancer. | 0.011911105 | 2014 | ERCC1 | 19 | 45420395 | A | G |
| rs11615 | 25542228 | 4683 | NBN | umls:C0024623 | BeFree | In conclusion, our results suggest that ERCC1 rs11615, ERCC2 rs1799793, and NBN rs1805794 polymorphisms in the DNA repair pathways may influence the response to chemotherapy and OS of gastric cancer. | 0.002909916 | 2014 | ERCC1 | 19 | 45420395 | A | G |
| rs1179251 | 25387810 | 53342 | IL17D | umls:C0024623 | BeFree | In summary, our study demonstrates that the rs1179251 polymorphism of IL-22 was associated with an increased risk of GC and may influence the progression of GC. | 0.000271442 | 2014 | IL22;LOC105369818 | 12 | 68251271 | C | G |
| rs12108497 | 25002346 | 836 | CASP3 | umls:C0024623 | BeFree | In analysis of gene polymorphism of caspase3 intrinsic apoptotic pathway and gastric cancer susceptibility, polymorphism of CASP3 rs4647693, CASP3 rs12108497 and CASP3 rs4647610 increased gastric cancer risk (rs4647693: ORGA 1.61, 95 % CI 1.06-2.28; rs12108497: ORTC 1.55, 95 % CI 1.09-2.18; ORCC 2.45, 95 % CI 1.08-4.16; rs4647610: ORAG 1.71, 95 % CI 1.14-2.31; ORGG 1.60, 95 % CI 1.23-2.34). | 0.007057489 | 2015 | CASP3;PRIMPOL | 4 | 184650403 | C | T |
| rs12155758 | 24023815 | 8000 | PSCA | umls:C0024623 | BeFree | We analyzed 3 SNPs in the PSCA gene (rs2294008, rs9297976 and rs12155758) which were previously found to be associated with GC risk in Europeans. | 0.009771907 | 2013 | NA | 8 | 142684467 | G | A |
| rs121912664 | 22004116 | 7157 | TP53 | umls:C0024623 | BeFree | TP53 mutation p.R337H in gastric cancer tissues of a 12-year-old male child: evidence for chimerism involving a common mutant founder haplotype: case report. | 0.084277802 | 2011 | TP53 | 17 | 7670699 | C | T,G,A |
| rs12229892 | 23455381 | 5781 | PTPN11 | umls:C0024623 | BeFree | We observed that PGC rs6458238, PGC rs4711690 and PTPN11 rs12229892 were associated with susceptibilities to GA and/or GC. | 0.004810009 | 2013 | PTPN11 | 12 | 112485589 | G | A |
| rs12229892 | 23455381 | 5225 | PGC | umls:C0024623 | BeFree | We observed that PGC rs6458238, PGC rs4711690 and PTPN11 rs12229892 were associated with susceptibilities to GA and/or GC. | 0.009815515 | 2013 | PTPN11 | 12 | 112485589 | G | A |
| rs1229984 | 25524923 | 125 | ADH1B | umls:C0024623 | BeFree | No association was observed between alcohol consumption, ADH1B (rs1229984), ADH1C (rs698) and ALDH2 (rs671) polymorphisms and gastric cancer risk. | 0.003995683 | 2015 | ADH1B | 4 | 99318162 | T | C |
| rs1229984 | 22144473 | 125 | ADH1B | umls:C0024623 | BeFree | A known functional SNP in ADH1B (rs1229984) was associated with alcohol intake (P-value = 0.04) but not GC risk. | 0.003995683 | 2012 | ADH1B | 4 | 99318162 | T | C |
| rs12537 | 22971574 | 8897 | MTMR3 | umls:C0024623 | BeFree | Our study suggested that rs12537 is associated with susceptibility and prognosis of GC in southern Han Chinese, and miR-181a and its target gene MTMR3 play important roles in GC. | 0.000542884 | 2012 | MTMR3;HORMAD2-AS1 | 22 | 30027471 | C | T |
| rs12602885 | 23423739 | 64223 | MLST8 | umls:C0024623 | BeFree | In this study, we examined the associations between eight potential functional single nucleotide polymorphisms in the mTORC1 genes (rs2536T>C and rs1883965G>A for mTOR, rs3160T>C, and rs26865A>G for mLST8, rs3751934C>A, rs1062935T>C, rs3751932T>C, and rs12602885G>A for Raptor, not included in published gastric cancer genome-wide association studies) and gastric cancer risk in 1125 gastric cancer cases and 1196 cancer-free controls. | 0.000271442 | 2013 | RPTOR | 17 | 80545369 | G | A |
| rs12683422 | 25239644 | 1993 | ELAVL2 | umls:C0024623 | BeFree | ASSET analyses identified four SNPs significantly associated with multiple cancers: rs3731239 (CDKN2A intronic) with ESCC, GC and BC (P = 3.96 × 10(-) (4)); rs10811474 (3' of IFNW1) with RCC and BrC (P = 0.001); rs12683422 (LINGO2 intronic) with RCC and BC (P = 5.93 × 10(-) (4)) and rs10511729 (3' of ELAVL2) with LC and BrC (P = 8.63 × 10(-) (4)). | 0.000814326 | 2015 | LINGO2 | 9 | 27969442 | C | T |
| rs12917 | 20817763 | 7517 | XRCC3 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.007448483 | 2010 | MGMT | 10 | 129708019 | C | T |
| rs12917 | 20817763 | 4255 | MGMT | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.006710102 | 2010 | MGMT | 10 | 129708019 | C | T |
| rs12917 | 20817763 | 2067 | ERCC1 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.010434343 | 2010 | MGMT | 10 | 129708019 | C | T |
| rs12917 | 20817763 | 2068 | ERCC2 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.011911105 | 2010 | MGMT | 10 | 129708019 | C | T |
| rs12917 | 20817763 | 4968 | OGG1 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.012529933 | 2010 | MGMT | 10 | 129708019 | C | T |
| rs13181 | 20981556 | 2068 | ERCC2 | umls:C0024623 | BeFree | ERCC2 Lys751Gln and Asp312Asn polymorphisms and gastric cancer risk: a meta-analysis. | 0.011911105 | 2011 | ERCC2;KLC3 | 19 | 45351661 | T | A,G |
| rs13275170 | 23028900 | 1672 | DEFB1 | umls:C0024623 | BeFree | Four SNPS had no heterogeneity across the phases: in the meta-analysis, DEFA6 rs13275170 and DEFB1 rs2738169 had both a 1.3-fold increased odds ratio (OR) for gastric cancer (95% CIs = 1.1-1.6; and 1.1-1.5, respectively). | 0.000271442 | 2012 | NA | 8 | 6922722 | T | C |
| rs13275170 | 23028900 | 1671 | DEFA6 | umls:C0024623 | BeFree | Four SNPS had no heterogeneity across the phases: in the meta-analysis, DEFA6 rs13275170 and DEFB1 rs2738169 had both a 1.3-fold increased odds ratio (OR) for gastric cancer (95% CIs = 1.1-1.6; and 1.1-1.5, respectively). | 0.000271442 | 2012 | NA | 8 | 6922722 | T | C |
| rs13361707 | 22037551 | 26137 | ZBTB20 | umls:C0024623 | BeFree | We identified two new susceptibility loci for non-cardia gastric cancer at 5p13.1 (rs13361707 in the region including PTGER4 and PRKAA1; odds ratio (OR) = 1.41; P = 7.6 × 10(-29)) and 3q13.31 (rs9841504 in ZBTB20; OR = 0.76; P = 1.7 × 10(-9)). | 0.120542884 | 2011 | PRKAA1 | 5 | 40791782 | C | T |
| rs13361707 | 23861218 | 5734 | PTGER4 | umls:C0024623 | BeFree | A recent genome-wide association study (GWAS) identified new susceptibility single-nucleotide polymorphisms (SNPs) rs13361707 (PRKAA1 and PTGER4 gene on 5p13.1) and rs9841504 (ZBTB20 gene on 3q13.31) that were significantly associated with non-cardia gastric cancer. | 0.000542884 | 2013 | PRKAA1 | 5 | 40791782 | C | T |
| rs13361707 | 22037551 | 5734 | PTGER4 | umls:C0024623 | BeFree | We identified two new susceptibility loci for non-cardia gastric cancer at 5p13.1 (rs13361707 in the region including PTGER4 and PRKAA1; odds ratio (OR) = 1.41; P = 7.6 × 10(-29)) and 3q13.31 (rs9841504 in ZBTB20; OR = 0.76; P = 1.7 × 10(-9)). | 0.000542884 | 2011 | PRKAA1 | 5 | 40791782 | C | T |
| rs13361707 | 22037551 | 5562 | PRKAA1 | umls:C0024623 | BeFree | We identified two new susceptibility loci for non-cardia gastric cancer at 5p13.1 (rs13361707 in the region including PTGER4 and PRKAA1; odds ratio (OR) = 1.41; P = 7.6 × 10(-29)) and 3q13.31 (rs9841504 in ZBTB20; OR = 0.76; P = 1.7 × 10(-9)). | 0.121900093 | 2011 | PRKAA1 | 5 | 40791782 | C | T |
| rs13361707 | 22037551 | 5562 | PRKAA1 | umls:C0024623 | GWASCAT | We identified two new susceptibility loci for non-cardia gastric cancer at 5p13.1 (rs13361707 in the region including PTGER4 and PRKAA1; odds ratio (OR) = 1.41; P = 7.6 × 10(-29)) and 3q13.31 (rs9841504 in ZBTB20; OR = 0.76; P = 1.7 × 10(-9)). | 0.121900093 | 2011 | PRKAA1 | 5 | 40791782 | C | T |
| rs13420827 | 24289567 | 1788 | DNMT3A | umls:C0024623 | BeFree | This study revealed that DNMT3a rs1550117 polymorphism is significantly associated with an increased risk of H. pylori infection, but did not support any evidence for contributions of DNMT3a rs1550117 and rs13420827 to either gastric atrophy or gastric cancer. | 0.001357209 | 2015 | NA | 2 | 25231099 | C | G |
| rs137854905 | 24453034 | 3459 | IFNGR1 | umls:C0024623 | BeFree | Association study of SNPs of genes IFNGR1 (rs137854905), GSTT1 (rs71748309), and GSTP1 (rs1695) in gastric cancer development in samples of patient in the northern and northeastern Brazil. | 0.000271442 | 2014 | IFNGR1 | 6 | 137198270 | - | ATTTCTGGAGTGATCACTCTCAGAACA |
| rs137854905 | 24453034 | 2952 | GSTT1 | umls:C0024623 | BeFree | Association study of SNPs of genes IFNGR1 (rs137854905), GSTT1 (rs71748309), and GSTP1 (rs1695) in gastric cancer development in samples of patient in the northern and northeastern Brazil. | 0.034256553 | 2014 | IFNGR1 | 6 | 137198270 | - | ATTTCTGGAGTGATCACTCTCAGAACA |
| rs137854905 | 24453034 | 2950 | GSTP1 | umls:C0024623 | BeFree | Association study of SNPs of genes IFNGR1 (rs137854905), GSTT1 (rs71748309), and GSTP1 (rs1695) in gastric cancer development in samples of patient in the northern and northeastern Brazil. | 0.021455178 | 2014 | IFNGR1 | 6 | 137198270 | - | ATTTCTGGAGTGATCACTCTCAGAACA |
| rs1468063 | 23042672 | 983 | CDK1 | umls:C0024623 | BeFree | CDK1 rs4145643, FAS rs6586161, and FAS rs1468063 in the AKT signaling pathway presented significant genetic effects on gastric cancer (OR = 0.81 (95% CI: 0.66-0.99) for CDK1 rs4145643; OR = 1.27 (95% CI: 1.03-1.58) for FAS rs6586161; OR = 1.29 (95% CI: 1.03-1.56) for FAS rs1468063; Cochran Q statistics > 0.10). | 0.000542884 | 2012 | FAS | 10 | 89015534 | C | T |
| rs1478604 | 22011138 | 7057 | THBS1 | umls:C0024623 | BeFree | Polymorphism of THBS1 rs1478604 A>G in 5-untranslated region is associated with lymph node metastasis of gastric cancer in a Southeast Chinese population. | 0.003257302 | 2012 | THBS1 | 15 | 39581120 | T | C |
| rs148704956 | 24965422 | 3605 | IL17A | umls:C0024623 | BeFree | The present meta-analysis showed the IL- 17A G197A polymorphism is associated with a significantly increased risk for specific forms of cancer, especially in gastric cancer. | 0.008610195 | 2014 | IL17A | 6 | 52187772 | A | G |
| rs148704956 | 25008567 | 3605 | IL17A | umls:C0024623 | BeFree | We firstly show that the polymorphism of IL-17A G197A but not C1249T is a risk factor for gastric cancer. | 0.008610195 | 2014 | IL17A | 6 | 52187772 | A | G |
| rs1550117 | 24289567 | 1788 | DNMT3A | umls:C0024623 | BeFree | This study revealed that DNMT3a rs1550117 polymorphism is significantly associated with an increased risk of H. pylori infection, but did not support any evidence for contributions of DNMT3a rs1550117 and rs13420827 to either gastric atrophy or gastric cancer. | 0.001357209 | 2015 | DNMT3A | 2 | 25343038 | A | G |
| rs160277 | 19655167 | 1462 | VCAN | umls:C0024623 | BeFree | Genetic variants A1826H and D2937Y in GAG-beta domain of versican influence susceptibility to intestinal-type gastric cancer. | 0.000814326 | 2010 | VCAN;LOC105379054 | 5 | 83541812 | G | T,A |
| rs1695 | 24453034 | 3459 | IFNGR1 | umls:C0024623 | BeFree | Association study of SNPs of genes IFNGR1 (rs137854905), GSTT1 (rs71748309), and GSTP1 (rs1695) in gastric cancer development in samples of patient in the northern and northeastern Brazil. | 0.000271442 | 2014 | GSTP1 | 11 | 67585218 | A | G |
| rs1695 | 24453034 | 2950 | GSTP1 | umls:C0024623 | BeFree | Association study of SNPs of genes IFNGR1 (rs137854905), GSTT1 (rs71748309), and GSTP1 (rs1695) in gastric cancer development in samples of patient in the northern and northeastern Brazil. | 0.021455178 | 2014 | GSTP1 | 11 | 67585218 | A | G |
| rs1695 | 23456768 | 2950 | GSTP1 | umls:C0024623 | BeFree | There were many studies investigating the association between GSTP1 gene Ile105Val polymorphism and gastric cancer risk, but studies from East Asians reported inconsistent findings. | 0.021455178 | 2013 | GSTP1 | 11 | 67585218 | A | G |
| rs1695 | 24453034 | 2952 | GSTT1 | umls:C0024623 | BeFree | Association study of SNPs of genes IFNGR1 (rs137854905), GSTT1 (rs71748309), and GSTP1 (rs1695) in gastric cancer development in samples of patient in the northern and northeastern Brazil. | 0.034256553 | 2014 | GSTP1 | 11 | 67585218 | A | G |
| rs1799782 | 25335737 | 7515 | XRCC1 | umls:C0024623 | BeFree | XRCC1 genetic polymorphism Arg339Gln, Arg194Trp, Arg280His and gastric cancer risk: an evidence based decision. | 0.017611384 | 2015 | XRCC1 | 19 | 43553422 | G | A |
| rs1799782 | 19147860 | 7515 | XRCC1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.017611384 | 2009 | XRCC1 | 19 | 43553422 | G | A |
| rs1799782 | 19147860 | 328 | APEX1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.002442977 | 2009 | XRCC1 | 19 | 43553422 | G | A |
| rs1799782 | 22901183 | 7515 | XRCC1 | umls:C0024623 | BeFree | ADPRT Val762Ala and XRCC1 Arg194Trp polymorphisms and risk of gastric cancer in Sichuan of China. | 0.017611384 | 2012 | XRCC1 | 19 | 43553422 | G | A |
| rs1799782 | 19147860 | 4968 | OGG1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.012529933 | 2009 | XRCC1 | 19 | 43553422 | G | A |
| rs1799782 | 22901183 | 142 | PARP1 | umls:C0024623 | BeFree | ADPRT Val762Ala and XRCC1 Arg194Trp polymorphisms and risk of gastric cancer in Sichuan of China. | 0.002714419 | 2012 | XRCC1 | 19 | 43553422 | G | A |
| rs1799793 | 25542228 | 4683 | NBN | umls:C0024623 | BeFree | In conclusion, our results suggest that ERCC1 rs11615, ERCC2 rs1799793, and NBN rs1805794 polymorphisms in the DNA repair pathways may influence the response to chemotherapy and OS of gastric cancer. | 0.002909916 | 2014 | ERCC2 | 19 | 45364001 | C | T |
| rs1799793 | 25542228 | 2067 | ERCC1 | umls:C0024623 | BeFree | By the Cox analysis, the CC genotype of ERCC1 rs11615, AA genotype of ERCC2 rs1799793, and CC genotype of NBN rs1805794 were significantly associated with a longer overall survival (OS) of gastric cancer. | 0.010434343 | 2014 | ERCC2 | 19 | 45364001 | C | T |
| rs1799793 | 20981556 | 2068 | ERCC2 | umls:C0024623 | BeFree | ERCC2 Lys751Gln and Asp312Asn polymorphisms and gastric cancer risk: a meta-analysis. | 0.011911105 | 2011 | ERCC2 | 19 | 45364001 | C | T |
| rs1799793 | 25542228 | 2068 | ERCC2 | umls:C0024623 | BeFree | In conclusion, our results suggest that ERCC1 rs11615, ERCC2 rs1799793, and NBN rs1805794 polymorphisms in the DNA repair pathways may influence the response to chemotherapy and OS of gastric cancer. | 0.011911105 | 2014 | ERCC2 | 19 | 45364001 | C | T |
| rs1799794 | 21347786 | 7517 | XRCC3 | umls:C0024623 | BeFree | In R0 resected patients, XRCC3 variants (rs861539, P = 0.04; rs861530, P = 0.02) in esophageal cancer, and XRCC3 (rs1799794, P = 0.02) and MTHFR (rs1801131, P = 0.005) in gastric cancer predicted survival. | 0.007448483 | 2011 | XRCC3 | 14 | 103712930 | T | C |
| rs1800566 | 24716985 | 1429 | CRYZ | umls:C0024623 | BeFree | quinone oxidoreductase 1 (NQO1) gene C609T polymorphism (rs1800566) and gastric cancer has been widely evaluated, but a definitive answer is so far lacking. | 0.000542884 | 2014 | NQO1 | 16 | 69711242 | G | A |
| rs1800629 | 24142527 | 7124 | TNF | umls:C0024623 | BeFree | Association between tumor necrosis factor-α rs1800629 polymorphism and risk of gastric cancer: a meta-analysis. | 0.033865559 | 2013 | TNF | 6 | 31575254 | G | A |
| rs1800795 | 23893709 | 3569 | IL6 | umls:C0024623 | BeFree | The interleukin 6 -174 G/C (rs1800795) gene polymorphisms was analyzed in gastric cancer, peptic ulcer, and nonulcer dyspepsia patients and in healthy control subjects and the data were correlated with the histopathological features of the patients' biopsies. | 0.013496149 | 2013 | IL6;LOC541472 | 7 | 22727026 | C | G |
| rs1801131 | 21347786 | 7517 | XRCC3 | umls:C0024623 | BeFree | In R0 resected patients, XRCC3 variants (rs861539, P = 0.04; rs861530, P = 0.02) in esophageal cancer, and XRCC3 (rs1799794, P = 0.02) and MTHFR (rs1801131, P = 0.005) in gastric cancer predicted survival. | 0.007448483 | 2011 | MTHFR | 1 | 11794419 | T | G |
| rs1801131 | 21347786 | 4524 | MTHFR | umls:C0024623 | BeFree | Cox regression revealed ypT category (P = 0.001) and lymphatic vessel invasion (P = 0.03) to be independent prognostic factors for esophageal cancer, and histopathological response (P = 0.01), MTHFR variant (rs1801131, P = 0.002), and ypN category (P = 0.02) to be prognostic factors for gastric cancer. | 0.036428088 | 2011 | MTHFR | 1 | 11794419 | T | G |
| rs1801133 | 25337902 | 4524 | MTHFR | umls:C0024623 | BeFree | After shrinkage and adjusting for potential confounding factors, we found positive associations between MTHFR rs1801133 and stomach cancer (any T versus C/C, SB odds-ratio [SBOR]: 1.79, 95% posterior limits: 1.18, 2.71) and liver cancer (SBOR: 1.51, 95% posterior limits: 0.98, 2.32). | 0.036428088 | 2014 | MTHFR | 1 | 11796321 | G | A |
| rs1801200 | 21649724 | 5743 | PTGS2 | umls:C0024623 | BeFree | In the Chinese subgroup, nominally significant associations were shown between (i) EBBR2+1963G (rs1801200) and H. pylori infection (per-allele OR: 0.48, 95% CI 0.23, 0.98, P = 0.04), (ii) PTGS2-1195G (rs689466) and an increased risk of GC on adjusting for H. pylori status (OR: 1.53, 95% CI 0.99, 2.37, P = 0.05), and (iii) IL1B-1473C (rs1143623) and a decreased risk of GC (OR: 0.64, 95% CI 0.41, 0.99, P = 0.05). | 0.036959702 | 2011 | NA | NA | NA | NA | NA |
| rs1801200 | 21649724 | 3553 | IL1B | umls:C0024623 | BeFree | In the Chinese subgroup, nominally significant associations were shown between (i) EBBR2+1963G (rs1801200) and H. pylori infection (per-allele OR: 0.48, 95% CI 0.23, 0.98, P = 0.04), (ii) PTGS2-1195G (rs689466) and an increased risk of GC on adjusting for H. pylori status (OR: 1.53, 95% CI 0.99, 2.37, P = 0.05), and (iii) IL1B-1473C (rs1143623) and a decreased risk of GC (OR: 0.64, 95% CI 0.41, 0.99, P = 0.05). | 0.064669312 | 2011 | NA | NA | NA | NA | NA |
| rs1801201 | 23844533 | 2064 | ERBB2 | umls:C0024623 | BeFree | Analysis of the polymorphisms EGFR-r521K and ERBB2-I655V in Mexican patients with gastric cancer and premalignant gastric lesions. | 0.070151555 | 2013 | ERBB2 | 17 | 39723332 | A | C,G |
| rs1801201 | 23844533 | 1956 | EGFR | umls:C0024623 | BeFree | Our data suggest that the EGFR-R521K and ERBB2-I655V polymorphisms are not suitable as markers for identifying individuals with a higher risk for developing gastric cancer in our population. | 0.03009771 | 2013 | ERBB2 | 17 | 39723332 | A | C,G |
| rs1801274 | 21780194 | 3566 | IL4R | umls:C0024623 | BeFree | Interleukin-4 receptor (IL-4R) variant rs2107356 presented negative correlations to E-selectin variant rs5361 and FCGR2A variant rs1801274 (P = 0.035 and P = 0.023) in conferring susceptibility to gastric cancer. | 0.002909916 | 2012 | FCGR2A | 1 | 161509955 | A | G |
| rs1801274 | 21780194 | 2212 | FCGR2A | umls:C0024623 | BeFree | E-selectin rs5361 and FCGR2A rs1801274 variants were associated with increased risk of gastric cancer in a Chinese population. | 0.002638474 | 2012 | FCGR2A | 1 | 161509955 | A | G |
| rs1801274 | 21780194 | 6401 | SELE | umls:C0024623 | BeFree | E-selectin rs5361 and FCGR2A rs1801274 variants were associated with increased risk of gastric cancer in a Chinese population. | 0.001900093 | 2012 | FCGR2A | 1 | 161509955 | A | G |
| rs1801282 | 18372284 | 5468 | PPARG | umls:C0024623 | BeFree | We investigated the association of Pro12Ala PPARgamma polymorphism and Helicobacter pylori infection with gastric cancer and peptic ulcer disease (PUD). | 0.004071628 | 2008 | PPARG | 3 | 12351626 | C | G |
| rs1801282 | 17763950 | 5468 | PPARG | umls:C0024623 | BeFree | Our study suggests that the PPARgamma Pro12Ala polymorphism may be a shared risk marker of both IFG and gastric cancer in Japanese. | 0.004071628 | 2008 | PPARG | 3 | 12351626 | C | G |
| rs1801282 | 25824760 | 5468 | PPARG | umls:C0024623 | BeFree | Peroxisome proliferator-activated receptor-gamma Pro12Ala polymorphism could be a risk factor for gastric cancer. | 0.004071628 | 2016 | PPARG | 3 | 12351626 | C | G |
| rs1801394 | 25337902 | 4552 | MTRR | umls:C0024623 | BeFree | In addition, we detected potential heterogeneity across alcohol drinking status for ORs relating MTRR rs1801394 to esophageal (posterior homogeneity P = 0.005) and stomach cancer (posterior homogeneity P = 0.004), and ORs relating MTR rs1805087 to liver cancer (posterior homogeneity P = 0.021). | 0.003181358 | 2014 | MTRR;FASTKD3 | 5 | 7870860 | A | G |
| rs1801394 | 25337902 | 4548 | MTR | umls:C0024623 | BeFree | In addition, we detected potential heterogeneity across alcohol drinking status for ORs relating MTRR rs1801394 to esophageal (posterior homogeneity P = 0.005) and stomach cancer (posterior homogeneity P = 0.004), and ORs relating MTR rs1805087 to liver cancer (posterior homogeneity P = 0.021). | 0.002909916 | 2014 | MTRR;FASTKD3 | 5 | 7870860 | A | G |
| rs1803245 | 25310523 | 6275 | S100A4 | umls:C0024623 | BeFree | The S100A4 D10V polymorphism is related to cell migration ability but not drug resistance in gastric cancer cells. | 0.003800186 | 2014 | S100A4;LOC101928034 | 1 | 153544766 | T | A |
| rs1805087 | 25337902 | 4548 | MTR | umls:C0024623 | BeFree | In addition, we detected potential heterogeneity across alcohol drinking status for ORs relating MTRR rs1801394 to esophageal (posterior homogeneity P = 0.005) and stomach cancer (posterior homogeneity P = 0.004), and ORs relating MTR rs1805087 to liver cancer (posterior homogeneity P = 0.021). | 0.002909916 | 2014 | MTR | 1 | 236885200 | A | G |
| rs1805087 | 25337902 | 4552 | MTRR | umls:C0024623 | BeFree | In addition, we detected potential heterogeneity across alcohol drinking status for ORs relating MTRR rs1801394 to esophageal (posterior homogeneity P = 0.005) and stomach cancer (posterior homogeneity P = 0.004), and ORs relating MTR rs1805087 to liver cancer (posterior homogeneity P = 0.021). | 0.003181358 | 2014 | MTR | 1 | 236885200 | A | G |
| rs1805192 | 25824760 | 5468 | PPARG | umls:C0024623 | BeFree | Peroxisome proliferator-activated receptor-gamma Pro12Ala polymorphism could be a risk factor for gastric cancer. | 0.004071628 | 2016 | PPARG | 3 | 12379739 | C | G |
| rs1805192 | 17763950 | 5468 | PPARG | umls:C0024623 | BeFree | Our study suggests that the PPARgamma Pro12Ala polymorphism may be a shared risk marker of both IFG and gastric cancer in Japanese. | 0.004071628 | 2008 | PPARG | 3 | 12379739 | C | G |
| rs1805192 | 18372284 | 5468 | PPARG | umls:C0024623 | BeFree | We investigated the association of Pro12Ala PPARgamma polymorphism and Helicobacter pylori infection with gastric cancer and peptic ulcer disease (PUD). | 0.004071628 | 2008 | PPARG | 3 | 12379739 | C | G |
| rs1805794 | 25542228 | 2067 | ERCC1 | umls:C0024623 | BeFree | By the Cox analysis, the CC genotype of ERCC1 rs11615, AA genotype of ERCC2 rs1799793, and CC genotype of NBN rs1805794 were significantly associated with a longer overall survival (OS) of gastric cancer. | 0.010434343 | 2014 | NBN | 8 | 89978251 | C | G |
| rs1805794 | 25542228 | 4683 | NBN | umls:C0024623 | BeFree | In conclusion, our results suggest that ERCC1 rs11615, ERCC2 rs1799793, and NBN rs1805794 polymorphisms in the DNA repair pathways may influence the response to chemotherapy and OS of gastric cancer. | 0.002909916 | 2014 | NBN | 8 | 89978251 | C | G |
| rs1805794 | 25542228 | 2068 | ERCC2 | umls:C0024623 | BeFree | In conclusion, our results suggest that ERCC1 rs11615, ERCC2 rs1799793, and NBN rs1805794 polymorphisms in the DNA repair pathways may influence the response to chemotherapy and OS of gastric cancer. | 0.011911105 | 2014 | NBN | 8 | 89978251 | C | G |
| rs1883965 | 23423739 | 64223 | MLST8 | umls:C0024623 | BeFree | In this study, we examined the associations between eight potential functional single nucleotide polymorphisms in the mTORC1 genes (rs2536T>C and rs1883965G>A for mTOR, rs3160T>C, and rs26865A>G for mLST8, rs3751934C>A, rs1062935T>C, rs3751932T>C, and rs12602885G>A for Raptor, not included in published gastric cancer genome-wide association studies) and gastric cancer risk in 1125 gastric cancer cases and 1196 cancer-free controls. | 0.000271442 | 2013 | MTOR | 1 | 11262099 | A | G |
| rs1917799 | 24586594 | 406881 | MIRLET7A1 | umls:C0024623 | BeFree | An interaction effect of pri-let-7a-1 rs10739971 polymorphism with ERCC6 rs1917799 polymorphism was observed for the risk of gastric cancer (P interaction = 0.026); and interaction effects of pri-let-7a-1 rs10739971 polymorphism with PGC rs6458238 polymorphism (P interaction = 0.012) and PGC rs9471643 polymorphism (P interaction = 0.039) were observed for the risk of atrophic gastritis. | 0.000271442 | 2014 | NA | 10 | 49542929 | A | C |
| rs1917799 | 24289633 | 2074 | ERCC6 | umls:C0024623 | BeFree | The DNA repair gene ERCC6 rs1917799 polymorphism is associated with gastric cancer risk in Chinese. | 0.000542884 | 2014 | NA | 10 | 49542929 | A | C |
| rs2010963 | 22292637 | 7422 | VEGFA | umls:C0024623 | BeFree | VEGFA+936C/T and -634G/C polymorphisms and gastric cancer risk: a meta-analysis. | 0.028620949 | 2011 | VEGFA | 6 | 43770613 | C | G |
| rs2031920 | 26373042 | 4193 | MDM2 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.007795869 | 2015 | CYP2E1 | 10 | 133526341 | C | T |
| rs2031920 | 26373042 | 328 | APEX1 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.002442977 | 2015 | CYP2E1 | 10 | 133526341 | C | T |
| rs2031920 | 26373042 | 1571 | CYP2E1 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.019359587 | 2015 | CYP2E1 | 10 | 133526341 | C | T |
| rs2031920 | 26373042 | 9360 | PPIG | umls:C0024623 | BeFree | Risk analysis revealed that there was increased risk for gastric cancer in subjects with mutant alleles in APE 1 (rs2275008: OR 5.49, 95% CI = 2.6-5.7, p <.0001), NEIL 2 (rs804270: OR 2.3, 95% CI = 1.22-4.3, p=0.01), MDM2 (rs2279744: OR 14.65, 95% CI = 5.63-8.15, p < .0001), and CYP 2E1 (rs2031920: OR 8.385, 95% CI = 3.2-5.3, p < .0001) SNPs. | 0.000814326 | 2015 | CYP2E1 | 10 | 133526341 | C | T |
| rs2031920 | 26373042 | 252969 | NEIL2 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.000542884 | 2015 | CYP2E1 | 10 | 133526341 | C | T |
| rs2071504 | 22350505 | 5430 | POLR2A | umls:C0024623 | BeFree | Our findings provided evidence that the SNP rs2071504 in the exon of POLR2A gene would not only confer a decreased risk of gastric cancer, but also influence lymph node metastasis and TMN stage of gastric cancer in the Chinese population. | 0.000271442 | 2012 | POLR2A | 17 | 7502618 | C | T |
| rs2107356 | 21780194 | 3566 | IL4R | umls:C0024623 | BeFree | Interleukin-4 receptor (IL-4R) variant rs2107356 presented negative correlations to E-selectin variant rs5361 and FCGR2A variant rs1801274 (P = 0.035 and P = 0.023) in conferring susceptibility to gastric cancer. | 0.002909916 | 2012 | IL4R | 16 | 27312083 | C | T |
| rs213045 | 17977716 | 1889 | ECE1 | umls:C0024623 | BeFree | Our results suggest that the ECE-1b C-338A polymorphism may be associated with increased risk of gastric cancer. | 0.000271442 | 2008 | ECE1 | 1 | 21290752 | G | T |
| rs2227983 | 23844533 | 1956 | EGFR | umls:C0024623 | BeFree | Our data suggest that the EGFR-R521K and ERBB2-I655V polymorphisms are not suitable as markers for identifying individuals with a higher risk for developing gastric cancer in our population. | 0.03009771 | 2013 | EGFR | 7 | 55161562 | G | A,C,T |
| rs2234922 | 23580125 | 2052 | EPHX1 | umls:C0024623 | BeFree | Association of microsomal epoxide hydrolase exon 3 Tyr113His and exon 4 His139Arg polymorphisms with gastric cancer in India. | 0.002909916 | 2013 | EPHX1 | 1 | 225838705 | A | G,T |
| rs2274223 | 23826241 | 51196 | PLCE1 | umls:C0024623 | BeFree | In this meta-analysis, the PLCE1 rs2274223 polymorphism was confirmed to have a statistically significant association with an increasing risk of ESCC and gastric cancer. | 0.124071628 | 2013 | PLCE1 | 10 | 94306584 | A | G |
| rs2274223 | 24254309 | 4582 | MUC1 | umls:C0024623 | BeFree | The aim of this study was to determine whether rs4072037A > G in MUC1 at 1q22 and rs2274223A > G in PLCE1 at 10q23 are associated with a risk of gastric cancer in a Korean population. | 0.129500466 | 2013 | PLCE1 | 10 | 94306584 | A | G |
| rs2274223 | 24254309 | 51196 | PLCE1 | umls:C0024623 | BeFree | The aim of this study was to determine whether rs4072037A > G in MUC1 at 1q22 and rs2274223A > G in PLCE1 at 10q23 are associated with a risk of gastric cancer in a Korean population. | 0.124071628 | 2013 | PLCE1 | 10 | 94306584 | A | G |
| rs2274223 | 23797815 | 51196 | PLCE1 | umls:C0024623 | BeFree | Recently, a single nucleotide polymorphism (rs2274223 A>G) in PLCE1 was reported as a novel susceptibility locus for esophageal and gastric cancers by genome-wide association studies performed in Chinese population. | 0.124071628 | 2013 | PLCE1 | 10 | 94306584 | A | G |
| rs2274223 | 20729852 | 51196 | PLCE1 | umls:C0024623 | BeFree | A notable signal was rs2274223, a nonsynonymous SNP located in PLCE1, for gastric cancer (P = 8.40 x 10(-9); per-allele odds ratio (OR) = 1.31) and ESCC (P = 3.85 x 10(-9); OR = 1.34). | 0.124071628 | 2010 | PLCE1 | 10 | 94306584 | A | G |
| rs2275008 | 26373042 | 1571 | CYP2E1 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.019359587 | 2015 | OSGEP | 14 | 20448090 | T | C |
| rs2275008 | 26373042 | 9360 | PPIG | umls:C0024623 | BeFree | Risk analysis revealed that there was increased risk for gastric cancer in subjects with mutant alleles in APE 1 (rs2275008: OR 5.49, 95% CI = 2.6-5.7, p <.0001), NEIL 2 (rs804270: OR 2.3, 95% CI = 1.22-4.3, p=0.01), MDM2 (rs2279744: OR 14.65, 95% CI = 5.63-8.15, p < .0001), and CYP 2E1 (rs2031920: OR 8.385, 95% CI = 3.2-5.3, p < .0001) SNPs. | 0.000814326 | 2015 | OSGEP | 14 | 20448090 | T | C |
| rs2275008 | 26373042 | 252969 | NEIL2 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.000542884 | 2015 | OSGEP | 14 | 20448090 | T | C |
| rs2275008 | 26373042 | 328 | APEX1 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.002442977 | 2015 | OSGEP | 14 | 20448090 | T | C |
| rs2275008 | 26373042 | 4193 | MDM2 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.007795869 | 2015 | OSGEP | 14 | 20448090 | T | C |
| rs2275913 | 19414056 | 3605 | IL17A | umls:C0024623 | BeFree | We concluded that G-197A polymorphism of IL-17A gene was significantly associated with the development of gastric cancer, especially intestinal-type cancer. | 0.008610195 | 2009 | IL17A | 6 | 52186235 | G | A |
| rs2276331 | 23431106 | 999 | CDH1 | umls:C0024623 | BeFree | Four novel CDH1 sequence alterations were identified in GC patients including a G>T transition 49 bp before the start codon; a three-nucleotide deletion, c.44_46del TGC; one missense mutation, c.604G>A (V202I); and one variation in the intron, c.1320+7A>G. In addition, polymorphism frequencies were observed for CDH1-164delT, -161C>A, -73A>C, c.48+6C>T, c.48+62_48+63delinsCGTGCCCCAGCCC, c.894C>T (A298A), c.1224G>A (A408A), c.1888C>G (L630V), c.2076T>C (A692A), and c.2253C>T (N751N) which is similar to the data reported in http://www.ncbi.nlm.nih.gov/projects/SNP/. | 0.055189915 | 2012 | CDH1 | 16 | 68822177 | C | G |
| rs2279115 | 26554163 | 51196 | PLCE1 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.124071628 | 2016 | BCL2 | 18 | 63319604 | G | T |
| rs2279115 | 26554163 | 8000 | PSCA | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.009771907 | 2016 | BCL2 | 18 | 63319604 | G | T |
| rs2279115 | 26554163 | 596 | BCL2 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.015200745 | 2016 | BCL2 | 18 | 63319604 | G | T |
| rs2279115 | 26554163 | 252969 | NEIL2 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.000542884 | 2016 | BCL2 | 18 | 63319604 | G | T |
| rs2279744 | 26373042 | 252969 | NEIL2 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.000542884 | 2015 | MDM2 | 12 | 68808800 | T | G |
| rs2279744 | 26373042 | 328 | APEX1 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.002442977 | 2015 | MDM2 | 12 | 68808800 | T | G |
| rs2279744 | 26373042 | 1571 | CYP2E1 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.019359587 | 2015 | MDM2 | 12 | 68808800 | T | G |
| rs2279744 | 26373042 | 9360 | PPIG | umls:C0024623 | BeFree | Risk analysis revealed that there was increased risk for gastric cancer in subjects with mutant alleles in APE 1 (rs2275008: OR 5.49, 95% CI = 2.6-5.7, p <.0001), NEIL 2 (rs804270: OR 2.3, 95% CI = 1.22-4.3, p=0.01), MDM2 (rs2279744: OR 14.65, 95% CI = 5.63-8.15, p < .0001), and CYP 2E1 (rs2031920: OR 8.385, 95% CI = 3.2-5.3, p < .0001) SNPs. | 0.000814326 | 2015 | MDM2 | 12 | 68808800 | T | G |
| rs2279744 | 23451111 | 4193 | MDM2 | umls:C0024623 | BeFree | MDM2 SNP309 rs2279744 polymorphism and gastric cancer risk: a meta-analysis. | 0.007795869 | 2013 | MDM2 | 12 | 68808800 | T | G |
| rs2279744 | 26373042 | 4193 | MDM2 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.007795869 | 2015 | MDM2 | 12 | 68808800 | T | G |
| rs2292832 | 24379078 | 406938 | MIR146A | umls:C0024623 | BeFree | The aim of the study was to investigated whether three common miRNA polymorphisms [miR-146a C>G (rs2910164), miR-149 T>C (rs2292832), and miR-196a2 T>C (rs11614913)] are associated with the susceptibility and prognosis of gastric cancer (GC) in the Greek population. | 0.005157396 | 2013 | GPC1;MIR149;PP14571 | 2 | 240456086 | T | C |
| rs2292832 | 25795117 | 406941 | MIR149 | umls:C0024623 | BeFree | In summary, miR-27a rs895819 and miR-149 rs2292832 are of potential forewarning ability for gastric cancer risk. | 0.001085767 | 2014 | GPC1;MIR149;PP14571 | 2 | 240456086 | T | C |
| rs2292832 | 24379078 | 406941 | MIR149 | umls:C0024623 | BeFree | We found that the risk for GC was significantly higher for the carriers of miR-149 rs2292832CC (p = 0.009) and miR-196a2 rs11614913CC (p < 0.0001) genotypes, as well as for the carriers of the rs2910164/rs2292832/rs11614913 CCC and GTC haplotype (p < 0.0001 and p = 0.03, respectively). | 0.001085767 | 2013 | GPC1;MIR149;PP14571 | 2 | 240456086 | T | C |
| rs2294008 | 25582162 | 8000 | PSCA | umls:C0024623 | BeFree | The PSCA rs2294008 C>T polymorphism may be acting through induction of gastric mucosal atrophy, finally leading to development of gastric ulcer and gastric cancer in PSCA rs2294008 T allele carriers, but not duodenal ulcer. | 0.009771907 | 2015 | PSCA | 8 | 142680513 | C | T |
| rs2294008 | 26554163 | 51196 | PLCE1 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.124071628 | 2016 | PSCA | 8 | 142680513 | C | T |
| rs2294008 | 24023815 | 8000 | PSCA | umls:C0024623 | BeFree | We analyzed 3 SNPs in the PSCA gene (rs2294008, rs9297976 and rs12155758) which were previously found to be associated with GC risk in Europeans. | 0.009771907 | 2013 | PSCA | 8 | 142680513 | C | T |
| rs2294008 | 20083643 | 8000 | PSCA | umls:C0024623 | BeFree | Recently, two genome-wide association studies identified a significant association between the prostate stem cell antigen (PSCA) rs2294008 (C>T) polymorphism and risk of diffuse-type of gastric cancer in Asians and bladder cancer in Caucasians, respectively. | 0.009771907 | 2010 | PSCA | 8 | 142680513 | C | T |
| rs2294008 | 21268123 | 8000 | PSCA | umls:C0024623 | BeFree | Polymorphisms in prostate stem cell antigen gene rs2294008 increase gastric cancer risk in Chinese. | 0.009771907 | 2011 | PSCA | 8 | 142680513 | C | T |
| rs2294008 | 24962126 | 8000 | PSCA | umls:C0024623 | BeFree | The variant C allele of the reference SNP rs2294008 in the PSCA gene was associated with a significantly reduced risk of GC (per allele-adjusted odds ratio [aOR], 0.51; 95% confidence interval [CI], 0.33-0.77; P = .002). | 0.009771907 | 2014 | PSCA | 8 | 142680513 | C | T |
| rs2294008 | 26554163 | 596 | BCL2 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.015200745 | 2016 | PSCA | 8 | 142680513 | C | T |
| rs2294008 | 26554163 | 8000 | PSCA | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.009771907 | 2016 | PSCA | 8 | 142680513 | C | T |
| rs2294008 | 26554163 | 252969 | NEIL2 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.000542884 | 2016 | PSCA | 8 | 142680513 | C | T |
| rs2294008 | 22155405 | 84668 | FAM126A | umls:C0024623 | BeFree | The results of subgroup analyses (according to histopathology, countries and sources of controls) indicated that T allele of rs2294008C>T and A allele rs2976392G>A were associated with increased risk of both intestinal- and diffuse-type GC, and associated with increased risk of GC for Chinese, Japanese, Koreans, PCC and HCC/PHCC. | 0.001628651 | 2012 | PSCA | 8 | 142680513 | C | T |
| rs2294008 | 22938475 | 8000 | PSCA | umls:C0024623 | BeFree | Association of the PSCA rs2294008 C>T polymorphism with gastric cancer risk: evidence from a meta-analysis. | 0.009771907 | 2012 | PSCA | 8 | 142680513 | C | T |
| rs2294008 | 21070776 | 8000 | PSCA | umls:C0024623 | BeFree | The rs2294008 polymorphism in PSCA increases the risk of noncardia gastric cancer and its precursors in white individuals but protects against proximal cancers. | 0.009771907 | 2011 | PSCA | 8 | 142680513 | C | T |
| rs2294008 | 21681742 | 8000 | PSCA | umls:C0024623 | BeFree | A genome-wide study performed in a Japanese population identified a strong association between SNP rs2294008 (Met1Thr) in the Prostate Stem Cell Antigen gene (PSCA) and diffuse-type gastric cancer (GC). | 0.009771907 | 2012 | PSCA | 8 | 142680513 | C | T |
| rs2294008 | 24654646 | 8000 | PSCA | umls:C0024623 | BeFree | We found that the T allele of rs2294008, an intronic variant of the PSCA gene at 8q24 that was previously associated with an increased risk of gastric cancer, was inversely associated with a decreased risk of ESCC (odds ratio = 0.90; 95% confidence interval, 0.81-0.99; P = 0.034). | 0.009771907 | 2014 | PSCA | 8 | 142680513 | C | T |
| rs2294008 | 22387998 | 8000 | PSCA | umls:C0024623 | BeFree | The C allele of rs2294008 at PSCA was associated with increased risk of duodenal ulcer (odds ratio (OR) = 1.84; P = 3.92 × 10(-33)) in a recessive model but was associated with decreased risk of gastric cancer (OR = 0.79; P = 6.79 × 10(-12)), as reported previously. | 0.009771907 | 2012 | PSCA | 8 | 142680513 | C | T |
| rs2294008 | 25721731 | 8000 | PSCA | umls:C0024623 | BeFree | Association of PSCA rs2294008 gene variants with poor prognosis and increased susceptibility to gastric cancer and decreased risk of duodenal ulcer disease. | 0.009771907 | 2015 | PSCA | 8 | 142680513 | C | T |
| rs2295080 | 23555892 | 2475 | MTOR | umls:C0024623 | BeFree | A polymorphism (rs2295080) in mTOR promoter region and its association with gastric cancer in a Chinese population. | 0.002171535 | 2013 | MTOR | 1 | 11262571 | G | T |
| rs2301756 | 19589142 | 52 | ACP1 | umls:C0024623 | BeFree | This study aimed to examine the formerly reported association of G/A PTPN11 (protein-tyrosine phosphatase, nonreceptor-type 11) polymorphism (rs2301756) with gastric atrophy, as well as the association with gastric cancer in a Japanese population using a large sample size. | 0.001900093 | 2009 | PTPN11 | 12 | 112452972 | A | G |
| rs243865 | 21612407 | 4313 | MMP2 | umls:C0024623 | BeFree | Epistasis between PARP1 rs1136410 and MMP2 rs243865 increased the risk of LNM of GC. | 0.013420204 | 2011 | MMP2 | 16 | 55477894 | C | T |
| rs2536 | 23423739 | 64223 | MLST8 | umls:C0024623 | BeFree | In this study, we examined the associations between eight potential functional single nucleotide polymorphisms in the mTORC1 genes (rs2536T>C and rs1883965G>A for mTOR, rs3160T>C, and rs26865A>G for mLST8, rs3751934C>A, rs1062935T>C, rs3751932T>C, and rs12602885G>A for Raptor, not included in published gastric cancer genome-wide association studies) and gastric cancer risk in 1125 gastric cancer cases and 1196 cancer-free controls. | 0.000271442 | 2013 | MTOR | 1 | 11106656 | T | C |
| rs25487 | 24590266 | 7515 | XRCC1 | umls:C0024623 | BeFree | Results from the current meta-analysis indicate that XRCC1 Arg399Gln polymorphism may be associated with poor clinical outcomes in GC patients treated with oxaliplatin-based chemotherapy. | 0.017611384 | 2014 | XRCC1 | 19 | 43551574 | T | C |
| rs25487 | 19147860 | 328 | APEX1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.002442977 | 2009 | XRCC1 | 19 | 43551574 | T | C |
| rs25487 | 19147860 | 7515 | XRCC1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.017611384 | 2009 | XRCC1 | 19 | 43551574 | T | C |
| rs25487 | 15533591 | 7515 | XRCC1 | umls:C0024623 | BeFree | However, carrying at least one copy of the variant allele in XRCC1 Arg399Gln (codon 399 arganine to glutamine substitution) was associated with reduced risk of gastric cardia cancer (RR: 0.60, 95% CI: 0.37-0.97) and the combined category esophageal/gastric cancer (RR: 0.67, 95% CI: 0.48-0.95). | 0.017611384 | 2004 | XRCC1 | 19 | 43551574 | T | C |
| rs25487 | 23212324 | 7515 | XRCC1 | umls:C0024623 | BeFree | Lack of an association between the XRCC1 Arg399Gln polymorphism and gastric cancer based on a meta-analysis. | 0.017611384 | 2012 | XRCC1 | 19 | 43551574 | T | C |
| rs25487 | 19034980 | 7515 | XRCC1 | umls:C0024623 | BeFree | XRCC1 genetic polymorphism Arg399Gln and gastric cancer risk: A meta-analysis. | 0.017611384 | 2008 | XRCC1 | 19 | 43551574 | T | C |
| rs25487 | 19147860 | 4968 | OGG1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.012529933 | 2009 | XRCC1 | 19 | 43551574 | T | C |
| rs25489 | 25335737 | 7515 | XRCC1 | umls:C0024623 | BeFree | XRCC1 genetic polymorphism Arg339Gln, Arg194Trp, Arg280His and gastric cancer risk: an evidence based decision. | 0.017611384 | 2015 | XRCC1 | 19 | 43552260 | C | T,G |
| rs2569190 | 24978812 | 929 | CD14 | umls:C0024623 | BeFree | This meta-analysis suggests that the CD14 -260C/T polymorphism may increase the risk of gastric cancer in H. pylori-infected individuals. | 0.004810009 | 2014 | CD14;TMCO6 | 5 | 140633331 | A | G |
| rs2569190 | 23565226 | 4695 | NDUFA2 | umls:C0024623 | BeFree | TLR4 rs11536889 and CD14 -260 C/T are associated with non-cardia GC in Chinese. | 0.002171535 | 2013 | CD14;TMCO6 | 5 | 140633331 | A | G |
| rs26865 | 23423739 | 64223 | MLST8 | umls:C0024623 | BeFree | In this study, we examined the associations between eight potential functional single nucleotide polymorphisms in the mTORC1 genes (rs2536T>C and rs1883965G>A for mTOR, rs3160T>C, and rs26865A>G for mLST8, rs3751934C>A, rs1062935T>C, rs3751932T>C, and rs12602885G>A for Raptor, not included in published gastric cancer genome-wide association studies) and gastric cancer risk in 1125 gastric cancer cases and 1196 cancer-free controls. | 0.000271442 | 2013 | MLST8 | 16 | 2203772 | A | G |
| rs2738169 | 23028900 | 1671 | DEFA6 | umls:C0024623 | BeFree | Four SNPS had no heterogeneity across the phases: in the meta-analysis, DEFA6 rs13275170 and DEFB1 rs2738169 had both a 1.3-fold increased odds ratio (OR) for gastric cancer (95% CIs = 1.1-1.6; and 1.1-1.5, respectively). | 0.000271442 | 2012 | NA | 8 | 6885036 | G | A |
| rs2738169 | 23028900 | 1672 | DEFB1 | umls:C0024623 | BeFree | Four SNPS had no heterogeneity across the phases: in the meta-analysis, DEFA6 rs13275170 and DEFB1 rs2738169 had both a 1.3-fold increased odds ratio (OR) for gastric cancer (95% CIs = 1.1-1.6; and 1.1-1.5, respectively). | 0.000271442 | 2012 | NA | 8 | 6885036 | G | A |
| rs2910164 | 25202115 | 574501 | MIR499A | umls:C0024623 | BeFree | We evaluated the associations of three selected SNPs (rs11614913, rs2910164, and rs3746444) in pre-miRNAs (hsa-mir-196a2, hsa-mir-146a and hsa-mir-499) with the prognosis of advanced gastric cancers (GCs) treated by chemotherapy. | 0.001085767 | 2014 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 24379078 | 406938 | MIR146A | umls:C0024623 | BeFree | The aim of the study was to investigated whether three common miRNA polymorphisms [miR-146a C>G (rs2910164), miR-149 T>C (rs2292832), and miR-196a2 T>C (rs11614913)] are associated with the susceptibility and prognosis of gastric cancer (GC) in the Greek population. | 0.005157396 | 2013 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 25455160 | 406938 | MIR146A | umls:C0024623 | BeFree | The association between miR-146a gene rs2910164 polymorphism and gastric cancer risk: a meta-analysis. | 0.005157396 | 2014 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 25386093 | 406938 | MIR146A | umls:C0024623 | BeFree | MiR-146a rs2910164 polymorphism increases risk of gastric cancer: a meta-analysis. | 0.005157396 | 2014 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 25795117 | 406938 | MIR146A | umls:C0024623 | BeFree | In the stratified analysis, in some subgroup, heterozygous miR-146a rs2910164 was associated with a decreased risk of gastric cancer; and the variant genotype of miR-196a-2 rs11614913 was associated with an increased risk. | 0.005157396 | 2014 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 25326754 | 406938 | MIR146A | umls:C0024623 | BeFree | MiR-146a rs2910164 G/C polymorphism and gastric cancer susceptibility: a meta-analysis. | 0.005157396 | 2014 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 24379078 | 406941 | MIR149 | umls:C0024623 | BeFree | We found that the risk for GC was significantly higher for the carriers of miR-149 rs2292832CC (p = 0.009) and miR-196a2 rs11614913CC (p < 0.0001) genotypes, as well as for the carriers of the rs2910164/rs2292832/rs11614913 CCC and GTC haplotype (p < 0.0001 and p = 0.03, respectively). | 0.001085767 | 2013 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 20721625 | 7099 | TLR4 | umls:C0024623 | BeFree | This study aimed to examine the associations of the miR-146a G/C (rs2910164) and TLR4 +3725 G/C (rs11536889) polymorphisms with the risk of Helicobacter pylori (H. pylori) infection, gastric atrophy, and gastric cancer in a Japanese population. | 0.008881637 | 2011 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 21073609 | 406938 | MIR146A | umls:C0024623 | BeFree | The rs2910164 (G>C) SNP in the miR-146a is associated with susceptibility to GC. | 0.005157396 | 2010 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 20721625 | 406938 | MIR146A | umls:C0024623 | BeFree | This study aimed to examine the associations of the miR-146a G/C (rs2910164) and TLR4 +3725 G/C (rs11536889) polymorphisms with the risk of Helicobacter pylori (H. pylori) infection, gastric atrophy, and gastric cancer in a Japanese population. | 0.005157396 | 2011 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 21073609 | 574501 | MIR499A | umls:C0024623 | BeFree | We evaluated the associations of three SNPs (rs11614913, rs2910164, and rs3746444) in pre-miRNAs (miR-196a2, miR-146a, and miR-499) with the risk of gastric cancer (GC) and peptic ulcer diseases, and with the severity of Helicobacter pylori-induced gastritis in Japanese population. | 0.001085767 | 2010 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2910164 | 25202115 | 406938 | MIR146A | umls:C0024623 | BeFree | We evaluated the associations of three selected SNPs (rs11614913, rs2910164, and rs3746444) in pre-miRNAs (hsa-mir-196a2, hsa-mir-146a and hsa-mir-499) with the prognosis of advanced gastric cancers (GCs) treated by chemotherapy. | 0.005157396 | 2014 | LOC285628;MIR146A | 5 | 160485411 | C | G |
| rs2976392 | 22155405 | 84668 | FAM126A | umls:C0024623 | BeFree | The results of subgroup analyses (according to histopathology, countries and sources of controls) indicated that T allele of rs2294008C>T and A allele rs2976392G>A were associated with increased risk of both intestinal- and diffuse-type GC, and associated with increased risk of GC for Chinese, Japanese, Koreans, PCC and HCC/PHCC. | 0.001628651 | 2012 | PSCA | 8 | 142681514 | G | A |
| rs3134613 | 20874233 | 4610 | MYCL | umls:C0024623 | BeFree | Association of a MYCL1 single nucleotide polymorphism, rs3134613, with susceptibility to diffuse-type gastric cancer and with differentiation of gastric cancer in a southeast Chinese population. | 0.00764398 | 2010 | MYCL;LOC105378668 | 1 | 39899131 | C | A |
| rs3160 | 23423739 | 64223 | MLST8 | umls:C0024623 | BeFree | In this study, we examined the associations between eight potential functional single nucleotide polymorphisms in the mTORC1 genes (rs2536T>C and rs1883965G>A for mTOR, rs3160T>C, and rs26865A>G for mLST8, rs3751934C>A, rs1062935T>C, rs3751932T>C, and rs12602885G>A for Raptor, not included in published gastric cancer genome-wide association studies) and gastric cancer risk in 1125 gastric cancer cases and 1196 cancer-free controls. | 0.000271442 | 2013 | MLST8;BRICD5 | 16 | 2209190 | T | C |
| rs35010275 | 25474430 | 406973 | MIR196A2 | umls:C0024623 | BeFree | Evaluation of a novel functional single-nucleotide polymorphism (rs35010275 G>C) in MIR196A2 promoter region as a risk factor of gastric cancer in a Chinese population. | 0.003181358 | 2015 | MIR196A2 | 12 | 53991008 | G | C |
| rs351855 | 23901234 | 2264 | FGFR4 | umls:C0024623 | BeFree | Our results suggest that the FGFR4 Gly388Arg polymorphism is not a risk factor for GC cancer initiation but that it is a useful prognostic marker for GC patients when the tumor is relatively small, well differentiated, or at an early clinical stage. | 0.001900093 | 2013 | FGFR4 | 5 | 177093242 | G | A |
| rs36012910 | 23053986 | 1788 | DNMT3A | umls:C0024623 | BeFree | DNMT3A rs36012910 A>G polymorphism and gastric cancer susceptibility in a Chinese population. | 0.001357209 | 2012 | NA | 2 | 25345310 | A | G |
| rs3731239 | 25239644 | 1993 | ELAVL2 | umls:C0024623 | BeFree | ASSET analyses identified four SNPs significantly associated with multiple cancers: rs3731239 (CDKN2A intronic) with ESCC, GC and BC (P = 3.96 × 10(-) (4)); rs10811474 (3' of IFNW1) with RCC and BrC (P = 0.001); rs12683422 (LINGO2 intronic) with RCC and BC (P = 5.93 × 10(-) (4)) and rs10511729 (3' of ELAVL2) with LC and BrC (P = 8.63 × 10(-) (4)). | 0.000814326 | 2015 | CDKN2A | 9 | 21974219 | A | G |
| rs3746444 | 25202115 | 574501 | MIR499A | umls:C0024623 | BeFree | We evaluated the associations of three selected SNPs (rs11614913, rs2910164, and rs3746444) in pre-miRNAs (hsa-mir-196a2, hsa-mir-146a and hsa-mir-499) with the prognosis of advanced gastric cancers (GCs) treated by chemotherapy. | 0.001085767 | 2014 | MYH7B;MIR499A;MIR499B | 20 | 34990448 | A | G |
| rs3746444 | 25202115 | 406938 | MIR146A | umls:C0024623 | BeFree | We evaluated the associations of three selected SNPs (rs11614913, rs2910164, and rs3746444) in pre-miRNAs (hsa-mir-196a2, hsa-mir-146a and hsa-mir-499) with the prognosis of advanced gastric cancers (GCs) treated by chemotherapy. | 0.005157396 | 2014 | MYH7B;MIR499A;MIR499B | 20 | 34990448 | A | G |
| rs3746444 | 21073609 | 574501 | MIR499A | umls:C0024623 | BeFree | We evaluated the associations of three SNPs (rs11614913, rs2910164, and rs3746444) in pre-miRNAs (miR-196a2, miR-146a, and miR-499) with the risk of gastric cancer (GC) and peptic ulcer diseases, and with the severity of Helicobacter pylori-induced gastritis in Japanese population. | 0.001085767 | 2010 | MYH7B;MIR499A;MIR499B | 20 | 34990448 | A | G |
| rs3746444 | 24107911 | 574501 | MIR499A | umls:C0024623 | BeFree | Association of the hsa-mir-499 (rs3746444) polymorphisms with gastric cancer risk in the Chinese population. | 0.001085767 | 2014 | MYH7B;MIR499A;MIR499B | 20 | 34990448 | A | G |
| rs3746444 | 25795117 | 574501 | MIR499A | umls:C0024623 | BeFree | No association was found between miR-499 rs3746444 and gastric cancer risk. | 0.001085767 | 2014 | MYH7B;MIR499A;MIR499B | 20 | 34990448 | A | G |
| rs3751932 | 23423739 | 64223 | MLST8 | umls:C0024623 | BeFree | In this study, we examined the associations between eight potential functional single nucleotide polymorphisms in the mTORC1 genes (rs2536T>C and rs1883965G>A for mTOR, rs3160T>C, and rs26865A>G for mLST8, rs3751934C>A, rs1062935T>C, rs3751932T>C, and rs12602885G>A for Raptor, not included in published gastric cancer genome-wide association studies) and gastric cancer risk in 1125 gastric cancer cases and 1196 cancer-free controls. | 0.000271442 | 2013 | RPTOR | 17 | 80965614 | C | T |
| rs3751934 | 23423739 | 64223 | MLST8 | umls:C0024623 | BeFree | In this study, we examined the associations between eight potential functional single nucleotide polymorphisms in the mTORC1 genes (rs2536T>C and rs1883965G>A for mTOR, rs3160T>C, and rs26865A>G for mLST8, rs3751934C>A, rs1062935T>C, rs3751932T>C, and rs12602885G>A for Raptor, not included in published gastric cancer genome-wide association studies) and gastric cancer risk in 1125 gastric cancer cases and 1196 cancer-free controls. | 0.000271442 | 2013 | RPTOR | 17 | 80964698 | C | A |
| rs376040996 | 20817763 | 2067 | ERCC1 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.010434343 | 2010 | XPA | 9 | 97687210 | T | C,G |
| rs376040996 | 20817763 | 4968 | OGG1 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.012529933 | 2010 | XPA | 9 | 97687210 | T | C,G |
| rs376040996 | 20817763 | 4255 | MGMT | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.006710102 | 2010 | XPA | 9 | 97687210 | T | C,G |
| rs376040996 | 20817763 | 7517 | XRCC3 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.007448483 | 2010 | XPA | 9 | 97687210 | T | C,G |
| rs376040996 | 20817763 | 2068 | ERCC2 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.011911105 | 2010 | XPA | 9 | 97687210 | T | C,G |
| rs3765524 | 26554163 | 8000 | PSCA | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.009771907 | 2016 | PLCE1 | 10 | 94298541 | C | T |
| rs3765524 | 20729852 | 51196 | PLCE1 | umls:C0024623 | GWASCAT | A notable signal was rs2274223, a nonsynonymous SNP located in PLCE1, for gastric cancer (P = 8.40 x 10(-9); per-allele odds ratio (OR) = 1.31) and ESCC (P = 3.85 x 10(-9); OR = 1.34). | 0.124071628 | 2010 | PLCE1 | 10 | 94298541 | C | T |
| rs3765524 | 26554163 | 51196 | PLCE1 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.124071628 | 2016 | PLCE1 | 10 | 94298541 | C | T |
| rs3765524 | 26554163 | 252969 | NEIL2 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.000542884 | 2016 | PLCE1 | 10 | 94298541 | C | T |
| rs3765524 | 26554163 | 596 | BCL2 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.015200745 | 2016 | PLCE1 | 10 | 94298541 | C | T |
| rs377566281 | 25335737 | 7515 | XRCC1 | umls:C0024623 | BeFree | XRCC1 genetic polymorphism Arg339Gln, Arg194Trp, Arg280His and gastric cancer risk: an evidence based decision. | 0.017611384 | 2015 | XRCC1 | 19 | 43552083 | C | T |
| rs3781264 | 20729852 | 51196 | PLCE1 | umls:C0024623 | GWASCAT | A notable signal was rs2274223, a nonsynonymous SNP located in PLCE1, for gastric cancer (P = 8.40 x 10(-9); per-allele odds ratio (OR) = 1.31) and ESCC (P = 3.85 x 10(-9); OR = 1.34). | 0.124071628 | 2010 | PLCE1 | 10 | 94310618 | A | G |
| rs3789210 | 25551587 | 5225 | PGC | umls:C0024623 | BeFree | Our findings highlight an important role of PGC rs3789210 and rs6939861 in altering susceptibility to atrophic gastritis and/or gastric cancer. | 0.009815515 | 2014 | PGC | 6 | 41743584 | C | G |
| rs3807987 | 24065198 | 857 | CAV1 | umls:C0024623 | BeFree | Interaction among Caveolin-1 genotypes (rs3807987/rs7804372), H. pylori infection, and risk of gastric cancer in a Chinese population. | 0.002714419 | 2013 | CAV1 | 7 | 116539780 | G | A |
| rs386493716 | 15533591 | 7515 | XRCC1 | umls:C0024623 | BeFree | However, carrying at least one copy of the variant allele in XRCC1 Arg399Gln (codon 399 arganine to glutamine substitution) was associated with reduced risk of gastric cardia cancer (RR: 0.60, 95% CI: 0.37-0.97) and the combined category esophageal/gastric cancer (RR: 0.67, 95% CI: 0.48-0.95). | 0.017611384 | 2004 | NA | NA | NA | NA | NA |
| rs386493716 | 24590266 | 7515 | XRCC1 | umls:C0024623 | BeFree | Results from the current meta-analysis indicate that XRCC1 Arg399Gln polymorphism may be associated with poor clinical outcomes in GC patients treated with oxaliplatin-based chemotherapy. | 0.017611384 | 2014 | NA | NA | NA | NA | NA |
| rs386493716 | 19147860 | 4968 | OGG1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.012529933 | 2009 | NA | NA | NA | NA | NA |
| rs386493716 | 19147860 | 7515 | XRCC1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.017611384 | 2009 | NA | NA | NA | NA | NA |
| rs386493716 | 23212324 | 7515 | XRCC1 | umls:C0024623 | BeFree | Lack of an association between the XRCC1 Arg399Gln polymorphism and gastric cancer based on a meta-analysis. | 0.017611384 | 2012 | NA | NA | NA | NA | NA |
| rs386493716 | 19147860 | 328 | APEX1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.002442977 | 2009 | NA | NA | NA | NA | NA |
| rs386493716 | 19034980 | 7515 | XRCC1 | umls:C0024623 | BeFree | XRCC1 genetic polymorphism Arg399Gln and gastric cancer risk: A meta-analysis. | 0.017611384 | 2008 | NA | NA | NA | NA | NA |
| rs386526551 | 20817763 | 2067 | ERCC1 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.010434343 | 2010 | NA | NA | NA | NA | NA |
| rs386526551 | 20817763 | 4968 | OGG1 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.012529933 | 2010 | NA | NA | NA | NA | NA |
| rs386526551 | 20817763 | 7517 | XRCC3 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.007448483 | 2010 | NA | NA | NA | NA | NA |
| rs386526551 | 20817763 | 4255 | MGMT | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.006710102 | 2010 | NA | NA | NA | NA | NA |
| rs386526551 | 20817763 | 2068 | ERCC2 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.011911105 | 2010 | NA | NA | NA | NA | NA |
| rs386539567 | 19655167 | 1462 | VCAN | umls:C0024623 | BeFree | Genetic variants A1826H and D2937Y in GAG-beta domain of versican influence susceptibility to intestinal-type gastric cancer. | 0.000814326 | 2010 | NA | NA | NA | NA | NA |
| rs386545546 | 25335737 | 7515 | XRCC1 | umls:C0024623 | BeFree | XRCC1 genetic polymorphism Arg339Gln, Arg194Trp, Arg280His and gastric cancer risk: an evidence based decision. | 0.017611384 | 2015 | NA | NA | NA | NA | NA |
| rs386545546 | 19147860 | 328 | APEX1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.002442977 | 2009 | NA | NA | NA | NA | NA |
| rs386545546 | 19147860 | 4968 | OGG1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.012529933 | 2009 | NA | NA | NA | NA | NA |
| rs386545546 | 22901183 | 7515 | XRCC1 | umls:C0024623 | BeFree | ADPRT Val762Ala and XRCC1 Arg194Trp polymorphisms and risk of gastric cancer in Sichuan of China. | 0.017611384 | 2012 | NA | NA | NA | NA | NA |
| rs386545546 | 19147860 | 7515 | XRCC1 | umls:C0024623 | BeFree | To evaluate the association between genetic polymorphisms of X-ray repair cross-complementing group 1 (XRCC1, Arg194Trp and Arg399Gln), adenosine diphosphate ribosyl transferase (ADPRT, Val762Ala), 8-oxoguanine DNA glycosylase (OGG1, Ser326Cys) and apurinic/apyrimidinic endonuclease 1 (APE1, Asp148Glu) and evolution of H.pylori-associated precancerous gastric lesions, a population-based cohort study was conducted in Linqu County, a high-risk area of gastric cancer in China. | 0.017611384 | 2009 | NA | NA | NA | NA | NA |
| rs386545546 | 22901183 | 142 | PARP1 | umls:C0024623 | BeFree | ADPRT Val762Ala and XRCC1 Arg194Trp polymorphisms and risk of gastric cancer in Sichuan of China. | 0.002714419 | 2012 | NA | NA | NA | NA | NA |
| rs386547285 | 23776537 | 54106 | TLR9 | umls:C0024623 | BeFree | For TLR9 -1486 T/C, multiple logistic regression analyses revealed that compared with the TT homozygote, patients with both the TC variant (adjusted odds ratio (OR) = 1.47, 95% confidence interval (CI) = 1.04-2.10) and the CC variant (adjusted OR = 1.63, 95% CI = 1.01-2.64) had higher risks of gastric cancer. | 0.000814326 | 2013 | NA | NA | NA | NA | NA |
| rs386596107 | 20233853 | 6648 | SOD2 | umls:C0024623 | BeFree | To investigate the association between MnSOD Val(16)Ala polymorphism and risk of advanced gastric lesions, and its effects on chemoprevention, a population-based study was conducted in Linqu, a high-risk area of gastric cancer in China. | 0.003724241 | 2010 | NA | NA | NA | NA | NA |
| rs386602118 | 24913346 | 627 | BDNF | umls:C0024623 | BeFree | The aim of this study was to elucidate the association between the brain-derived neurotrophic factor (BDNF) Val66Met polymorphism and coping response to stress in patients diagnosed with advanced gastric cancer. | 0.000814326 | 2014 | NA | NA | NA | NA | NA |
| rs386626619 | 20306156 | 3717 | JAK2 | umls:C0024623 | BeFree | The development of gastric cancer in a patient with polycythemia Vera, 3P deletion, and JAK2 V617F mutation. | 0.002442977 | 2010 | NA | NA | NA | NA | NA |
| rs397507444 | 16886608 | 4524 | MTHFR | umls:C0024623 | BeFree | Recently, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) mutations were discovered to be associated with childhood acute lymphoblastic leukemia (ALL), as well as colon cancer, lymphoma, esophageal and stomach cancer. | 0.036428088 | 2006 | MTHFR | 1 | 11794407 | T | G |
| rs397507444 | 23897558 | 4524 | MTHFR | umls:C0024623 | BeFree | The polymorphism of methylenetetrahydrofolate reductase C677T but not A1298C contributes to gastric cancer. | 0.036428088 | 2013 | MTHFR | 1 | 11794407 | T | G |
| rs397507444 | 20470942 | 4524 | MTHFR | umls:C0024623 | BeFree | Methylenetetrahydrofolate reductase C677T and A1298C polymorphisms and gastric cancer: a meta-analysis. | 0.036428088 | 2010 | MTHFR | 1 | 11794407 | T | G |
| rs397507444 | 25170232 | 4524 | MTHFR | umls:C0024623 | BeFree | Methylenetetrahydrofolate reductase C677T and A1298C polymorphisms and gastric cancer susceptibility. | 0.036428088 | 2014 | MTHFR | 1 | 11794407 | T | G |
| rs397507444 | 18162478 | 4524 | MTHFR | umls:C0024623 | BeFree | Meta- and pooled analyses of the methylenetetrahydrofolate reductase C677T and A1298C polymorphisms and gastric cancer risk: a huge-GSEC review. | 0.036428088 | 2008 | MTHFR | 1 | 11794407 | T | G |
| rs40239 | 25203738 | 8731 | RNMT | umls:C0024623 | BeFree | MET rs40239 may serve as a prognostic biomarker in locoregional gastric cancer. | 0.008414698 | 2015 | MET | 7 | 116677823 | G | A |
| rs4072037 | 24755768 | 4582 | MUC1 | umls:C0024623 | BeFree | In conclusion, MUC1 rs4072037 polymorphism may be used as potential biomarker for cancer susceptibility particularly for gastric cancer and for Asian population. | 0.129500466 | 2014 | MUC1 | 1 | 155192276 | C | T |
| rs4072037 | 24254309 | 4582 | MUC1 | umls:C0024623 | BeFree | The aim of this study was to determine whether rs4072037A > G in MUC1 at 1q22 and rs2274223A > G in PLCE1 at 10q23 are associated with a risk of gastric cancer in a Korean population. | 0.129500466 | 2013 | MUC1 | 1 | 155192276 | C | T |
| rs4072037 | 20729852 | 4582 | MUC1 | umls:C0024623 | GWASCAT | A shared susceptibility locus in PLCE1 at 10q23 for gastric adenocarcinoma and esophageal squamous cell carcinoma. | 0.129500466 | 2010 | MUC1 | 1 | 155192276 | C | T |
| rs4072037 | 24254309 | 51196 | PLCE1 | umls:C0024623 | BeFree | The aim of this study was to determine whether rs4072037A > G in MUC1 at 1q22 and rs2274223A > G in PLCE1 at 10q23 are associated with a risk of gastric cancer in a Korean population. | 0.124071628 | 2013 | MUC1 | 1 | 155192276 | C | T |
| rs4072037 | 24072653 | 4582 | MUC1 | umls:C0024623 | BeFree | Functional polymorphism rs4072037 in MUC1 gene contributes to the susceptibility to gastric cancer: evidence from pooled 6,580 cases and 10,324 controls. | 0.129500466 | 2013 | MUC1 | 1 | 155192276 | C | T |
| rs4072037 | 22805490 | 4582 | MUC1 | umls:C0024623 | BeFree | The rs4072037 polymorphism in MUC1 was associated with a reduced risk of GC of intestinal histological type (OR 0.4; 95% CI 0.2-0.9) and a reduced risk of oesophageal squamous cell cancer (OR 0.5; 95% CI 0.2-1.0), but not oesphageal adenocarcinoma. | 0.129500466 | 2012 | MUC1 | 1 | 155192276 | C | T |
| rs4073 | 23558993 | 3576 | CXCL8 | umls:C0024623 | BeFree | The aim of this study was to investigate the association between the IL-8 (rs4073) -251A/T gene polymorphism and the risk of gastric cancer (GC). | 0.044343509 | 2012 | CXCL8 | 4 | 73740307 | A | T |
| rs4145643 | 23042672 | 983 | CDK1 | umls:C0024623 | BeFree | CDK1 rs4145643, FAS rs6586161, and FAS rs1468063 in the AKT signaling pathway presented significant genetic effects on gastric cancer (OR = 0.81 (95% CI: 0.66-0.99) for CDK1 rs4145643; OR = 1.27 (95% CI: 1.03-1.58) for FAS rs6586161; OR = 1.29 (95% CI: 1.03-1.56) for FAS rs1468063; Cochran Q statistics > 0.10). | 0.000542884 | 2012 | NA | 10 | 60803097 | G | C |
| rs4635002 | 21698158 | 2048 | EPHB2 | umls:C0024623 | BeFree | In the extension analyses, ERK rs5999749, Dock180 rs4635002 and C3G rs7853122 showed marginally significant gene-dose effects for gastric cancer. | 0.007057489 | 2011 | DOCK1 | 10 | 127064415 | A | C |
| rs4635002 | 21698158 | 1793 | DOCK1 | umls:C0024623 | BeFree | In the extension analyses, ERK rs5999749, Dock180 rs4635002 and C3G rs7853122 showed marginally significant gene-dose effects for gastric cancer. | 0.000271442 | 2011 | DOCK1 | 10 | 127064415 | A | C |
| rs4647610 | 25002346 | 836 | CASP3 | umls:C0024623 | BeFree | In analysis of gene polymorphism of caspase3 intrinsic apoptotic pathway and gastric cancer susceptibility, polymorphism of CASP3 rs4647693, CASP3 rs12108497 and CASP3 rs4647610 increased gastric cancer risk (rs4647693: ORGA 1.61, 95 % CI 1.06-2.28; rs12108497: ORTC 1.55, 95 % CI 1.09-2.18; ORCC 2.45, 95 % CI 1.08-4.16; rs4647610: ORAG 1.71, 95 % CI 1.14-2.31; ORGG 1.60, 95 % CI 1.23-2.34). | 0.007057489 | 2015 | CASP3 | 4 | 184646777 | C | T |
| rs4647693 | 25002346 | 836 | CASP3 | umls:C0024623 | BeFree | In analysis of gene polymorphism of caspase3 intrinsic apoptotic pathway and gastric cancer susceptibility, polymorphism of CASP3 rs4647693, CASP3 rs12108497 and CASP3 rs4647610 increased gastric cancer risk (rs4647693: ORGA 1.61, 95 % CI 1.06-2.28; rs12108497: ORTC 1.55, 95 % CI 1.09-2.18; ORCC 2.45, 95 % CI 1.08-4.16; rs4647610: ORAG 1.71, 95 % CI 1.14-2.31; ORGG 1.60, 95 % CI 1.23-2.34). | 0.007057489 | 2015 | CASP3 | 4 | 184629610 | T | C |
| rs4648068 | 22776619 | 4790 | NFKB1 | umls:C0024623 | BeFree | Association of an NFKB1 intron SNP (rs4648068) with gastric cancer patients in the Han Chinese population. | 0.009229024 | 2012 | NFKB1 | 4 | 102597148 | A | G |
| rs4711690 | 23455381 | 5225 | PGC | umls:C0024623 | BeFree | We observed that PGC rs6458238, PGC rs4711690 and PTPN11 rs12229892 were associated with susceptibilities to GA and/or GC. | 0.009815515 | 2013 | PGC | 6 | 41741200 | C | G |
| rs4711690 | 23455381 | 5781 | PTPN11 | umls:C0024623 | BeFree | We observed that PGC rs6458238, PGC rs4711690 and PTPN11 rs12229892 were associated with susceptibilities to GA and/or GC. | 0.004810009 | 2013 | PGC | 6 | 41741200 | C | G |
| rs4880 | 20233853 | 6648 | SOD2 | umls:C0024623 | BeFree | To investigate the association between MnSOD Val(16)Ala polymorphism and risk of advanced gastric lesions, and its effects on chemoprevention, a population-based study was conducted in Linqu, a high-risk area of gastric cancer in China. | 0.003724241 | 2010 | SOD2 | 6 | 159692840 | A | G |
| rs4938723 | 25658980 | 7157 | TP53 | umls:C0024623 | BeFree | Combined analysis showed that subjects carrying the miR-34b/c rs4938723 CT/CC and TP53 CG/CC genotypes had a 0.62-fold decreased risk to develop gastric cancer compared with subjects carrying the miR-34b/c rs4938723 TT and TP53 CG/CC genotypes (OR=0.62; 95% CI, 0.40-0.96). | 0.084277802 | 2015 | BTG4;MIR34B;MIR34C | 11 | 111511840 | T | C |
| rs4986790 | 18755634 | 7099 | TLR4 | umls:C0024623 | BeFree | TLR4/D299G/T399I polymorphisms were more frequent in duodenal ulcer and showed a trend in gastric cancer, when compared with non-atrophic gastritis. | 0.008881637 | 2008 | TLR4 | 9 | 117713024 | A | G |
| rs4986790 | 17462092 | 3576 | CXCL8 | umls:C0024623 | BeFree | Assessment of the toll-like receptor 4 Asp299Gly, Thr399Ile and interleukin-8 -251 polymorphisms in the risk for the development of distal gastric cancer. | 0.044343509 | 2007 | TLR4 | 9 | 117713024 | A | G |
| rs4986790 | 19847953 | 929 | CD14 | umls:C0024623 | BeFree | Our data suggest that CD14 promoter-159TT and T carrier were associated with lower risk of developing gastric mucosal atrophy in H. pylori infected patients more than 61 years of age, and these genotypes may reduce the risk of intestinal type gastric cancer and TLR4 Asp299Gly, Thr399Ile are very rare in the Japanese population. | 0.004810009 | 2007 | TLR4 | 9 | 117713024 | A | G |
| rs4986790 | 17462092 | 7099 | TLR4 | umls:C0024623 | BeFree | Assessment of the toll-like receptor 4 Asp299Gly, Thr399Ile and interleukin-8 -251 polymorphisms in the risk for the development of distal gastric cancer. | 0.008881637 | 2007 | TLR4 | 9 | 117713024 | A | G |
| rs4986790 | 19847953 | 4695 | NDUFA2 | umls:C0024623 | BeFree | Our data suggest that CD14 promoter-159TT and T carrier were associated with lower risk of developing gastric mucosal atrophy in H. pylori infected patients more than 61 years of age, and these genotypes may reduce the risk of intestinal type gastric cancer and TLR4 Asp299Gly, Thr399Ile are very rare in the Japanese population. | 0.002171535 | 2007 | TLR4 | 9 | 117713024 | A | G |
| rs4986790 | 19847953 | 7099 | TLR4 | umls:C0024623 | BeFree | Our data suggest that CD14 promoter-159TT and T carrier were associated with lower risk of developing gastric mucosal atrophy in H. pylori infected patients more than 61 years of age, and these genotypes may reduce the risk of intestinal type gastric cancer and TLR4 Asp299Gly, Thr399Ile are very rare in the Japanese population. | 0.008881637 | 2007 | TLR4 | 9 | 117713024 | A | G |
| rs4986790 | 24007538 | 7099 | TLR4 | umls:C0024623 | BeFree | The results of this meta-analysis indicate that the TLR4 Asp299Gly and Thr399Ile polymorphisms are risk factors for gastric cancer development. | 0.008881637 | 2014 | TLR4 | 9 | 117713024 | A | G |
| rs4986790 | 23565226 | 7099 | TLR4 | umls:C0024623 | BeFree | Based on our meta-analysis, the TLR signalling pathway is involved in gastric carcinogenesis, TLR4 Asp299Gly and TLR2 -196 to -174del showing associations with GC in an ethnic-specific manner. | 0.008881637 | 2013 | TLR4 | 9 | 117713024 | A | G |
| rs4986790 | 19326213 | 7099 | TLR4 | umls:C0024623 | BeFree | We investigated the effects of common polymorphisms of TLR4 Asp299Gly, Thr399Ile, and CD14 promoter-C159T on the risk of gastric cancer including its subtypes and clinicopathologic features. | 0.008881637 | 2009 | TLR4 | 9 | 117713024 | A | G |
| rs4986790 | 18826495 | 7099 | TLR4 | umls:C0024623 | BeFree | Toll-like receptor 4 Asp299Gly and Thr399Ile polymorphisms in gastric cancer of intestinal and diffuse histotypes. | 0.008881637 | 2008 | TLR4 | 9 | 117713024 | A | G |
| rs4986790 | 23565226 | 7097 | TLR2 | umls:C0024623 | BeFree | Based on our meta-analysis, the TLR signalling pathway is involved in gastric carcinogenesis, TLR4 Asp299Gly and TLR2 -196 to -174del showing associations with GC in an ethnic-specific manner. | 0.001900093 | 2013 | TLR4 | 9 | 117713024 | A | G |
| rs4986790 | 24007538 | 7097 | TLR2 | umls:C0024623 | BeFree | The association between Toll-like receptor 2 (TLR2) -196 to -174del polymorphism and Toll-like receptor 4 (TLR4) polymorphisms (Asp299Gly, Thr399Ile, and 3725G>C) and gastric cancer risk are still conflicting. | 0.001900093 | 2014 | TLR4 | 9 | 117713024 | A | G |
| rs4986791 | 24007538 | 7099 | TLR4 | umls:C0024623 | BeFree | The results of this meta-analysis indicate that the TLR4 Asp299Gly and Thr399Ile polymorphisms are risk factors for gastric cancer development. | 0.008881637 | 2014 | TLR4 | 9 | 117713324 | C | T |
| rs4986791 | 17462092 | 7099 | TLR4 | umls:C0024623 | BeFree | Assessment of the toll-like receptor 4 Asp299Gly, Thr399Ile and interleukin-8 -251 polymorphisms in the risk for the development of distal gastric cancer. | 0.008881637 | 2007 | TLR4 | 9 | 117713324 | C | T |
| rs4986791 | 19847953 | 4695 | NDUFA2 | umls:C0024623 | BeFree | Our data suggest that CD14 promoter-159TT and T carrier were associated with lower risk of developing gastric mucosal atrophy in H. pylori infected patients more than 61 years of age, and these genotypes may reduce the risk of intestinal type gastric cancer and TLR4 Asp299Gly, Thr399Ile are very rare in the Japanese population. | 0.002171535 | 2007 | TLR4 | 9 | 117713324 | C | T |
| rs4986791 | 19847953 | 7099 | TLR4 | umls:C0024623 | BeFree | Our data suggest that CD14 promoter-159TT and T carrier were associated with lower risk of developing gastric mucosal atrophy in H. pylori infected patients more than 61 years of age, and these genotypes may reduce the risk of intestinal type gastric cancer and TLR4 Asp299Gly, Thr399Ile are very rare in the Japanese population. | 0.008881637 | 2007 | TLR4 | 9 | 117713324 | C | T |
| rs4986791 | 18755634 | 7099 | TLR4 | umls:C0024623 | BeFree | TLR4/D299G/T399I polymorphisms were more frequent in duodenal ulcer and showed a trend in gastric cancer, when compared with non-atrophic gastritis. | 0.008881637 | 2008 | TLR4 | 9 | 117713324 | C | T |
| rs4986791 | 19847953 | 929 | CD14 | umls:C0024623 | BeFree | Our data suggest that CD14 promoter-159TT and T carrier were associated with lower risk of developing gastric mucosal atrophy in H. pylori infected patients more than 61 years of age, and these genotypes may reduce the risk of intestinal type gastric cancer and TLR4 Asp299Gly, Thr399Ile are very rare in the Japanese population. | 0.004810009 | 2007 | TLR4 | 9 | 117713324 | C | T |
| rs4986791 | 18826495 | 7099 | TLR4 | umls:C0024623 | BeFree | Toll-like receptor 4 Asp299Gly and Thr399Ile polymorphisms in gastric cancer of intestinal and diffuse histotypes. | 0.008881637 | 2008 | TLR4 | 9 | 117713324 | C | T |
| rs4986791 | 17462092 | 3576 | CXCL8 | umls:C0024623 | BeFree | Assessment of the toll-like receptor 4 Asp299Gly, Thr399Ile and interleukin-8 -251 polymorphisms in the risk for the development of distal gastric cancer. | 0.044343509 | 2007 | TLR4 | 9 | 117713324 | C | T |
| rs4986791 | 24007538 | 7097 | TLR2 | umls:C0024623 | BeFree | The association between Toll-like receptor 2 (TLR2) -196 to -174del polymorphism and Toll-like receptor 4 (TLR4) polymorphisms (Asp299Gly, Thr399Ile, and 3725G>C) and gastric cancer risk are still conflicting. | 0.001900093 | 2014 | TLR4 | 9 | 117713324 | C | T |
| rs4986791 | 19326213 | 7099 | TLR4 | umls:C0024623 | BeFree | We investigated the effects of common polymorphisms of TLR4 Asp299Gly, Thr399Ile, and CD14 promoter-C159T on the risk of gastric cancer including its subtypes and clinicopathologic features. | 0.008881637 | 2009 | TLR4 | 9 | 117713324 | C | T |
| rs5275 | 22385256 | 5743 | PTGS2 | umls:C0024623 | BeFree | Our findings indicate that PTGS2 rs5275T/C may be a candidate genetic marker for gastric cancer susceptibility. | 0.036959702 | 2012 | PTGS2 | 1 | 186673926 | A | G |
| rs5361 | 21780194 | 6401 | SELE | umls:C0024623 | BeFree | E-selectin rs5361 and FCGR2A rs1801274 variants were associated with increased risk of gastric cancer in a Chinese population. | 0.001900093 | 2012 | SELE | 1 | 169731919 | T | G |
| rs5361 | 21780194 | 2212 | FCGR2A | umls:C0024623 | BeFree | E-selectin rs5361 and FCGR2A rs1801274 variants were associated with increased risk of gastric cancer in a Chinese population. | 0.002638474 | 2012 | SELE | 1 | 169731919 | T | G |
| rs5361 | 21780194 | 3566 | IL4R | umls:C0024623 | BeFree | Interleukin-4 receptor (IL-4R) variant rs2107356 presented negative correlations to E-selectin variant rs5361 and FCGR2A variant rs1801274 (P = 0.035 and P = 0.023) in conferring susceptibility to gastric cancer. | 0.002909916 | 2012 | SELE | 1 | 169731919 | T | G |
| rs5743618 | 23067142 | 7096 | TLR1 | umls:C0024623 | BeFree | The TLR1 I602S SNP is significantly associated with GC (p = .002) and gastric ulcer (p = .051). | 0.000542884 | 2013 | TLR1 | 4 | 38797027 | C | A |
| rs5744174 | 21994405 | 7100 | TLR5 | umls:C0024623 | BeFree | These findings suggest that TLR2 c. -196 to -174 ins > del, TLR5 rs5744174 and interaction between rs5744174 and H. pylori infection were associated with the development of GC. | 0.000542884 | 2011 | TLR5 | 1 | 223111186 | A | G |
| rs5999749 | 21698158 | 1793 | DOCK1 | umls:C0024623 | BeFree | In the extension analyses, ERK rs5999749, Dock180 rs4635002 and C3G rs7853122 showed marginally significant gene-dose effects for gastric cancer. | 0.000271442 | 2011 | MAPK1 | 22 | 21833371 | A | C |
| rs5999749 | 21698158 | 2048 | EPHB2 | umls:C0024623 | BeFree | In the extension analyses, ERK rs5999749, Dock180 rs4635002 and C3G rs7853122 showed marginally significant gene-dose effects for gastric cancer. | 0.007057489 | 2011 | MAPK1 | 22 | 21833371 | A | C |
| rs629367 | 24760009 | 406882 | MIRLET7A2 | umls:C0024623 | BeFree | pri-let-7a-2 rs629367 CC genotype could increase the risks of gastric cancer as well as atrophic gastritis and was also associated with poor survival of gastric cancer, which possibly by affecting the mature let-7a expression, and could serve as a predicting biomarker for high-risk and poor prognosis of gastric cancer. | 0.000271442 | 2014 | MIR100HG;MIRLET7A2 | 11 | 122146306 | C | A |
| rs63750114 | 22136435 | 4292 | MLH1 | umls:C0024623 | BeFree | The MLH1 2101C>A (Q701K) variant increases the risk of gastric cancer in Chinese males. | 0.024668873 | 2011 | MLH1 | 3 | 37049015 | C | A,T |
| rs63750447 | 20177793 | 4292 | MLH1 | umls:C0024623 | BeFree | A new familial gastric cancer-related gene polymorphism: T1151A in the mismatch repair gene hMLH1. | 0.024668873 | 2011 | MLH1 | 3 | 37025749 | T | A |
| rs6458238 | 24586594 | 406881 | MIRLET7A1 | umls:C0024623 | BeFree | An interaction effect of pri-let-7a-1 rs10739971 polymorphism with ERCC6 rs1917799 polymorphism was observed for the risk of gastric cancer (P interaction = 0.026); and interaction effects of pri-let-7a-1 rs10739971 polymorphism with PGC rs6458238 polymorphism (P interaction = 0.012) and PGC rs9471643 polymorphism (P interaction = 0.039) were observed for the risk of atrophic gastritis. | 0.000271442 | 2014 | NA | 6 | 41749967 | G | A |
| rs6458238 | 23455381 | 5781 | PTPN11 | umls:C0024623 | BeFree | We observed that PGC rs6458238, PGC rs4711690 and PTPN11 rs12229892 were associated with susceptibilities to GA and/or GC. | 0.004810009 | 2013 | NA | 6 | 41749967 | G | A |
| rs6458238 | 23455381 | 5225 | PGC | umls:C0024623 | BeFree | We observed that PGC rs6458238, PGC rs4711690 and PTPN11 rs12229892 were associated with susceptibilities to GA and/or GC. | 0.009815515 | 2013 | NA | 6 | 41749967 | G | A |
| rs6586161 | 23042672 | 983 | CDK1 | umls:C0024623 | BeFree | CDK1 rs4145643, FAS rs6586161, and FAS rs1468063 in the AKT signaling pathway presented significant genetic effects on gastric cancer (OR = 0.81 (95% CI: 0.66-0.99) for CDK1 rs4145643; OR = 1.27 (95% CI: 1.03-1.58) for FAS rs6586161; OR = 1.29 (95% CI: 1.03-1.56) for FAS rs1468063; Cochran Q statistics > 0.10). | 0.000542884 | 2012 | ACTA2;FAS | 10 | 88981502 | T | A |
| rs6672420 | 19728008 | 864 | RUNX3 | umls:C0024623 | BeFree | Our study results revealed that the RUNX3 intronic T/A polymorphism (rs760805) might modulate the risk of gastric atrophy among H. pylori seropositive subjects, and the RUNX3 T/A polymorphism at exon 1 (rs6672420) had little influence on the risks of H. pylori infection, gastric atrophy or gastric cancer in Japanese people. | 0.018186605 | 2009 | RUNX3;LOC105376878 | 1 | 24964519 | A | T |
| rs671 | 25524923 | 125 | ADH1B | umls:C0024623 | BeFree | No association was observed between alcohol consumption, ADH1B (rs1229984), ADH1C (rs698) and ALDH2 (rs671) polymorphisms and gastric cancer risk. | 0.003995683 | 2015 | ALDH2 | 12 | 111803962 | G | A |
| rs671 | 23455379 | 217 | ALDH2 | umls:C0024623 | BeFree | The aldehyde dehydrogenase 2 (ALDH2) Glu504Lys polymorphism interacts with alcohol drinking in the risk of stomach cancer. | 0.00853425 | 2013 | ALDH2 | 12 | 111803962 | G | A |
| rs689466 | 21649724 | 3553 | IL1B | umls:C0024623 | BeFree | In the Chinese subgroup, nominally significant associations were shown between (i) EBBR2+1963G (rs1801200) and H. pylori infection (per-allele OR: 0.48, 95% CI 0.23, 0.98, P = 0.04), (ii) PTGS2-1195G (rs689466) and an increased risk of GC on adjusting for H. pylori status (OR: 1.53, 95% CI 0.99, 2.37, P = 0.05), and (iii) IL1B-1473C (rs1143623) and a decreased risk of GC (OR: 0.64, 95% CI 0.41, 0.99, P = 0.05). | 0.064669312 | 2011 | PTGS2;PACERR | 1 | 186681619 | T | C |
| rs689466 | 21649724 | 5743 | PTGS2 | umls:C0024623 | BeFree | In the Chinese subgroup, nominally significant associations were shown between (i) EBBR2+1963G (rs1801200) and H. pylori infection (per-allele OR: 0.48, 95% CI 0.23, 0.98, P = 0.04), (ii) PTGS2-1195G (rs689466) and an increased risk of GC on adjusting for H. pylori status (OR: 1.53, 95% CI 0.99, 2.37, P = 0.05), and (iii) IL1B-1473C (rs1143623) and a decreased risk of GC (OR: 0.64, 95% CI 0.41, 0.99, P = 0.05). | 0.036959702 | 2011 | PTGS2;PACERR | 1 | 186681619 | T | C |
| rs6939861 | 25551587 | 5225 | PGC | umls:C0024623 | BeFree | Our findings highlight an important role of PGC rs3789210 and rs6939861 in altering susceptibility to atrophic gastritis and/or gastric cancer. | 0.009815515 | 2014 | TFEB | 6 | 41735303 | G | A |
| rs698 | 25524923 | 125 | ADH1B | umls:C0024623 | BeFree | No association was observed between alcohol consumption, ADH1B (rs1229984), ADH1C (rs698) and ALDH2 (rs671) polymorphisms and gastric cancer risk. | 0.003995683 | 2015 | ADH1C | 4 | 99339632 | T | C,A |
| rs712 | 23729275 | 3845 | KRAS | umls:C0024623 | BeFree | A let-7 binding site polymorphism rs712 in the KRAS 3' UTR is associated with an increased risk of gastric cancer. | 0.013887143 | 2013 | KRAS | 12 | 25209618 | A | C |
| rs7121 | 20027678 | 2778 | GNAS | umls:C0024623 | BeFree | Association of the GNAS1 T393C polymorphism with tumor stage and survival in gastric cancer. | 0.002638474 | 2009 | GNAS | 20 | 58903752 | C | T |
| rs71748309 | 24453034 | 3459 | IFNGR1 | umls:C0024623 | BeFree | Association study of SNPs of genes IFNGR1 (rs137854905), GSTT1 (rs71748309), and GSTP1 (rs1695) in gastric cancer development in samples of patient in the northern and northeastern Brazil. | 0.000271442 | 2014 | NA | NA | NA | NA | NA |
| rs71748309 | 24453034 | 2950 | GSTP1 | umls:C0024623 | BeFree | Association study of SNPs of genes IFNGR1 (rs137854905), GSTT1 (rs71748309), and GSTP1 (rs1695) in gastric cancer development in samples of patient in the northern and northeastern Brazil. | 0.021455178 | 2014 | NA | NA | NA | NA | NA |
| rs71748309 | 24453034 | 2952 | GSTT1 | umls:C0024623 | BeFree | Association study of SNPs of genes IFNGR1 (rs137854905), GSTT1 (rs71748309), and GSTP1 (rs1695) in gastric cancer development in samples of patient in the northern and northeastern Brazil. | 0.034256553 | 2014 | NA | NA | NA | NA | NA |
| rs727088 | 25510399 | 10666 | CD226 | umls:C0024623 | BeFree | CD226 rs727088A>G polymorphism increases the susceptibility to gastric cancer in Chinese populations. | 0.000271442 | 2014 | CD226 | 18 | 69863203 | G | A |
| rs738722 | 20729852 | 11200 | CHEK2 | umls:C0024623 | GWASCAT | A shared susceptibility locus in PLCE1 at 10q23 for gastric adenocarcinoma and esophageal squamous cell carcinoma. | 0.121357209 | 2010 | CHEK2 | 22 | 28734024 | T | C |
| rs744166 | 24864251 | 6774 | STAT3 | umls:C0024623 | BeFree | rs744166 polymorphism of the STAT3 gene is associated with risk of gastric cancer in a Chinese population. | 0.010586233 | 2014 | STAT3 | 17 | 42362183 | A | G |
| rs74483926 | 24965397 | 58508 | KMT2C | umls:C0024623 | BeFree | A missense mutation (S3660L) in MLL3 gene influences risk of gastric cancer. | 0.001357209 | 2014 | KMT2C | 7 | 152162598 | G | A |
| rs7528484 | 21523770 | 1385 | CREB1 | umls:C0024623 | BeFree | The risk-associated, minor variant of an intestinal-type gastric cancer-associated SNP in the RUNX3 distal promoter (rs7528484) significantly increased promoter activity in a CREB1-dependent manner. | 0.001085767 | 2011 | RUNX3 | 1 | 24966177 | C | T |
| rs760805 | 19728008 | 864 | RUNX3 | umls:C0024623 | BeFree | Our study results revealed that the RUNX3 intronic T/A polymorphism (rs760805) might modulate the risk of gastric atrophy among H. pylori seropositive subjects, and the RUNX3 T/A polymorphism at exon 1 (rs6672420) had little influence on the risks of H. pylori infection, gastric atrophy or gastric cancer in Japanese people. | 0.018186605 | 2009 | RUNX3 | 1 | 24925432 | A | T |
| rs760805 | 23959374 | 864 | RUNX3 | umls:C0024623 | BeFree | Runt-related transcription factor 3: single nucleotide polymorphism rs760805, gene expression, and methylation status in Helicobacter pylori -infected patients for determination of gastric cancer risk. | 0.018186605 | 2014 | RUNX3 | 1 | 24925432 | A | T |
| rs763780 | 25338988 | 3605 | IL17A | umls:C0024623 | BeFree | Our meta analysis reveal the IL-17A rs763780T>C gene polymorphism is involved in risk of gastric cancer but not other tumor types. | 0.008610195 | 2015 | IL17F;LOC105375088 | 6 | 52236941 | T | C |
| rs763780 | 25147431 | 112744 | IL17F | umls:C0024623 | BeFree | The IL-17F rs763780T>C polymorphism was also significantly associated with gastric cancer development. | 0.003995683 | 2014 | IL17F;LOC105375088 | 6 | 52236941 | T | C |
| rs77375493 | 20306156 | 3717 | JAK2 | umls:C0024623 | BeFree | The development of gastric cancer in a patient with polycythemia Vera, 3P deletion, and JAK2 V617F mutation. | 0.002442977 | 2010 | JAK2;INSL6 | 9 | 5073770 | G | A,T |
| rs7804372 | 24065198 | 857 | CAV1 | umls:C0024623 | BeFree | Interaction among Caveolin-1 genotypes (rs3807987/rs7804372), H. pylori infection, and risk of gastric cancer in a Chinese population. | 0.002714419 | 2013 | CAV1 | 7 | 116554174 | T | A |
| rs7853122 | 21698158 | 2048 | EPHB2 | umls:C0024623 | BeFree | In the extension analyses, ERK rs5999749, Dock180 rs4635002 and C3G rs7853122 showed marginally significant gene-dose effects for gastric cancer. | 0.007057489 | 2011 | RAPGEF1 | 9 | 131705224 | C | T |
| rs7853122 | 21698158 | 1793 | DOCK1 | umls:C0024623 | BeFree | In the extension analyses, ERK rs5999749, Dock180 rs4635002 and C3G rs7853122 showed marginally significant gene-dose effects for gastric cancer. | 0.000271442 | 2011 | RAPGEF1 | 9 | 131705224 | C | T |
| rs799917 | 25266802 | 672 | BRCA1 | umls:C0024623 | BeFree | The functional BRCA1 rs799917 genetic polymorphism is associated with gastric cancer risk in a Chinese Han population. | 0.003528744 | 2014 | BRCA1 | 17 | 43092919 | G | T,C,A |
| rs804270 | 26373042 | 4193 | MDM2 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.007795869 | 2015 | NEIL2 | 8 | 11770112 | G | C |
| rs804270 | 26554163 | 8000 | PSCA | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.009771907 | 2016 | NEIL2 | 8 | 11770112 | G | C |
| rs804270 | 26554163 | 51196 | PLCE1 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.124071628 | 2016 | NEIL2 | 8 | 11770112 | G | C |
| rs804270 | 26373042 | 1571 | CYP2E1 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.019359587 | 2015 | NEIL2 | 8 | 11770112 | G | C |
| rs804270 | 26554163 | 252969 | NEIL2 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.000542884 | 2016 | NEIL2 | 8 | 11770112 | G | C |
| rs804270 | 26554163 | 596 | BCL2 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.015200745 | 2016 | NEIL2 | 8 | 11770112 | G | C |
| rs804270 | 26373042 | 252969 | NEIL2 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.000542884 | 2015 | NEIL2 | 8 | 11770112 | G | C |
| rs804270 | 26373042 | 328 | APEX1 | umls:C0024623 | BeFree | In conclusion, variant alleles in the NEIL2 (rs804270), APE1 (rs2275008), CYP2E1 (rs2031920) and MDM2 (rs2279744) SNPs may independently influence susceptibility to gastric cancer in a Northern Jiangsu Chinese population. | 0.002442977 | 2015 | NEIL2 | 8 | 11770112 | G | C |
| rs804270 | 26373042 | 9360 | PPIG | umls:C0024623 | BeFree | Risk analysis revealed that there was increased risk for gastric cancer in subjects with mutant alleles in APE 1 (rs2275008: OR 5.49, 95% CI = 2.6-5.7, p <.0001), NEIL 2 (rs804270: OR 2.3, 95% CI = 1.22-4.3, p=0.01), MDM2 (rs2279744: OR 14.65, 95% CI = 5.63-8.15, p < .0001), and CYP 2E1 (rs2031920: OR 8.385, 95% CI = 3.2-5.3, p < .0001) SNPs. | 0.000814326 | 2015 | NEIL2 | 8 | 11770112 | G | C |
| rs8126 | 23724109 | 406960 | MIR184 | umls:C0024623 | BeFree | The miR-184 binding-site rs8126 T>C polymorphism in TNFAIP2 is associated with risk of gastric cancer. | 0.000271442 | 2013 | TNFAIP2;LOC105370684 | 14 | 103137232 | C | T |
| rs8126 | 23724109 | 7127 | TNFAIP2 | umls:C0024623 | BeFree | The miR-184 binding-site rs8126 T>C polymorphism in TNFAIP2 is associated with risk of gastric cancer. | 0.000271442 | 2013 | TNFAIP2;LOC105370684 | 14 | 103137232 | C | T |
| rs8506 | 24595048 | 732253 | TDRG1 | umls:C0024623 | BeFree | The has-miR-526b binding-site rs8506G>a polymorphism in the lincRNA-NR_024015 exon identified by GWASs predispose to non-cardia gastric cancer risk. | 0.000271442 | 2014 | TDRG1 | 6 | 40379813 | C | T |
| rs861530 | 21347786 | 7517 | XRCC3 | umls:C0024623 | BeFree | In R0 resected patients, XRCC3 variants (rs861539, P = 0.04; rs861530, P = 0.02) in esophageal cancer, and XRCC3 (rs1799794, P = 0.02) and MTHFR (rs1801131, P = 0.005) in gastric cancer predicted survival. | 0.007448483 | 2011 | XRCC3 | 14 | 103707786 | T | C |
| rs861539 | 20817763 | 7517 | XRCC3 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.007448483 | 2010 | KLC1;XRCC3 | 14 | 103699416 | G | A |
| rs861539 | 20817763 | 4968 | OGG1 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.012529933 | 2010 | KLC1;XRCC3 | 14 | 103699416 | G | A |
| rs861539 | 20817763 | 2067 | ERCC1 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.010434343 | 2010 | KLC1;XRCC3 | 14 | 103699416 | G | A |
| rs861539 | 21347786 | 7517 | XRCC3 | umls:C0024623 | BeFree | In R0 resected patients, XRCC3 variants (rs861539, P = 0.04; rs861530, P = 0.02) in esophageal cancer, and XRCC3 (rs1799794, P = 0.02) and MTHFR (rs1801131, P = 0.005) in gastric cancer predicted survival. | 0.007448483 | 2011 | KLC1;XRCC3 | 14 | 103699416 | G | A |
| rs861539 | 24315014 | 7517 | XRCC3 | umls:C0024623 | BeFree | XRCC3 Thr241Met polymorphism and gastric cancer susceptibility: a meta-analysis. | 0.007448483 | 2013 | KLC1;XRCC3 | 14 | 103699416 | G | A |
| rs861539 | 20817763 | 4255 | MGMT | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.006710102 | 2010 | KLC1;XRCC3 | 14 | 103699416 | G | A |
| rs861539 | 20817763 | 2068 | ERCC2 | umls:C0024623 | BeFree | Polymorphic variants of base excision repair (APE1-D148E, XRCC1-R194W, XRCC1-R399Q and OGG1-S326C), nucleotide excision repair (XPC-PAT, XPA-23G>A, ERCC1-19007T>C and XPD-L751Q), recombination (XRCC3-T241M) and alkylation damage reversal (MGMT-L84F) were tested for their potential role in the development of GC by using logistic regression models. | 0.011911105 | 2010 | KLC1;XRCC3 | 14 | 103699416 | G | A |
| rs861539 | 15019159 | 7517 | XRCC3 | umls:C0024623 | BeFree | Polymorphisms of DNA repair gene XRCC3 Thr241Met and risk of gastric cancer in a Chinese population. | 0.007448483 | 2004 | KLC1;XRCC3 | 14 | 103699416 | G | A |
| rs861539 | 25973083 | 7517 | XRCC3 | umls:C0024623 | BeFree | Association of XRCC3 gene rs861539 polymorphism with gastric cancer risk: evidence from a case-control study and a meta-analysis. | 0.007448483 | 2014 | KLC1;XRCC3 | 14 | 103699416 | G | A |
| rs861539 | 20549576 | 7517 | XRCC3 | umls:C0024623 | BeFree | Relationship between XRCC3 T241M polymorphism and gastric cancer risk: a meta-analysis. | 0.007448483 | 2011 | KLC1;XRCC3 | 14 | 103699416 | G | A |
| rs861539 | 24197974 | 7517 | XRCC3 | umls:C0024623 | BeFree | Quantitative assessment of the associations between DNA repair gene XRCC3 Thr241Met polymorphism and gastric cancer. | 0.007448483 | 2013 | KLC1;XRCC3 | 14 | 103699416 | G | A |
| rs895819 | 25795117 | 406941 | MIR149 | umls:C0024623 | BeFree | In summary, miR-27a rs895819 and miR-149 rs2292832 are of potential forewarning ability for gastric cancer risk. | 0.001085767 | 2014 | LOC284454;MIR23A;MIR24-2;MIR27A | 19 | 13836478 | T | A,C,G |
| rs895819 | 20666778 | 65986 | ZBTB10 | umls:C0024623 | BeFree | In conclusion, we were the first to show that a common polymorphism (rs895819) in hsa-mir-27a, by modulating miR-27a and ZBTB10 levels, acted as an important factor of the gastric cancer susceptibility. | 0.000271442 | 2010 | LOC284454;MIR23A;MIR24-2;MIR27A | 19 | 13836478 | T | A,C,G |
| rs909253 | 26554163 | 252969 | NEIL2 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.000542884 | 2016 | LTA;LOC100287329 | 6 | 31572536 | A | G |
| rs909253 | 26554163 | 51196 | PLCE1 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.124071628 | 2016 | LTA;LOC100287329 | 6 | 31572536 | A | G |
| rs909253 | 26554163 | 8000 | PSCA | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.009771907 | 2016 | LTA;LOC100287329 | 6 | 31572536 | A | G |
| rs909253 | 26554163 | 596 | BCL2 | umls:C0024623 | BeFree | Genetic Variation of BCL2 (rs2279115), NEIL2 (rs804270), LTA (rs909253), PSCA (rs2294008) and PLCE1 (rs3765524, rs10509670) Genes and Their Correlation to Gastric Cancer Risk Based on Universal Tagged Arrays and Fe3O4 Magnetic Nanoparticles. | 0.015200745 | 2016 | LTA;LOC100287329 | 6 | 31572536 | A | G |
| rs909253 | 22748850 | 4049 | LTA | umls:C0024623 | BeFree | A functional polymorphism of lymphotoxin-alpha (LTA) gene rs909253 is associated with gastric cancer risk in an Asian population. | 0.009001189 | 2012 | LTA;LOC100287329 | 6 | 31572536 | A | G |
| rs9297976 | 24023815 | 8000 | PSCA | umls:C0024623 | BeFree | We analyzed 3 SNPs in the PSCA gene (rs2294008, rs9297976 and rs12155758) which were previously found to be associated with GC risk in Europeans. | 0.009771907 | 2013 | PSCA;JRK | 8 | 142670817 | T | C |
| rs9471643 | 24586594 | 406881 | MIRLET7A1 | umls:C0024623 | BeFree | An interaction effect of pri-let-7a-1 rs10739971 polymorphism with ERCC6 rs1917799 polymorphism was observed for the risk of gastric cancer (P interaction = 0.026); and interaction effects of pri-let-7a-1 rs10739971 polymorphism with PGC rs6458238 polymorphism (P interaction = 0.012) and PGC rs9471643 polymorphism (P interaction = 0.039) were observed for the risk of atrophic gastritis. | 0.000271442 | 2014 | NA | 6 | 41751177 | G | C |
| rs9841504 | 22037551 | 5562 | PRKAA1 | umls:C0024623 | BeFree | We identified two new susceptibility loci for non-cardia gastric cancer at 5p13.1 (rs13361707 in the region including PTGER4 and PRKAA1; odds ratio (OR) = 1.41; P = 7.6 × 10(-29)) and 3q13.31 (rs9841504 in ZBTB20; OR = 0.76; P = 1.7 × 10(-9)). | 0.121900093 | 2011 | ZBTB20 | 3 | 114643917 | C | G |
| rs9841504 | 22037551 | 26137 | ZBTB20 | umls:C0024623 | BeFree | We identified two new susceptibility loci for non-cardia gastric cancer at 5p13.1 (rs13361707 in the region including PTGER4 and PRKAA1; odds ratio (OR) = 1.41; P = 7.6 × 10(-29)) and 3q13.31 (rs9841504 in ZBTB20; OR = 0.76; P = 1.7 × 10(-9)). | 0.120542884 | 2011 | ZBTB20 | 3 | 114643917 | C | G |
| rs9841504 | 22037551 | 5734 | PTGER4 | umls:C0024623 | BeFree | We identified two new susceptibility loci for non-cardia gastric cancer at 5p13.1 (rs13361707 in the region including PTGER4 and PRKAA1; odds ratio (OR) = 1.41; P = 7.6 × 10(-29)) and 3q13.31 (rs9841504 in ZBTB20; OR = 0.76; P = 1.7 × 10(-9)). | 0.000542884 | 2011 | ZBTB20 | 3 | 114643917 | C | G |
| rs9841504 | 23861218 | 5734 | PTGER4 | umls:C0024623 | BeFree | A recent genome-wide association study (GWAS) identified new susceptibility single-nucleotide polymorphisms (SNPs) rs13361707 (PRKAA1 and PTGER4 gene on 5p13.1) and rs9841504 (ZBTB20 gene on 3q13.31) that were significantly associated with non-cardia gastric cancer. | 0.000542884 | 2013 | ZBTB20 | 3 | 114643917 | C | G |
| rs9841504 | 22037551 | 26137 | ZBTB20 | umls:C0024623 | GWASCAT | We identified two new susceptibility loci for non-cardia gastric cancer at 5p13.1 (rs13361707 in the region including PTGER4 and PRKAA1; odds ratio (OR) = 1.41; P = 7.6 × 10(-29)) and 3q13.31 (rs9841504 in ZBTB20; OR = 0.76; P = 1.7 × 10(-9)). | 0.120542884 | 2011 | ZBTB20 | 3 | 114643917 | C | G |
| rs9904341 | 21161671 | 332 | BIRC5 | umls:C0024623 | BeFree | The present result suggests that the presence of the C allele of -31C/G Survivin promoter polymorphism in combination with D17S250 instability may be used as a risk factor for gastric cancer in our population. | 0.004885954 | 2011 | BIRC5 | 17 | 78214286 | G | C |
