PedAM

Pediatric Disease Annotations & Medicines


	dravet syndrome

Disease ID	133
Disease	dravet syndrome
Definition	A severe form of epilepsy that presents in early childhood and is characterized by frequent, prolonged febrile or myoclonic seizures that may progress to status epilepticus and poor development of language, motor, and socialization skills.
Synonym	dravet syndromes eiee6 epilepsy, myoclonic, infantile, severe epileptic encephalopathy, early infantile, 6 infantile severe myoclonic epilepsy myoclonic epilepsy, infantile, severe myoclonic epilepsy, severe infantile myoclonic epilepsy, severe, of infancy severe infantile myoclonic epilepsy severe myoclonic epilepsy in infancy severe myoclonic epilepsy in infancy (disorder) severe myoclonic epilepsy of infancy severe myoclonic epilepsy, infantile smei syndrome, dravet syndromes, dravet
Orphanet	ORPHANET:33069
OMIM	OMIM:607208
DOID	DOID:0060171
UMLS	C0751122
SNOMED-CT	SNOMEDCT_US_2016_09_01:230437002
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:8) C0014544 \| epilepsy \| 4 C0038220 \| status epilepticus \| 3 C0014544 \| epileptic seizures \| 1 C0037317 \| sleep disturbance \| 1 C0014544 \| epileptic seizure \| 1 C0751651 \| mitochondrial disease \| 1 C0004352 \| autism \| 1 C0751265 \| learning disability \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:8) SCN1A \| 6323 \| CLINVAR;ORPHANET;UNIPROT SCN1B \| 6324 \| ORPHANET GABRA1 \| 2554 \| ORPHANET PCDH19 \| 57526 \| ORPHANET SCN9A \| 6335 \| ORPHANET GABRG2 \| 2566 \| ORPHANET SCN2A \| 6326 \| ORPHANET STXBP1 \| 6812 \| ORPHANET
Inferring Gene	Entrez_id \| Symbol \| Resource(Total Genes:1) 6323 \| SCN1A \| infer
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:89) 2554 \| GABRA1 \| DISEASES 112755 \| STX1B \| DISEASES 5816 \| PVALB \| DISEASES 140679 \| SLC32A1 \| DISEASES 55163 \| PNPO \| DISEASES 3131 \| HLF \| DISEASES 3641 \| INSL4 \| DISEASES 23229 \| ARHGEF9 \| DISEASES 2016 \| EMX1 \| DISEASES 57575 \| PCDH10 \| DISEASES 1181 \| CLCN2 \| DISEASES 5428 \| POLG \| DISEASES 2044 \| EPHA5 \| DISEASES 2559 \| GABRA6 \| DISEASES 2561 \| GABRB2 \| DISEASES 6327 \| SCN2B \| DISEASES 6328 \| SCN3A \| DISEASES 6326 \| SCN2A \| DISEASES 1476 \| CSTB \| DISEASES 57465 \| TBC1D24 \| DISEASES 256471 \| MFSD8 \| DISEASES 2562 \| GABRB3 \| DISEASES 6323 \| SCN1A \| DISEASES 53343 \| NUDT9 \| DISEASES 3954 \| LETM1 \| DISEASES 5978 \| REST \| DISEASES 27319 \| BHLHE22 \| DISEASES 79751 \| SLC25A22 \| DISEASES 6330 \| SCN4B \| DISEASES 11284 \| PNKP \| DISEASES 51733 \| UPB1 \| DISEASES 5504 \| PPP1R2 \| DISEASES 51400 \| PPME1 \| DISEASES 84679 \| SLC9A7 \| DISEASES 23236 \| PLCB1 \| DISEASES 2290 \| FOXG1 \| DISEASES 89910 \| UBE3B \| DISEASES 1544 \| CYP1A2 \| DISEASES 378884 \| NHLRC1 \| DISEASES 9863 \| MAGI2 \| DISEASES 6334 \| SCN8A \| DISEASES 7453 \| WARS \| DISEASES 122786 \| FRMD6 \| DISEASES 2555 \| GABRA2 \| DISEASES 8913 \| CACNA1G \| DISEASES 3785 \| KCNQ2 \| DISEASES 10319 \| LAMC3 \| DISEASES 1745 \| DLX1 \| DISEASES 7957 \| EPM2A \| DISEASES 1805 \| DPT \| DISEASES 1141 \| CHRNB2 \| DISEASES 9900 \| SV2A \| DISEASES 10479 \| SLC9A6 \| DISEASES 114327 \| EFHC1 \| DISEASES 1557 \| CYP2C19 \| DISEASES 9211 \| LGI1 \| DISEASES 57582 \| KCNT1 \| DISEASES 6709 \| SPTAN1 \| DISEASES 57526 \| PCDH19 \| DISEASES 6812 \| STXBP1 \| DISEASES 1741 \| DLG3 \| DISEASES 1269 \| CNR2 \| DISEASES 2259 \| FGF14 \| DISEASES 2563 \| GABRD \| DISEASES 170302 \| ARX \| DISEASES 6792 \| CDKL5 \| DISEASES 3736 \| KCNA1 \| DISEASES 3786 \| KCNQ3 \| DISEASES 6263 \| RYR3 \| DISEASES 2617 \| GARS \| DISEASES 5091 \| PC \| DISEASES 1106 \| CHD2 \| DISEASES 782 \| CACNB1 \| DISEASES 4356 \| MPP3 \| DISEASES 6335 \| SCN9A \| DISEASES 6332 \| SCN7A \| DISEASES 501 \| ALDH7A1 \| DISEASES 27247 \| NFU1 \| DISEASES 57282 \| SLC4A10 \| DISEASES 4204 \| MECP2 \| DISEASES 6324 \| SCN1B \| DISEASES 154881 \| KCTD7 \| DISEASES 6635 \| SNRPE \| DISEASES 2566 \| GABRG2 \| DISEASES 23270 \| TSPYL4 \| DISEASES 6513 \| SLC2A1 \| DISEASES 10243 \| GPHN \| DISEASES 785 \| CACNB4 \| DISEASES 4566 \| MT-TK \| DISEASES
Locus	Symbol \| Locus(Total Locus:8) SCN1B \| 19q13.11 SCN1A \| 2q24.3 GABRG2 \| 5q34 STXBP1 \| 9q34.11 SCN9A \| 2q24.3 GABRA1 \| 5q34 SCN2A \| 2q24.3 PCDH19 \| Xq22.1

Disease ID	133
Disease	dravet syndrome
Integrated Phenotype	HPO \| Name(Total Integrated Phenotypes:17) HP:0001251 \| Ataxia HP:0012758 \| Neurodevelopmental delay HP:0000992 \| Cutaneous photosensitivity HP:0007334 \| Bilateral convulsive seizures HP:0002121 \| Absence seizures HP:0000708 \| Behavioral abnormality HP:0011151 \| Obtundation status HP:0001250 \| Seizures HP:0002373 \| Febrile seizures HP:0002384 \| Focal seizures with impairment of consciousness or awareness HP:0001263 \| Global developmental delay HP:0002266 \| Focal clonic seizures HP:0002353 \| EEG abnormality HP:0002123 \| Generalized myoclonic seizures HP:0001252 \| Muscular hypotonia HP:0001337 \| Tremor HP:0002197 \| Generalized seizures
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:11) HP:0001250 \| Seizures \| 16 HP:0001298 \| Encephalopathy \| 4 HP:0002133 \| Status epilepticus \| 3 HP:0010819 \| drop attacks \| 3 HP:0006846 \| Acute encephalopathy \| 2 HP:0000717 \| Autism \| 1 HP:0200134 \| Epileptic encephalopathy \| 1 HP:0002360 \| Sleep disturbance \| 1 HP:0002180 \| Neurodegeneration \| 1 HP:0011170 \| Myoclonic atonic seizures \| 1 HP:0002373 \| Febrile convulsions \| 1

Disease ID	133
Disease	dravet syndrome
Manually Symptom	UMLS \| Name(Total Manually Symptoms:4) C0751494 \| convulsive seizures C0543888 \| epileptic encephalopathy C0038220 \| status epilepticus C0014544 \| epilepsy
Text Mined Symptom	UMLS \| Name \| Sentences' Count(Total Symptoms:4) C0014544 \| epilepsy \| 4 C0038220 \| status epilepticus \| 3 C0751494 \| convulsive seizures \| 2 C0543888 \| epileptic encephalopathy \| 1

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:284)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs121917907	20729507	6323	SCN1A	umls:C0751122	UNIPROT	Genotype-phenotype correlations in a group of 15 SCN1A-mutated Italian patients with GEFS+ spectrum (seizures plus, classical and borderline severe myoclonic epilepsy of infancy).	0.370955127	2010	SCN1A	2	166073435	A	G
rs121917908	20729507	6323	SCN1A	umls:C0751122	UNIPROT	Genotype-phenotype correlations in a group of 15 SCN1A-mutated Italian patients with GEFS+ spectrum (seizures plus, classical and borderline severe myoclonic epilepsy of infancy).	0.370955127	2010	SCN1A;LOC102724058	2	165999764	C	T,G
rs121917909	20729507	6323	SCN1A	umls:C0751122	UNIPROT	Genotype-phenotype correlations in a group of 15 SCN1A-mutated Italian patients with GEFS+ spectrum (seizures plus, classical and borderline severe myoclonic epilepsy of infancy).	0.370955127	2010	SCN1A	2	166051967	G	A
rs121917911	12821740	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A;LOC102724058	2	166013752	C	G
rs121917912	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A;LOC102724058	2	166012254	C	T
rs121917913	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A;LOC102724058	2	166002491	T	C
rs121917914	17561957	6323	SCN1A	umls:C0751122	UNIPROT	This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes.	0.370955127	2007	SCN1A;LOC102724058	2	165992387	C	T
rs121917915	17561957	6323	SCN1A	umls:C0751122	UNIPROT	This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes.	0.370955127	2007	SCN1A;LOC102724058	2	165994176	C	A
rs121917916	17561957	6323	SCN1A	umls:C0751122	UNIPROT	This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes.	0.370955127	2007	SCN1A;LOC102724058	2	165991916	C	T
rs121917917	17561957	6323	SCN1A	umls:C0751122	UNIPROT	This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes.	0.370955127	2007	SCN1A	2	166037852	C	A
rs121917918	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166058651	C	T
rs121917918	14738421	6323	SCN1A	umls:C0751122	UNIPROT	Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB).	0.370955127	2004	SCN1A	2	166058651	C	T
rs121917919	17561957	6323	SCN1A	umls:C0751122	UNIPROT	This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes.	0.370955127	2007	SCN1A;LOC102724058	2	165994236	A	G
rs121917920	17561957	6323	SCN1A	umls:C0751122	UNIPROT	This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes.	0.370955127	2007	SCN1A	2	166047731	T	C
rs121917921	17561957	6323	SCN1A	umls:C0751122	UNIPROT	This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes.	0.370955127	2007	SCN1A;LOC102724058	2	165991927	G	A
rs121917922	17561957	6323	SCN1A	umls:C0751122	UNIPROT	This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes.	0.370955127	2007	SCN1A;LOC102724058	2	165992302	G	C,A
rs121917922	18930999	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients.	0.370955127	2009	SCN1A;LOC102724058	2	165992302	G	C,A
rs121917923	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166047725	G	T,A
rs121917923	17561957	6323	SCN1A	umls:C0751122	UNIPROT	This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes.	0.370955127	2007	SCN1A	2	166047725	G	T,A
rs121917924	17561957	6323	SCN1A	umls:C0751122	UNIPROT	This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes.	0.370955127	2007	SCN1A;LOC102724058	2	165998106	C	A
rs121917925	17561957	6323	SCN1A	umls:C0751122	UNIPROT	This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes.	0.370955127	2007	SCN1A;LOC102724058	2	166002516	T	A
rs121917926	17561957	6323	SCN1A	umls:C0751122	UNIPROT	This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes.	0.370955127	2007	SCN1A;LOC102724058	2	165992129	A	G
rs121917927	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166046969	C	T
rs121917927	12754708	6323	SCN1A	umls:C0751122	UNIPROT	De novo SCN1A mutations are a major cause of severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A	2	166046969	C	T
rs121917928	17561957	6323	SCN1A	umls:C0751122	UNIPROT	This study confirms the high sensitivity of SCN1A for SMEI/SMEB phenotypes.	0.370955127	2007	SCN1A	2	166048949	C	A
rs121917929	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A	2	166046970	G	T,A
rs121917929	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166046970	G	T,A
rs121917933	12821740	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A	2	166073388	C	A
rs121917934	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A	2	166054756	T	G
rs121917935	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A	2	166054660	C	T
rs121917936	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A	2	166052896	G	T
rs121917937	12821740	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A	2	166052866	A	C
rs121917937	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166052866	A	C
rs121917938	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166051845	A	G
rs121917938	12821740	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A	2	166051845	A	G
rs121917939	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A	2	166047648	G	C
rs121917940	12821740	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A	2	166046871	A	T
rs121917941	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A	2	166039577	G	C
rs121917942	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A	2	166039476	C	T
rs121917943	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A	2	166037897	A	G
rs121917944	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A;LOC102724058	2	166002479	A	C
rs121917945	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A;LOC102724058	2	165998162	G	A
rs121917946	12821740	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A;LOC102724058	2	165998126	A	G
rs121917947	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A;LOC102724058	2	165998090	A	G
rs121917948	12821740	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A;LOC102724058	2	165992273	G	C
rs121917949	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A;LOC102724058	2	165992134	A	G,C
rs121917950	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A;LOC102724058	2	165991990	C	T
rs121917951	17054684	6323	SCN1A	umls:C0751122	UNIPROT	Familial occurrence of febrile seizures and epilepsy in severe myoclonic epilepsy of infancy (SMEI) patients with SCN1A mutations.	0.370955127	2006	SCN1A;LOC102724058	2	165991957	G	A
rs121917952	12821740	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A;LOC102724058	2	165991936	A	G
rs121917957	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166047667	C	T
rs121917958	18413471	6323	SCN1A	umls:C0751122	UNIPROT	An additional search for SCN1A intragenic microdeletions in the remaining patients with SMEI/SMEI-borderland and no point mutations was also negative.	0.370955127	2008	SCN1A	2	166047699	A	T,G
rs121917959	18413471	6323	SCN1A	umls:C0751122	UNIPROT	An additional search for SCN1A intragenic microdeletions in the remaining patients with SMEI/SMEI-borderland and no point mutations was also negative.	0.370955127	2008	SCN1A	2	166058599	C	T,G
rs121917960	18413471	6323	SCN1A	umls:C0751122	UNIPROT	An additional search for SCN1A intragenic microdeletions in the remaining patients with SMEI/SMEI-borderland and no point mutations was also negative.	0.370955127	2008	SCN1A;LOC102724058	2	166002753	C	T
rs121917961	18413471	6323	SCN1A	umls:C0751122	UNIPROT	An additional search for SCN1A intragenic microdeletions in the remaining patients with SMEI/SMEI-borderland and no point mutations was also negative.	0.370955127	2008	SCN1A;LOC102724058	2	166002683	C	G
rs121917962	18413471	6323	SCN1A	umls:C0751122	UNIPROT	An additional search for SCN1A intragenic microdeletions in the remaining patients with SMEI/SMEI-borderland and no point mutations was also negative.	0.370955127	2008	SCN1A;LOC102724058	2	165998129	T	C
rs121917963	18413471	6323	SCN1A	umls:C0751122	UNIPROT	An additional search for SCN1A intragenic microdeletions in the remaining patients with SMEI/SMEI-borderland and no point mutations was also negative.	0.370955127	2008	SCN1A;LOC102724058	2	166013829	A	G
rs121917964	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A	2	166073371	T	C
rs121917965	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A	2	166058652	G	A
rs121917965	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166058652	G	A
rs121917966	16713920	6323	SCN1A	umls:C0751122	UNIPROT	Clinical-molecular correlation showed mutations in eight of eight cases with phenotypes of SMEI, in three of four cases with borderline SMEI, but not in two cases with Lennox-Gastaut syndrome.	0.370955127	2006	SCN1A	2	166046940	A	G
rs121917967	16713920	6323	SCN1A	umls:C0751122	UNIPROT	Clinical-molecular correlation showed mutations in eight of eight cases with phenotypes of SMEI, in three of four cases with borderline SMEI, but not in two cases with Lennox-Gastaut syndrome.	0.370955127	2006	SCN1A	2	166046910	A	T
rs121917968	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A	2	166041298	A	G
rs121917969	14738421	6323	SCN1A	umls:C0751122	UNIPROT	Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB).	0.370955127	2004	SCN1A	2	166037891	A	G
rs121917970	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A	2	166037889	A	G
rs121917971	14738421	6323	SCN1A	umls:C0751122	UNIPROT	Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB).	0.370955127	2004	SCN1A	2	166037885	C	T,G
rs121917971	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037885	C	T,G
rs121917972	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A	2	166037873	C	T
rs121917973	16713920	6323	SCN1A	umls:C0751122	UNIPROT	Clinical-molecular correlation showed mutations in eight of eight cases with phenotypes of SMEI, in three of four cases with borderline SMEI, but not in two cases with Lennox-Gastaut syndrome.	0.370955127	2006	SCN1A;LOC102724058	2	166012274	T	G
rs121917974	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A;LOC102724058	2	165999740	C	G
rs121917975	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A;LOC102724058	2	165994365	T	C
rs121917976	16713920	6323	SCN1A	umls:C0751122	UNIPROT	Clinical-molecular correlation showed mutations in eight of eight cases with phenotypes of SMEI, in three of four cases with borderline SMEI, but not in two cases with Lennox-Gastaut syndrome.	0.370955127	2006	SCN1A;LOC102724058	2	165992341	C	T,G
rs121917977	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A;LOC102724058	2	165992156	A	C
rs121917978	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A;LOC102724058	2	165992113	G	T,C
rs121917979	19589774	6323	SCN1A	umls:C0751122	UNIPROT	De novo SCN1A mutations in Dravet syndrome and related epileptic encephalopathies are largely of paternal origin.	0.370955127	2010	SCN1A;LOC102724058	2	165992099	A	G
rs121917980	18930999	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients.	0.370955127	2009	SCN1A;LOC102724058	2	165991928	C	T
rs121917981	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A;LOC102724058	2	165991510	A	G
rs121917982	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A	2	166073387	C	G
rs121917983	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A	2	166054644	G	C
rs121917984	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166052869	G	C,A
rs121917984	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A	2	166052869	G	C,A
rs121917985	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A	2	166051968	C	T
rs121917985	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166051968	C	T
rs121917986	12083760	6323	SCN1A	umls:C0751122	UNIPROT	Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy.	0.370955127	2002	SCN1A;LOC102724058	2	166002588	C	T,G
rs121917987	16713920	6323	SCN1A	umls:C0751122	UNIPROT	Clinical-molecular correlation showed mutations in eight of eight cases with phenotypes of SMEI, in three of four cases with borderline SMEI, but not in two cases with Lennox-Gastaut syndrome.	0.370955127	2006	SCN1A;LOC102724058	2	166002570	A	C
rs121917989	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166046882	A	T,G
rs121917990	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A	2	166043836	T	C
rs121917990	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166043836	T	C
rs121917993	17347258	6323	SCN1A	umls:C0751122	UNIPROT	The relationship between severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome) and the related syndrome SMEI-borderland (SMEB) with mutations in the sodium channel alpha 1 subunit gene SCN1A is well established.	0.370955127	2007	SCN1A;LOC102724058	2	165994212	G	A
rs121918622	10742094	6323	SCN1A	umls:C0751122	UNIPROT	Mutations of SCN1A, encoding a neuronal sodium channel, in two families with GEFS+2.	0.370955127	2000	SCN1A;LOC102724058	2	165992332	C	T,A
rs121918623	10742094	6323	SCN1A	umls:C0751122	UNIPROT	Mutations of SCN1A, encoding a neuronal sodium channel, in two families with GEFS+2.	0.370955127	2000	SCN1A	2	166038098	G	T,A
rs121918623	18930999	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients.	0.370955127	2009	SCN1A	2	166038098	G	T,A
rs121918624	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166052882	G	A
rs121918625	11359211	6323	SCN1A	umls:C0751122	UNIPROT	De novo mutations in the sodium-channel gene SCN1A cause severe myoclonic epilepsy of infancy.	0.370955127	2001	SCN1A;LOC102724058	2	166036521	G	A
rs121918625	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A;LOC102724058	2	166036521	G	A
rs121918629	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A;LOC102724058	2	165992149	G	A
rs121918630	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A;LOC102724058	2	165994167	C	A
rs121918733	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166058684	A	G
rs121918733	20431604	6323	SCN1A	umls:C0751122	UNIPROT	Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome.	0.370955127	2010	SCN1A	2	166058684	A	G
rs121918734	20431604	6323	SCN1A	umls:C0751122	UNIPROT	Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome.	0.370955127	2010	SCN1A	2	166058681	A	G
rs121918734	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166058681	A	G
rs121918735	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166051906	G	T,A
rs121918735	20431604	6323	SCN1A	umls:C0751122	UNIPROT	Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome.	0.370955127	2010	SCN1A	2	166051906	G	T,A
rs121918736	20431604	6323	SCN1A	umls:C0751122	UNIPROT	Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome.	0.370955127	2010	SCN1A	2	166037907	G	A
rs121918736	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037907	G	A
rs121918737	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037868	A	C
rs121918737	20431604	6323	SCN1A	umls:C0751122	UNIPROT	Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome.	0.370955127	2010	SCN1A	2	166037868	A	C
rs121918738	20431604	6323	SCN1A	umls:C0751122	UNIPROT	Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome.	0.370955127	2010	SCN1A;LOC102724058	2	166013820	G	T,A
rs121918739	20431604	6323	SCN1A	umls:C0751122	UNIPROT	Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome.	0.370955127	2010	SCN1A;LOC102724058	2	166012210	T	G
rs121918740	20431604	6323	SCN1A	umls:C0751122	UNIPROT	Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome.	0.370955127	2010	SCN1A;LOC102724058	2	166012128	A	G
rs121918741	20431604	6323	SCN1A	umls:C0751122	UNIPROT	Analysis of SCN1A mutation and parental origin in patients with Dravet syndrome.	0.370955127	2010	SCN1A;LOC102724058	2	165999763	C	T
rs121918742	18930999	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients.	0.370955127	2009	SCN1A;LOC102724058	2	165994241	C	T,G
rs121918743	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A	2	166058646	T	C
rs121918744	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A;LOC102724058	2	165992221	G	T,A
rs121918745	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A	2	166058618	G	A
rs121918746	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A;LOC102724058	2	166013756	A	T,G
rs121918747	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A;LOC102724058	2	166036523	T	A
rs121918748	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A;LOC102724058	2	165991783	A	G
rs121918749	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A	2	166051890	C	A
rs121918750	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A	2	166037844	T	C
rs121918751	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A;LOC102724058	2	165991841	A	C
rs121918752	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A;LOC102724058	2	166012199	G	C
rs121918753	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A	2	166048886	C	T
rs121918754	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A	2	166037787	C	T
rs121918755	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A;LOC102724058	2	165992381	G	A
rs121918756	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A;LOC102724058	2	166036529	A	G
rs121918757	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A;LOC102724058	2	165991853	A	G
rs121918758	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A	2	166039590	T	A
rs121918759	12566275	6323	SCN1A	umls:C0751122	UNIPROT	Here we suggest that SMEI and ICEGTC represent a continuum with minor phenotypic and genotypic differences.	0.370955127	2003	SCN1A;LOC102724058	2	166036445	T	A
rs121918760	18930999	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients.	0.370955127	2009	SCN1A;LOC102724058	2	166002655	A	T
rs121918761	18930999	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients.	0.370955127	2009	SCN1A	2	166058582	A	T
rs121918762	18930999	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients.	0.370955127	2009	SCN1A	2	166054669	T	A
rs121918763	18930999	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients.	0.370955127	2009	SCN1A;LOC102724058	2	165991929	G	C,A
rs121918764	20522430	6323	SCN1A	umls:C0751122	UNIPROT	Mechanisms for variable expressivity of inherited SCN1A mutations causing Dravet syndrome.	0.370955127	2010	SCN1A;LOC102724058	2	165996053	A	G
rs121918765	18930999	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients.	0.370955127	2009	SCN1A;LOC102724058	2	165992284	A	T
rs121918766	19589774	6323	SCN1A	umls:C0751122	UNIPROT	De novo SCN1A mutations in Dravet syndrome and related epileptic encephalopathies are largely of paternal origin.	0.370955127	2010	SCN1A	2	166054728	A	T
rs121918767	19589774	6323	SCN1A	umls:C0751122	UNIPROT	De novo SCN1A mutations in Dravet syndrome and related epileptic encephalopathies are largely of paternal origin.	0.370955127	2010	SCN1A	2	166054717	C	T
rs121918768	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166046931	C	A
rs121918768	19589774	6323	SCN1A	umls:C0751122	UNIPROT	De novo SCN1A mutations in Dravet syndrome and related epileptic encephalopathies are largely of paternal origin.	0.370955127	2010	SCN1A	2	166046931	C	A
rs121918770	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166054710	C	T,A
rs121918770	12821740	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A	2	166054710	C	T,A
rs121918771	12821740	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A	2	166051793	G	A
rs121918772	12821740	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A mutations in severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A;LOC102724058	2	165998133	G	T
rs121918773	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166054672	A	G
rs121918773	14738421	6323	SCN1A	umls:C0751122	UNIPROT	Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB).	0.370955127	2004	SCN1A	2	166054672	A	G
rs121918774	14738421	6323	SCN1A	umls:C0751122	UNIPROT	Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB).	0.370955127	2004	SCN1A	2	166037920	C	G
rs121918775	14738421	6323	SCN1A	umls:C0751122	UNIPROT	Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB).	0.370955127	2004	SCN1A	2	166037886	G	T,A
rs121918775	15944908	6323	SCN1A	umls:C0751122	UNIPROT	Severe myoclonic epilepsy in infancy (SMEI), severe idiopathic generalized epilepsy of infancy (SIGEI) with generalized tonic clonic seizures (GTCS), and myoclonic astatic epilepsy (MAE) may show semiological overlaps.	0.370955127	2005	SCN1A	2	166037886	G	T,A
rs121918775	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037886	G	T,A
rs121918776	14738421	6323	SCN1A	umls:C0751122	UNIPROT	Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB).	0.370955127	2004	SCN1A;LOC102724058	2	166002692	A	G
rs121918777	14738421	6323	SCN1A	umls:C0751122	UNIPROT	Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB).	0.370955127	2004	SCN1A;LOC102724058	2	165992194	T	C
rs121918778	14738421	6323	SCN1A	umls:C0751122	UNIPROT	Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB).	0.370955127	2004	SCN1A;LOC102724058	2	165992200	A	G
rs121918779	14738421	6323	SCN1A	umls:C0751122	UNIPROT	Mutations of neuronal voltage-gated Na+ channel alpha 1 subunit gene SCN1A in core severe myoclonic epilepsy in infancy (SMEI) and in borderline SMEI (SMEB).	0.370955127	2004	SCN1A;LOC102724058	2	165991933	T	C
rs121918780	15087100	6323	SCN1A	umls:C0751122	UNIPROT	Clinical correlations of mutations in the SCN1A gene: from febrile seizures to severe myoclonic epilepsy in infancy.	0.370955127	2004	SCN1A	2	166051928	A	T
rs121918784	16525050	6323	SCN1A	umls:C0751122	UNIPROT	An epilepsy mutation in the sodium channel SCN1A that decreases channel excitability.	0.370955127	2006	SCN1A	2	166039437	G	A
rs121918785	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166039427	C	T
rs121918785	20110217	6323	SCN1A	umls:C0751122	UNIPROT	Four novel SCN1A mutations in Turkish patients with severe myoclonic epilepsy of infancy (SMEI).	0.370955127	2010	SCN1A	2	166039427	C	T
rs121918786	20110217	6323	SCN1A	umls:C0751122	UNIPROT	Four novel SCN1A mutations in Turkish patients with severe myoclonic epilepsy of infancy (SMEI).	0.370955127	2010	SCN1A	2	166037862	C	T
rs121918787	12083760	6323	SCN1A	umls:C0751122	UNIPROT	Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy.	0.370955127	2002	SCN1A	2	166038017	A	C
rs121918788	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037931	G	A
rs121918788	12083760	6323	SCN1A	umls:C0751122	UNIPROT	Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy.	0.370955127	2002	SCN1A	2	166037931	G	A
rs121918789	12083760	6323	SCN1A	umls:C0751122	UNIPROT	Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy.	0.370955127	2002	SCN1A;LOC102724058	2	165999761	A	G
rs121918790	12083760	6323	SCN1A	umls:C0751122	UNIPROT	Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy.	0.370955127	2002	SCN1A;LOC102724058	2	165998165	T	C
rs121918791	12083760	6323	SCN1A	umls:C0751122	UNIPROT	Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy.	0.370955127	2002	SCN1A;LOC102724058	2	165992333	G	A
rs121918792	12083760	6323	SCN1A	umls:C0751122	UNIPROT	Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy.	0.370955127	2002	SCN1A;LOC102724058	2	165992255	C	G
rs121918793	12083760	6323	SCN1A	umls:C0751122	UNIPROT	Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy.	0.370955127	2002	SCN1A;LOC102724058	2	165991549	G	A
rs121918794	12083760	6323	SCN1A	umls:C0751122	UNIPROT	Significant correlation of the SCN1A mutations and severe myoclonic epilepsy in infancy.	0.370955127	2002	SCN1A;LOC102724058	2	166012194	A	G
rs121918795	12754708	6323	SCN1A	umls:C0751122	UNIPROT	De novo SCN1A mutations are a major cause of severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A	2	166037905	G	C
rs121918796	12754708	6323	SCN1A	umls:C0751122	UNIPROT	De novo SCN1A mutations are a major cause of severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A	2	166037847	A	G
rs121918797	12754708	6323	SCN1A	umls:C0751122	UNIPROT	De novo SCN1A mutations are a major cause of severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A;LOC102724058	2	165992293	A	G
rs121918798	12754708	6323	SCN1A	umls:C0751122	UNIPROT	De novo SCN1A mutations are a major cause of severe myoclonic epilepsy of infancy.	0.370955127	2003	SCN1A;LOC102724058	2	165992029	C	T
rs121918800	16458823	6323	SCN1A	umls:C0751122	UNIPROT	Recurrent de novo mutations of SCN1A in severe myoclonic epilepsy of infancy.	0.370955127	2006	SCN1A;LOC102724058	2	166013757	C	G
rs121918803	14504318	6323	SCN1A	umls:C0751122	UNIPROT	The rate of SCN1A mutations in this cohort of SMEI patients suggests that other factors may be important in SMEI.	0.370955127	2003	SCN1A;LOC102724058	2	166009745	C	G
rs121918804	14504318	6323	SCN1A	umls:C0751122	UNIPROT	The rate of SCN1A mutations in this cohort of SMEI patients suggests that other factors may be important in SMEI.	0.370955127	2003	SCN1A;LOC102724058	2	165991632	C	T,G
rs121918805	17507202	6323	SCN1A	umls:C0751122	UNIPROT	The SCN1A gene was screened for mutations in three unrelated Japanese families with generalized epilepsy with febrile seizure plus (GEFS+), febrile seizure with myoclonic seizures, or intractable childhood epilepsy with generalized tonic-clonic seizures (ICEGTC).	0.370955127	2007	SCN1A;LOC102724058	2	166002660	C	T
rs121918806	19589774	6323	SCN1A	umls:C0751122	UNIPROT	De novo SCN1A mutations in Dravet syndrome and related epileptic encephalopathies are largely of paternal origin.	0.370955127	2010	SCN1A;LOC102724058	2	165998166	G	T
rs121918808	18930999	6323	SCN1A	umls:C0751122	UNIPROT	Spectrum of SCN1A gene mutations associated with Dravet syndrome: analysis of 333 patients.	0.370955127	2009	SCN1A;LOC102724058	2	165994164	C	T
rs121918809	19563458	6323	SCN1A	umls:C0751122	UNIPROT	Novel SCN1A mutations in Indonesian patients with severe myoclonic epilepsy in infancy.	0.370955127	2010	SCN1A;LOC102724058	2	165992009	A	C
rs121918810	20392657	6323	SCN1A	umls:C0751122	UNIPROT	Hepatic coma culminating in severe brain damage in a child with a SCN1A mutation.	0.370955127	2010	SCN1A;LOC102724058	2	165992365	A	T
rs121918816	16122630	6323	SCN1A	umls:C0751122	UNIPROT	A missense mutation in SCN1A in brothers with severe myoclonic epilepsy in infancy (SMEI) inherited from a father with febrile seizures.	0.370955127	2005	SCN1A;LOC102724058	2	165992137	C	T
rs138877187	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166045081	G	A,T
rs397514459	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166039428	G	C,A
rs398123579	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166047769	C	G
rs398123580	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166047635	A	-
rs398123584	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166043946	T	C,A
rs398123585	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166043875	G	T,A
rs398123588	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166039436	C	T
rs398123588	24277604	6323	SCN1A	umls:C0751122	BeFree	We previously characterized two Nav1.1 mutants-R859H (GEFS+) and R865G (DS)-at room temperature and reported a mixture of biophysical gating defects that could not easily predict the phenotype presentation as either GEFS+ or DS.	0.370955127	2014	SCN1A	2	166039436	C	T
rs727504140	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166038134	T	C
rs727504142	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166052847	C	G
rs760361423	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166058645	C	A,T
rs764444350	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166073501	T	A,C
rs767045134	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166041293	T	A,C
rs773407463	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166051936	A	C,G
rs786200989	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166039591	-	A
rs794726695	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166047679	A	-
rs794726697	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166038129	G	A
rs794726704	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166044045	A	-
rs794726708	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037843	A	C
rs794726711	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166058616	G	T
rs794726712	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166039424	A	C
rs794726713	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166047721	T	C,A
rs794726714	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037774	AC	-
rs794726715	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037776	C	-
rs794726716	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037846	C	T
rs794726717	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166045045	-	G
rs794726718	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037930	C	T,G
rs794726719	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166052871	C	G
rs794726721	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037994	G	T
rs794726724	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166052884	AGAA	-
rs794726725	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166046948	A	T
rs794726730	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166042334	G	A
rs794726732	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166047661	A	T
rs794726736	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166043974	G	A
rs794726738	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166039488	GC	-
rs794726742	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166041433	C	T,A
rs794726743	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166041385	C	A
rs794726746	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A;LOC102724058	2	166036492	A	C
rs794726747	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166042397	T	A
rs794726749	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166045042	C	A
rs794726750	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166041343	-	GGTC
rs794726751	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166051932	T	-
rs794726753	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166047651	G	T
rs794726755	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166051955	G	T
rs794726756	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A;LOC102724058	2	166036411	TCCTT	-
rs794726761	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166038032	A	G
rs794726762	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166073353	C	T,G
rs794726764	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166056501	G	C
rs794726765	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166047626	C	A
rs794726766	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166041343	G	A
rs794726767	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166047741	CA	-
rs794726768	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166047749	T	C
rs794726771	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166051914	A	G
rs794726772	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037775	C	A
rs794726773	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166045040	T	C
rs794726775	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166039420	T	A
rs794726776	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166046963	GC	-
rs794726777	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166046964	-	T
rs794726778	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166043878	G	A
rs794726782	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166047764	A	G
rs794726786	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166038107	G	T
rs794726787	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166038119	T	-
rs794726788	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166051778	CCATTATAAT	-
rs794726790	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166045189	G	A
rs794726791	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166073437	G	-
rs794726792	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166047682	AAAGCCCAACTGAAGGTATC	-
rs794726793	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166058630	A	G
rs794726794	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166039475	T	C
rs794726795	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166042289	A	T
rs794726796	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166058661	CCTT	-
rs794726797	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166048889	G	A
rs794726798	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166048907	C	T
rs794726799	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166047668	G	A
rs794726803	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166058569	T	C
rs794726805	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166039533	A	C
rs794726806	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166042368	G	-
rs794726807	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166046802	C	A
rs794726808	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037844	TACAGTCCCA	-
rs794726810	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166046846	A	-
rs794726811	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037942	C	A
rs794726812	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166051857	-	TATAC
rs794726813	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A;LOC102724058	2	166036460	T	-
rs794726815	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166038044	A	T
rs794726818	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166046949	TG	-
rs794726820	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166041327	-	A
rs794726823	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037819	C	A
rs794726824	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166048950	C	T
rs794726826	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166046888	G	A
rs794726827	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166054637	C	T,G,A
rs794726828	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037793	C	T
rs794726829	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166045263	TCTG	-
rs794726830	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A;LOC102724058	2	166036496	GA	-
rs794726831	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166058573	T	A
rs794726833	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166054635	T	G
rs794726834	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166043908	C	A
rs794726837	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166051705	A	C
rs794726838	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166043742	G	A
rs794726840	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166056410	C	G
rs794726842	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166037786	C	T
rs794726843	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166048890	C	A
rs794726844	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166047751	T	C
rs794726846	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166051751	-	CA
rs794726847	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166051857	T	G
rs794726848	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166073552	C	T
rs794726849	NA	6323	SCN1A	umls:C0751122	CLINVAR	NA	0.370955127	NA	SCN1A	2	166056451	T	C

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:0)
(Waiting for update.)

Chemical(Total Drugs:0)
(Waiting for update.)

FDA approved drug and dosage information(Total Drugs:0)
(Waiting for update.)

FDA labeling changes(Total Drugs:0)
(Waiting for update.)