PedAM
Pediatric Disease Annotations & Medicines
| clubfoot | ||||
| Disease ID | 654 |
|---|---|
| Disease | clubfoot |
| Integrated Phenotype | (Waiting for update.) |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:19) HP:0001883 | Talipes | 4 HP:0001762 | Talipes equinovarus | 3 HP:0002804 | Arthrogryposis multiplex congenita | 2 HP:0002475 | Myelomeningocele | 1 HP:0003202 | Neurogenic muscle atrophy, especially in the lower limbs | 1 HP:0009826 | limb shortening | 1 HP:0100257 | Cleft hand | 1 HP:0002758 | Osteoarthritis | 1 HP:0012385 | Camptodactyly | 1 HP:0002857 | Genu valgum | 1 HP:0010648 | Dermal translucency | 1 HP:0002650 | Scoliosis | 1 HP:0012531 | Pain | 1 HP:0008138 | Hindfoot equinus | 1 HP:0002064 | Spastic gait | 1 HP:0001159 | Webbed fingers or toes | 1 HP:0100258 | Polydactyly, preaxial | 1 HP:0003418 | Back pain | 1 HP:0003470 | Inability to move | 1 |
| Disease ID | 654 |
|---|---|
| Disease | clubfoot |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
All Snps(Total Genotypes:8) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs104893915 | 11565064 | 1836 | SLC26A2 | umls:C0009081 | BeFree | The probands with talipes deformities or multipartite patella were also screened for the R279W mutation in DTDST. | 0.000271442 | 2001 | SLC26A2 | 5 | 149980428 | C | T |
| rs104893915 | 11565064 | 1836 | SLC26A2 | umls:C1301937 | BeFree | The probands with talipes deformities or multipartite patella were also screened for the R279W mutation in DTDST. | 0.000271442 | 2001 | SLC26A2 | 5 | 149980428 | C | T |
| rs121909109 | NA | 5307 | PITX1 | umls:C0009081 | CLINVAR | NA | 0.562171535 | NA | PITX1;C5orf66 | 5 | 135031290 | C | T |
| rs3731714 | 17534194 | 9360 | PPIG | umls:C0009081 | BeFree | rs3731714 in Casp10 showed linkage with association, suggesting variation in the apoptotic gene pathway, which is important in limb morphogenesis, and may play a role in the development of idiopathic talipes equinovarus. | 0.000542884 | 2007 | CASP10 | 2 | 201196097 | C | T |
| rs730882191 | NA | 5307 | PITX1 | umls:C0009081 | CLINVAR | NA | 0.562171535 | NA | PITX1 | 5 | 135028925 | GAGTGCCGTACGGGCAAGCGCCCGGCGACATGGCC | - |
| rs7969148 | 24667120 | 144348 | ZNF664 | umls:C0009081 | BeFree | Strongest evidence for an association of clubfoot was found with an intergenic SNP on chromosome 12q24.31 between NCOR2 and ZNF664 (rs7969148, OR=0.58, p=1.25×10⁻⁵) that was significant on replication (combined OR=0.63, p=1.90×10⁻⁷). | 0.000271442 | 2015 | ZNF664-FAM101A | 12 | 124129992 | T | C |
| rs7969148 | 24667120 | 9612 | NCOR2 | umls:C0009081 | BeFree | Strongest evidence for an association of clubfoot was found with an intergenic SNP on chromosome 12q24.31 between NCOR2 and ZNF664 (rs7969148, OR=0.58, p=1.25×10⁻⁵) that was significant on replication (combined OR=0.63, p=1.90×10⁻⁷). | 0.000271442 | 2015 | ZNF664-FAM101A | 12 | 124129992 | T | C |
| rs7969148 | 24667120 | 100533183 | ZNF664-FAM101A | umls:C0009081 | GWASCAT | Genome-wide association study identifies new disease loci for isolated clubfoot. | 0.12 | 2015 | ZNF664-FAM101A | 12 | 124129992 | T | C |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:4) | |||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CHR | POS | SNPID | REF | ALT | ORI_SNPID | PMID | P_VALUE | P_VALUE_TEXT | OR/BETA | CI95_TEXT | GWAS_INITIAL_SAMPLE_SIZE | SUB_POPULATION | SUPER_POPULATION | GWAS_TRAIT | HPO_ID | HPO_TERM | DO_ID | DO_TERM | MESH_ID | MESH_TERM | EFO_ID | EFO_TERM | DOLITE_TERM | RISK_ALLELE | PUBLICATION_TYPE | AA | GENE_SYMBOL | TYPE | REFGENE |
| 10 | 108725495 | rs4918273 | C | T | rs4918273 | 24667120 | 1.06E-04 | NA | 1.3 | NA | 396 European ancestry cases; 1,000 European ancestry controls | European(1396) | ALL(1396) | EUR(1396) | ALL(1396) | Clubfoot | HPOID:0001762 | Talipes equinovarus | DOID:11836 | clubfoot | NA | NA | NA | NA | NA | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't | T |
| 11 | 102346586 | rs11225266 | A | C | rs11225266 | 24667120 | 1.15E-05 | NA | 1.77 | NA | 396 European ancestry cases; 1,000 European ancestry controls | European(1396) | ALL(1396) | EUR(1396) | ALL(1396) | Clubfoot | HPOID:0001762 | Talipes equinovarus | DOID:11836 | clubfoot | NA | NA | NA | NA | NA | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't | A |
| 12 | 124614538 | rs7969148 | T | C | rs7969148 | 24667120 | 2.00E-07 | NA | 1.58 | NA | 396 European ancestry cases; 1,000 European ancestry controls | European(1396) | ALL(1396) | EUR(1396) | ALL(1396) | Clubfoot | HPOID:0001762 | Talipes equinovarus | DOID:11836 | clubfoot | NA | NA | NA | NA | NA | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't | T |
| 14 | 89901962 | rs12885505 | T | A | rs12885505 | 24667120 | 2.95E-05 | NA | 1.55 | NA | 396 European ancestry cases; 1,000 European ancestry controls | European(1396) | ALL(1396) | EUR(1396) | ALL(1396) | Clubfoot | HPOID:0001762 | Talipes equinovarus | DOID:11836 | clubfoot | NA | NA | NA | NA | NA | NA | Research Support, N.I.H., Extramural | Research Support, Non-U.S. Gov't | T |
Mapped by lexical matching(Total Items:0) |
|---|
| (Waiting for update.) |
Mapped by homologous gene(Total Items:0) |
|---|
| (Waiting for update.) |
Chemical(Total Drugs:0) | |
|---|---|
| (Waiting for update.) | |
FDA approved drug and dosage information(Total Drugs:0) | |
|---|---|
| (Waiting for update.) | |
FDA labeling changes(Total Drugs:0) | |
|---|---|
| (Waiting for update.) | |