PedAM

Pediatric Disease Annotations & Medicines


	chediak-higashi syndrome

Disease ID	157
Disease	chediak-higashi syndrome
Definition	A form of phagocyte bactericidal dysfunction characterized by unusual oculocutaneous albinism, high incidence of lymphoreticular neoplasms, and recurrent pyogenic infections. In many cell types, abnormal lysosomes are present leading to defective pigment distribution and abnormal neutrophil functions. The disease is transmitted by autosomal recessive inheritance and a similar disorder occurs in the beige mouse, the Aleutian mink, and albino Hereford cattle.
Synonym	anomaly or syndrome, chediak-steinbrinck anomaly or syndrome, chediak-steinbrinck-higashi beguez cesar disease bÃ©guez cÃ©sar disease chediak - steinbrinck anomaly chediak anomaly chediak higashi anomaly chediak higashi syndrome chediak-higashi syndrome (disorder) chediak-higashi syndrome -retired- chediak-higashi syndrome [disease/finding] chediak-steinbrinck anomaly chediak-steinbrinck-higashi syndrome chs chÃ©diak anomaly chÃ©diak-higashi syndrome chÃ©diak-higashi syndrome (disorder) chÃ©diak-steinbrinck anomaly congenital gigantism of peroxidase granules granulation anomaly of leucocytes granulation anomaly of leukocytes granulation anomaly or syndrome, chediak-steinbrinck granulation anomaly or syndrome, chediak-steinbrinck-higashi granulocyte anomaly or syndrome, chediak-steinbrinck granulocyte anomaly or syndrome, chediak-steinbrinck-higashi hereditary gigantism of cytoplasmic organelles hereditary leukomelanopathy oculocutaneous albinism with leukocyte defect steinbrinck anomaly syndrome, chediak-higashi
Orphanet	ORPHANET:167
OMIM	OMIM:214500
DOID	DOID:2935
ICD10	ICD10CM:E70.330
UMLS	C0007965
MeSH	D002609
SNOMED-CT	SNOMEDCT_US_2016_09_01:111396008
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:4) C0031099 \| periodontitis \| 2 C0030486 \| paraplegia \| 1 C0442874 \| neuropathy \| 1 C0078918 \| oculocutaneous albinism \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:1) LYST \| 1130 \| CLINVAR;CTD_human;GHR;ORPHANET;UNIPROT
Inferring Gene	(Waiting for update.)
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:164) 4074 \| M6PR \| DISEASES 5607 \| MAP2K5 \| DISEASES 201294 \| UNC13D \| DISEASES 4627 \| MYH9 \| DISEASES 1511 \| CTSG \| DISEASES 2937 \| GSS \| DISEASES 81027 \| TUBB1 \| DISEASES 26258 \| BLOC1S6 \| DISEASES 6813 \| STXBP2 \| DISEASES 858 \| CAV2 \| DISEASES 6369 \| CCL24 \| DISEASES 727 \| C5 \| DISEASES 4353 \| MPO \| DISEASES 8456 \| FOXN1 \| DISEASES 8929 \| PHOX2B \| DISEASES 3558 \| IL2 \| DISEASES 41 \| ASIC1 \| DISEASES 1839 \| HBEGF \| DISEASES 4015 \| LOX \| DISEASES 5341 \| PLEK \| DISEASES 55509 \| BATF3 \| DISEASES 23682 \| RAB38 \| DISEASES 6659 \| SOX4 \| DISEASES 91574 \| C12orf65 \| DISEASES 2161 \| F12 \| DISEASES 10267 \| RAMP1 \| DISEASES 8546 \| AP3B1 \| DISEASES 53 \| ACP2 \| DISEASES 6926 \| TBX3 \| DISEASES 967 \| CD63 \| DISEASES 6610 \| SMPD2 \| DISEASES 6366 \| CCL21 \| DISEASES 51196 \| PLCE1 \| DISEASES 80208 \| SPG11 \| DISEASES 8766 \| RAB11A \| DISEASES 3674 \| ITGA2B \| DISEASES 671 \| BPI \| DISEASES 3682 \| ITGAE \| DISEASES 7299 \| TYR \| DISEASES 3553 \| IL1B \| DISEASES 1991 \| ELANE \| DISEASES 51430 \| SUCO \| DISEASES 57192 \| MCOLN1 \| DISEASES 4811 \| NID1 \| DISEASES 79083 \| MLPH \| DISEASES 7879 \| RAB7A \| DISEASES 2028 \| ENPEP \| DISEASES 286 \| ANK1 \| DISEASES 429 \| ASCL1 \| DISEASES 65082 \| VPS33A \| DISEASES 3687 \| ITGAX \| DISEASES 3001 \| GZMA \| DISEASES 57105 \| CYSLTR2 \| DISEASES 25836 \| NIPBL \| DISEASES 4286 \| MITF \| DISEASES 23001 \| WDFY3 \| DISEASES 57619 \| SHROOM3 \| DISEASES 3673 \| ITGA2 \| DISEASES 51151 \| SLC45A2 \| DISEASES 7098 \| TLR3 \| DISEASES 94120 \| SYTL3 \| DISEASES 79841 \| AGBL2 \| DISEASES 8435 \| SOAT2 \| DISEASES 2357 \| FPR1 \| DISEASES 140738 \| TMEM37 \| DISEASES 1493 \| CTLA4 \| DISEASES 1602 \| DACH1 \| DISEASES 79029 \| SPATA5L1 \| DISEASES 64805 \| P2RY12 \| DISEASES 4046 \| LSP1 \| DISEASES 5897 \| RAG2 \| DISEASES 9575 \| CLOCK \| DISEASES 51206 \| GP6 \| DISEASES 5340 \| PLG \| DISEASES 6910 \| TBX5 \| DISEASES 8411 \| EEA1 \| DISEASES 10938 \| EHD1 \| DISEASES 7156 \| TOP3A \| DISEASES 2274 \| FHL2 \| DISEASES 55 \| ACPP \| DISEASES 7481 \| WNT11 \| DISEASES 23400 \| ATP13A2 \| DISEASES 6331 \| SCN5A \| DISEASES 10456 \| HAX1 \| DISEASES 9021 \| SOCS3 \| DISEASES 4692 \| NDN \| DISEASES 3916 \| LAMP1 \| DISEASES 340146 \| SLC35D3 \| DISEASES 682 \| BSG \| DISEASES 151888 \| BTLA \| DISEASES 10732 \| TCFL5 \| DISEASES 54821 \| ERCC6L \| DISEASES 1908 \| EDN3 \| DISEASES 5873 \| RAB27A \| DISEASES 3363 \| HTR7 \| DISEASES 85480 \| TSLP \| DISEASES 3762 \| KCNJ5 \| DISEASES 283652 \| SLC24A5 \| DISEASES 108 \| ADCY2 \| DISEASES 53827 \| FXYD5 \| DISEASES 4948 \| OCA2 \| DISEASES 204 \| AK2 \| DISEASES 219844 \| HYLS1 \| DISEASES 30849 \| PIK3R4 \| DISEASES 3482 \| IGF2R \| DISEASES 5625 \| PRODH \| DISEASES 987 \| LRBA \| DISEASES 60 \| ACTB \| DISEASES 6663 \| SOX10 \| DISEASES 23038 \| WDTC1 \| DISEASES 5867 \| RAB4A \| DISEASES 7139 \| TNNT2 \| DISEASES 8676 \| STX11 \| DISEASES 356 \| FASLG \| DISEASES 6375 \| XCL1 \| DISEASES 910 \| CD1B \| DISEASES 912 \| CD1D \| DISEASES 28956 \| LAMTOR2 \| DISEASES 959 \| CD40LG \| DISEASES 4068 \| SH2D1A \| DISEASES 83938 \| C10orf11 \| DISEASES 57158 \| JPH2 \| DISEASES 51552 \| RAB14 \| DISEASES 19 \| ABCA1 \| DISEASES 3108 \| HLA-DMA \| DISEASES 7507 \| XPA \| DISEASES 1740 \| DLG2 \| DISEASES 50943 \| FOXP3 \| DISEASES 1471 \| CST3 \| DISEASES 1910 \| EDNRB \| DISEASES 27237 \| ARHGEF16 \| DISEASES 10497 \| UNC13B \| DISEASES 4739 \| NEDD9 \| DISEASES 387755 \| INSC \| DISEASES 9751 \| SNPH \| DISEASES 7306 \| TYRP1 \| DISEASES 1130 \| LYST \| DISEASES 5077 \| PAX3 \| DISEASES 10203 \| CALCRL \| DISEASES 4773 \| NFATC2 \| DISEASES 2628 \| GATM \| DISEASES 4308 \| TRPM1 \| DISEASES 4644 \| MYO5A \| DISEASES 26960 \| NBEA \| DISEASES 4647 \| MYO7A \| DISEASES 50489 \| CD207 \| DISEASES 4125 \| MAN2B1 \| DISEASES 387836 \| CLEC2A \| DISEASES 6660 \| SOX5 \| DISEASES 7124 \| TNF \| DISEASES 3109 \| HLA-DMB \| DISEASES 139728 \| PNCK \| DISEASES 3920 \| LAMP2 \| DISEASES 8439 \| NSMAF \| DISEASES 3586 \| IL10 \| DISEASES 23218 \| NBEAL2 \| DISEASES 4935 \| GPR143 \| DISEASES 8649 \| LAMTOR3 \| DISEASES 2053 \| EPHX2 \| DISEASES 51271 \| UBAP1 \| DISEASES 3684 \| ITGAM \| DISEASES 11232 \| POLG2 \| DISEASES 8284 \| KDM5D \| DISEASES 768206 \| PRCD \| DISEASES
Locus	(Waiting for update.)

Disease ID	157
Disease	chediak-higashi syndrome
Integrated Phenotype	(Waiting for update.)
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:7) HP:0000704 \| Pyorrhea \| 2 HP:0001263 \| Developmental retardation \| 1 HP:0001258 \| Spastic paraplegia, lower limb \| 1 HP:0002721 \| Immunodeficiency \| 1 HP:0010550 \| Paraplegia \| 1 HP:0001022 \| Achromasia \| 1 HP:0000166 \| Severe periodontal disease \| 1

Disease ID	157
Disease	chediak-higashi syndrome
Manually Symptom	UMLS \| Name(Total Manually Symptoms:4) C1963139 \| hypopigmentation C0149678 \| epstein-barr virus infection C0027947 \| neutropenia C0004623 \| bacterial infection
Text Mined Symptom	(Waiting for update.)

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:42)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs28942077	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235766204	A	T
rs28942077	11857544	1130	LYST	umls:C0007965	UNIPROT	In patients with severe childhood CHS, we found only functionally null mutant CHS1 alleles, whereas in patients with the adolescent and adult forms of CHS we also found missense mutant alleles that likely encode CHS1 polypeptides with partial function.	0.648153188	2002	LYST	1	235766204	A	T
rs370022675	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235809893	G	A,T
rs757222354	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235775041	G	A,T
rs797044534	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235810046	A	G
rs797044535	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235802998	G	A
rs797044536	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235800381	-	G
rs797044537	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235775005	TT	-
rs797044538	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235744148	G	C
rs797044539	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235741499	T	A
rs797044540	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235712150	TTGTAT	-
rs797044541	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235664558	C	A
rs797044542	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235664487	C	T
rs80338642	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235830299	-	C
rs80338643	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235830270	G	A
rs80338644	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235809351	C	-
rs80338645	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235809278	G	A
rs80338646	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235808915	-	T
rs80338647	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235806723	C	-
rs80338648	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235806682	T	-
rs80338649	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235806513	A	-
rs80338650	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235806062	TT	-
rs80338651	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235806051	G	A
rs80338652	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235805826	G	A
rs80338653	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235804624	-	T
rs80338654	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235793567	G	C
rs80338655	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235791881	G	T
rs80338656	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235791968	A	-
rs80338657	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235788701	C	T
rs80338658	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235781018	A	T,G
rs80338659	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235777206	T	-
rs80338660	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235766122	G	T,A
rs80338661	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235755641	CTAATAG	-
rs80338662	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235752077	A	-
rs80338663	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235734590	C	T
rs80338664	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235733859	C	T
rs80338665	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235728076	CGAACTTTCAACTGTATCAGAAGCATTATCTTCCACAAAATACATTCCACATTTAC	-
rs80338666	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235724114	-	ACTGAAAGAA
rs80338667	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235716749	T	-
rs80338668	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235712089	A	-
rs80338669	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235709107	T	C
rs80338670	NA	1130	LYST	umls:C0007965	CLINVAR	NA	0.648153188	NA	LYST	1	235697252	T	-

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:1)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0007513	Generalized hypopigmentation	MP:0005408	hypopigmentation;HP:0000978	Bruising susceptibility

Mapped by homologous gene(Total Items:1)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0002716	Lymphadenopathy	MP:0002420	abnormal adaptive immunity;HP:0000505	Visual impairment

Chemical(Total Drugs:0)
(Waiting for update.)

FDA approved drug and dosage information(Total Drugs:0)
(Waiting for update.)

FDA labeling changes(Total Drugs:0)
(Waiting for update.)